(Hypertension. 1995;26:171-176.)
© 1995 American Heart Association, Inc.
Articles |
Gene Expression of Brain Nitric Oxide Synthase and Soluble Guanylyl Cyclase in Hypothalamus and Medulla of Two-Kidney, One Clip Hypertensive Rats
From the Department of Anatomy and Cell Biology, Faculty of Medicine, University of Alberta, Edmonton, Alberta, Canada (T.L.K.), and the Max Delbrück Center for Molecular Medicine, Berlin-Buch, Germany.
Correspondence to Dr Teresa L. Krukoff, Department of Anatomy and Cell Biology, Faculty of Medicine, University of Alberta, Edmonton, Alberta, Canada T6G 2H7. E-mail tkrukoff@anat.med.ualberta.ca.
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract Nitric oxide may act at autonomic sites in the brain to regulate arterial blood pressure. Our goal was to determine whether gene expressions of the brain isoform of nitric oxide synthase and of the ß subunit of soluble guanylyl cyclase, the target of nitric oxide, were altered in discrete autonomic brain regions after induction of hypertension in rats. The two-kidney, one clip model was used to induce hypertension, and measurements were made 3 and 6 weeks after the left renal artery was clipped. Only experimental rats with blood pressures elevated by at least 25 mm Hg were used. Total RNA was purified from microdissected tissue blocks containing hypothalamus, dorsal medulla, rostral ventrolateral medulla, and caudal ventrolateral medulla. Changes in nitric oxide synthase and guanylyl cyclase mRNA were semiquantified in each region by use of reverse transcription–polymerase chain reactions in which known concentrations of deletion mutants of the two genes were coamplified as internal standards. Compared with controls, significant decreases and increases in nitric oxide synthase mRNA were found in the hypothalamus (x2.2) and caudal ventrolateral medulla (x6.4), respectively, of hypertensive rats 3 weeks after clipping. These alterations were reversed in hypertensive rats at 6 weeks; levels increased (x4.6) in the hypothalamus and decreased (x5.5) in the caudal ventrolateral medulla. Changes in guanylyl cyclase expression paralleled those for nitric oxide synthase in some but not all areas at both time points. Changes in nitric oxide synthase gene expression in the hypothalamus and the so-called depressor caudal ventrolateral medulla support the hypothesis that nitric oxide participates in the response of the central nervous system to increases in blood pressure. Reversal of responses at 6 weeks after clipping may be related to the different phases of hypertension that occur in this model. Finally, while guanylyl cyclase is thought to be the primary target of nitric oxide, regional differences in expression of nitric oxide synthase and soluble guanylyl cyclase suggest that the two genes are differentially regulated in some parts of the brain.
Key Words: nitric oxide • hypertension, Goldblatt • hypothalamus • polymerase chain reaction • guanylate cyclase
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
There is increasing evidence that nitric oxide (NO), a short-lived gas that acts as a nonconventional neurotransmitter,1 plays an important role in the regulation of cardiovascular activity by causing a reduction in sympathetic tone.2 3 Injections of the NO donor sodium nitroprusside into the nucleus of the tractus solitarius (NTS), a medullary center that receives baroreceptor and chemoreceptor information, were shown to produce hypotension and bradycardia.4 Others5 showed that intravenous injections of NG-monomethyl-L-arginine, an inhibitor of NO synthase (NOS), increased arterial pressure and renal nerve sympathetic activity probably by acting on neurons in the NTS6 and that the effect of NO in the NTS may be mediated through the action of the excitatory amino acid L-glutamate.7 The hypothalamus may also be a site at which NO can affect blood pressure because administration of NO donors into this region caused decreases in blood pressure.8 Finally, NOS inhibitors administered at doses that did not affect blood pressure diminished renal excretion of sodium and water, suggesting additional mechanisms through which NO may affect blood pressure.9
The distribution of the brain isoform of NOS (bNOS) is highly localized to discrete regions of the brain; many bNOS-containing areas are also well known for their roles in the regulation of the cardiovascular system. In the hypothalamus, NOS-positive neurons are found primarily in the paraventricular nucleus (PVN) and supraoptic nucleus (SON)10 11 12 13 14 ; the PVN especially is an important integrating center for autonomic information.15 In the medulla, bNOS-producing neurons16 17 and bNOS-containing nerve terminals18 are found in the NTS and the rostral ventrolateral medulla (RVLM), an area known as a pressor region.19 20 21 In addition, the caudal ventrolateral medulla (CVLM), the so-called depressor area, contains bNOS-producing neurons, albeit in smaller numbers than the RVLM.16 17
This study was designed to determine whether bNOS gene expression is altered in the brain during Goldblatt hypertension. Expression of bNOS was measured in regions of the brain documented to be involved in regulation of the arterial pressure. A semiquantitative approach to the polymerase chain reaction (PCR) was used to compare expression of bNOS in these areas from brains of hypertensive and normotensive rats. The two-kidney, one clip (2K1C) model of hypertension was used, and animals were studied at two time points (3 and 6 weeks) corresponding to phases I and II of Goldblatt hypertension.22 In addition, because the soluble isoform of guanylyl cyclase (sGC) is considered to be the primary target molecule of NO,23 we measured the changes in gene expression of the ß subunit of sGC in the same areas to determine whether alterations in gene expression bNOS and sGC occurred in parallel.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Animals
All experiments were carried out according to institutional guidelines of the Max Delbrück Center for Molecular Medicine, Berlin, for use of experimental animals. Male Sprague-Dawley rats (150 to 200 g; Harlan Sprague Dawley Inc) were allowed to acclimatize to the local animal facility environment for 7 days. Rats were housed in threes under a 12-hour light/dark schedule (lights on at 8 AM) at a temperature of 21°C and were given free access to food and water.
Rats in the experimental groups were anesthetized with 4%
-chloralose intraperitoneal (Sigma-Aldrich
Chemie GmbH), and the left renal vessels were exposed through an
incision in the left flank. After a silver clip (2-mm separation) was
placed on the left renal artery, the wound was sutured closed, and the
rats were allowed to recover from anesthesia. Control rats
were treated similarly except that a clip was not placed on the renal
artery. At weekly intervals, blood pressures of rats from all groups
(3- and 6-week clipped groups and their respective control groups) were
measured with standard tail-cuff techniques (Harvard
Apparatus recorder 480, Harvard Apparatus
Ltd). At the end of the experiment, rats were deeply
anesthetized with ether. Brains were removed, quickly frozen on
dry ice, and stored at -70°C until RNA was isolated.
Tissue Blocking and RNA Isolation
Frozen brains were dissected into tissue blocks that included
the hypothalamus, dorsal medulla, RVLM, or CVLM. The following
descriptions of the extent of tissue blocks are made according to
coordinates from Paxinos and Watson24 : hypothalamus:
rostral, 0.6 mm caudal to the bregma; caudal, 2.2 mm caudal to the
bregma; dorsal, 4 mm from the ventral surface; ventral, ventral surface
of the brain; and lateral, 3.5 mm lateral to the midline; dorsal
medulla: rostral, 12.5 mm caudal to the bregma; caudal, 14.8 mm caudal
to the bregma; dorsal, dorsal surface of the brain stem; ventral, 2 mm
from the dorsal surface of the brain stem; and lateral, 2 mm lateral to
the midline; RVLM: rostral, 11.5 mm caudal to the bregma; caudal, 13.4
mm caudal to the bregma; dorsal, 2 mm from the dorsal surface of the
brain stem; ventral, ventral surface of the brain stem; and lateral,
lateral edge of the brain stem; CVLM: rostral, 13.4 mm caudal to the
bregma; caudal, 14.8 mm caudal to the bregma; dorsal, 1.5 mm from the
dorsal surface of the brain stem; ventral, ventral surface of the brain
stem; and lateral, lateral edge of the brain stem.
RNA was isolated from tissue blocks according to the standard lithium chloride method.25 Integrity of the RNA was assessed by gel electrophoresis; concentrations were calculated by spectrophotometric measurement at a wavelength of 260 nm.
Oligonucleotides Used for PCR Primers
We amplified bNOS26 using 19- and 20-mer
oligonucleotides with the following sequences:
TCAACAGCGTCTCCTCCTA (bases 2882 through 2890) as sense primer and
GTCGATCGGCTGAACTTAGG (bases 3364 through 3383) as antisense primer.
These primers yielded a PCR product 502 base pairs (bp) long.
The ß subunit of sGC27 was amplified with 20-mer oligonucleotides with the following sequences: GCTTCAGGACATTGTGATCG (bases 464 through 483) as sense primer and GAGGATGCTATCTGCTTCCG (bases 982 through 1001) as antisense primer. These primers yielded a PCR product 538 bp long.
Reverse Transcription and PCR
The methods of Wang et al28 and Paul et
al29 were used to transcribe total RNA into cDNA. Total
RNA (1 µg) was dis-solved in 20 µL of a reaction mixture
containing 1 mmol/L dATP, dCTP, dTTP, and dGTP; 1 U RNasin
(Boehringer Mannheim GmbH); 100 pmol/L random hexamers
(Boehringer Mannheim GmbH); PCR buffer (final concentrations,
50 mmol/L KCl, 20 mmol/L Tris-HCl [pH 8.4], 3.0 mmol/L
MgCl2, and 10 µg/µL nuclease-free bovine serum
albumin); and 200 U murine leukemia virus reverse transcriptase
(GIBCO BRL). Incubation was carried out at 42°C for 45 minutes; the
temperature of the reaction was then raised to 95°C for 5 minutes to
inactivate the enzyme and finally dropped to 4°C. To amplify the
resulting cDNA, the sample volume was increased to 100 µL with a
solution containing PCR buffer (same final concentrations as above), 8
pmol/L each primer, and 3 U Taq polymerase (GIBCO BRL). The reaction
was run on a Perkin- Elmer/Cetus thermal cycler under the following
conditions for bNOS: denaturation at 94°C for 45 seconds, annealing
at 56°C for 1 minute, and extension at 72°C for 1 minute for 30
cycles. The conditions for sGC were denaturation at 94°C for 45
seconds, annealing at 57°C for 1 minute, and extension at 72°C for
1 minute for 25 cycles. After completion of the reactions, 10 µL
loading buffer (50% glycerol, 10 mmol/L Tris-HCl [pH 8.0], and
0.25% bromphenol blue and xylene cyanol) was added to each sample, and
gel electrophoresis was used to verify amplification products for
the predicted size.
To control for contamination of RNA samples with DNA, two types of reactions were carried out. First, PCR reactions with either set of primers were run directly on samples of RNA. Second, the RNA in samples was destroyed with RNase (Promega); then reverse transcription–PCR reactions were carried out on the sample. Both types of controls were negative, demonstrating that RNA samples contained no DNA that could be amplified by the primers used in this study.
Competitive PCR
Semiquantification of bNOS and sGC mRNA was carried out, with
known concentrations of mutant bNOS and sGC cDNA as internal
standards.
The bNOS mutant was prepared by cloning the 502-bp bNOS PCR product into the pGEM-T Vector System (Promega). A 117-bp fragment was removed with AvaI–HindIII that cut at sites 134 and 251 of the PCR product; the DNA was religated, leaving a mutant product of 385 bp.
A similar approach was used to produce the sGC mutant DNA. The 536-bp PCR product was cloned into the pGEM-T Vector System, and a 96-bp fragment was removed with BglII–DraII that cut at sites 158 and 254 of the PCR fragment. After religation, a mutant product of 440 bp remained. For both bNOS and sGC mutant cDNAs, primer sites were not affected.
The deletion mutant cDNAs were added to the PCR mixture after reverse transcription to compete with the endogenous bNOS and sGC cDNAs. To assess whether linear relationships exist for the competition between the endogenous and mutant cDNAs, two approaches were taken. For bNOS reactions, mutant bNOS cDNA concentrations were kept constant at 20 pg per reaction, and concentrations of wild-type bNOS cDNAs (bNOS in pBlueScript II SK ±)26 were varied (8, 16, 24, 32, and 40 pg per reaction). The reverse was done for sGC reactions. The amounts of endogenous cDNAs were kept constant by combining multiple reverse transcription reactions and using aliquots of the same volume for each PCR reaction; mutant sGC cDNA concentrations were varied (100, 200, 300, 400, and 500 pg per reaction).
To measure bNOS and sGC mRNAs in specific brain tissues, the appropriate concentrations of the mutant cDNAs were determined empirically so that neither the endogenous nor the mutant bNOS or sGC cDNAs completely suppressed the production of the respective endogenous cDNAs. For bNOS, the concentration of mutant cDNA in the reaction was 4 pg; for sGC, 400 pg. Each reaction was then diluted three times, resulting in four tubes per sample, and each series of dilutions was amplified as described above.
Analysis of Data
Relative amounts of bNOS and sGC mRNAs in each sample were
semiquantified according to a modification of the protocol described by
Paul et al.29 Amplification products obtained after
PCR were electrophoretically separated on 2% agarose–1% NuSieve gels
(GIBCO BRL). Images of ethidium bromide–stained bands for bNOS, sGC,
and their respective mutant cDNAs were digitized with The Imager gel
documentation system (Appligene), and the intensities of the bands were
densitometrically measured with the National Institutes of Health
IMAGE 1.44 program. The relation of the intensity of the
endogenous cDNA band to its respective mutant cDNA band
(endogenous cDNAxmutant cDNA-1) was
calculated (no units) for each reaction.
To test for linear correlation of competitiveness between wild-type and mutant cDNAs, the values were subjected to the Pearson product moment correlation test. For brain samples, the dilution sequence for each sample provided four values per sample, which were averaged to obtain one value per sample. The means of the values for samples from each region of the brain were calculated for hypertensive and control rats, and the nonparametric Mann-Whitney U test was used to determine whether results from hypertensive rats were significantly different from those from their controls at the same time point.
For all tests, a value of P<.05 was considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Alterations in Arterial Blood Pressure
Only rats with blood pressures elevated by at least 25 mm Hg were included in the hypertensive group. Blood pressures of rats in the 3-week group were elevated to 183±15 mm Hg (n=5, mean±SEM); those of rats in the 6-week group were elevated to 179±6 mm Hg (n=5). Blood pressures of control rats were 114±3 (n=6) and 120±3 (n=3) in the 3- and 6-week groups, respectively.
Competitive PCR
The correlation coefficient for ratios obtained when
en-dogenous bNOS cDNA concentrations were varied and mutant
bNOS cDNA concentrations were kept constant was .98
(P<.005). When endogenous sGC cDNA
concentrations were kept constant and mutant sGC cDNAs were varied, the
correlation coefficient was -.97 (P<.005). These results
indicate a highly significant linearity in competitiveness between
endogenous and mutant cDNAs for both bNOS and sGC.
bNOS in the Brain
No differences in bNOS mRNA levels were found in the RVLM between
control and experimental rats at either 3 or 6 weeks (data not
shown).
Three weeks after placement of the renal artery clip, bNOS mRNA levels were significantly decreased by a factor of 2.2 (P<.05) in the hypothalamus of hypertensive rats compared with their controls (Fig 1A). These results were reversed at 6 weeks so that levels were significantly increased by a factor of 4.6 (P<.001) in the hypothalamus of hypertensive rats compared with controls (Fig 1A).
|
No significant differences were found in bNOS mRNA levels within the dorsal medulla of hypertensive rats at either 3 or 6 weeks after renal artery clipping relative to their respective controls (Fig 1B).
bNOS mRNA levels were significantly increased by a factor of 6.4 (P<.01) in the CVLM of hypertensive rats compared with their controls 3 weeks after renal artery clipping (Fig 1C). At 6 weeks, mRNA levels were significantly decreased by a factor of 5.5 (P<.02) in hypertensive rats relative to controls (Fig 1C).
sGC in the Brain
No differences in sGC mRNA levels were found in the RVLM between
control and experimental rats at either 3 or 6 weeks (data not
shown).
Results for the hypothalamus showed that expression of sGC was significantly decreased by a factor of 4.3 (P<.05) in hypertensive rats at 3 weeks compared with their controls (Fig 2A). At 6 weeks, the trend to a reduction in sGC mRNA levels remained, but the results did not reach significance (Fig 2A).
|
No significant difference was found in sGC mRNA levels within the dorsal medulla of hypertensive rats 3 weeks after clipping (Fig 2B). After 6 weeks, on the other hand, a significant decrease (x5.4, P<.01) in sGC expression compared with controls was found (Fig 2B).
As for the dorsal medulla, no difference was found in sGC expression within the CVLM of hypertensive rats compared with their controls after 3 weeks (Fig 2C), but a significant decrease (x2.6, P<.02) occurred within the CVLM of hypertensive rats 6 weeks after placement of the renal artery clip (Fig 2C).
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The results of this study show that, especially in the hypothalamus and CVLM, alterations in gene expression of bNOS and the ß subunit of sGC occur in response to elevation of blood pressure with the 2K1C model of hypertension. To the best of our knowledge, this is the first demonstration of an association between expression of bNOS in the brain and hypertension.
The semiquantitative PCR technique used to measure changes in bNOS and sGC mRNA levels has the advantage of an internal standard within each reaction.29 In this approach, known amounts of mutant cDNA are added to the reaction. This cDNA contains the same primer sequence so that competitive coamplification of the endogenous and mutant cDNAs occurs. Use of the same primer hybridization kinetics for both cDNAs ensures identical amplification efficiencies,28 30 and we have demonstrated the linear competitiveness between endogenous and mutant cDNAs. Using a dilution series of the coamplification products to calculate a final ratio value between the endogenous and mutant cDNA minimizes the effect of sample-to-sample variations, thereby increasing the accuracy of the technique.29 This technique is particularly advantageous for measuring changes in mRNA (compared with Northern blot analysis, for example) in areas where only small numbers of neurons express a particular gene. This point is illustrated in the present study when one considers the CVLM. Whereas only small numbers of neurons in this region express bNOS,17 we have shown that expression of bNOS is indeed altered in this small population of cells in response to hypertension.
Compared with their controls, levels of bNOS mRNA were decreased in the hypothalamus of hypertensive rats 3 weeks after clipping. While smaller numbers of bNOS-producing neurons are found in the dorsomedial, ventromedial, lateral, and mammillary nuclei of the hypothalamus,12 31 all of which would be included in the tissue blocks used in the present study, the majority of bNOS neurons are found in the PVN and SON.10 11 12 13 14 Therefore, it is reasonable to assume that the changes in bNOS expression that we have measured are due, at least in part, to alterations in bNOS mRNA levels within the PVN and/or SON. The underlying physiological processes responsible for these changes are, in all likelihood, complex because the PVN especially is involved in several related but distinct autonomic functions.15 For example, NO production may be related to the release of vasopressin into the portal circulation because it has been shown that NO may stimulate release of vasopressin.32 The PVN and SON contain the highest concentration of vasopressin-producing neurons in the brain, so a decrease in NO production may indicate an attempt by the system to decrease vasopressin production and/or release. This suggestion agrees with the evidence showing that blockade of vasopressin in 2K1C hypertensive rats causes a drop in arterial pressure.33 34 Alternatively, a decrease in bNOS expression in hypothalamus at 3 weeks may indicate decreased output from this area and a concomitant decrease in sympathetic output.
Interestingly, the results obtained for the hypothalamus after 6 weeks of hypertension were reversed from the results obtained after 3 weeks so that bNOS expression was increased compared with controls. Although the reason for this reversal is not apparent, one suggestion is that this shift is related to the different phases of hypertension in the 2K1C model. The first phase of Goldblatt hypertension, to which our 3-week group belongs,35 is clearly dependent on the renin-angiotensin system.22 The second phase, to which our 6-week group belongs, is less dependent on an elevated renin-angiotensin system and more dependent on hemodynamic changes, including salt and water retention as the kidneys attempt to normalize renal plasma flow and glomerular filtration rate.22 The way in which hypothalamic NO may participate in the two phases of 2K1C hypertension awaits further investigation. Measurements of changes in bNOS mRNA in other models of hypertension should help to clarify this issue.
A significant increase in bNOS expression was found in the CVLM of rats whose renal arteries were clipped at 3 weeks compared with their controls. These results agree with the role of this area as a depressor center. In addition to other neuroactive substances, catecholamines are thought to act as neurotransmitters in this process,19 20 21 and while NOS-producing and catecholaminergic neurons are generally separate populations,16 17 36 the proximity of these neuronal populations to one another suggests that the NO produced in the CVLM could diffuse to and affect the nearby catecholaminergic neurons.
As described for the hypothalamus, the results obtained for the CVLM after 6 weeks of hypertension were reversed from the results obtained after 3 weeks so that a decrease in bNOS mRNA levels was found at 6 weeks relative to controls. While the reason for this shift may again be related to the different phases of hypertension within which the two groups fall, the mechanism underlying the shift awaits further investigation.
There were no differences in the expression of bNOS in the dorsal medulla, including the NTS, between hypertensive and control rats at 3 or 6 weeks after clipping. In addition, no differences in bNOS or sGC gene expression were found in the RVLM of hypertensive rats at 3 or 6 weeks compared with their controls. This latter finding is not surprising because the RVLM is a known pressor area, and stimulation of neurons in this region raises blood pressure.19 20 21
The action of NO is thought to occur through the activation of sGC,37 38 which then leads to cGMP production.23 39 Therefore, we measured gene expression in the same areas as bNOS to determine whether the changes in bNOS gene expression would be paralleled by changes in sGC expression. In some cases (hypothalamus at 3 weeks and CVLM at 6 weeks), the changes in gene expression of sGC compared with controls paralleled those for bNOS. In other cases (hypothalamus at 6 weeks, dorsal medulla at 6 weeks, and CVLM at 3 weeks), sGC gene expression did not change or changed in the opposite direction from that of bNOS. Therefore, these differences in expression of bNOS and sGSß suggest that the two genes are differentially regulated. Indeed, other examples in the literature suggest the dissociation of bNOS and sGC gene regulation, and clear dissociations of mRNAs for the two genes have been found not only in adult brain but also during ontogeny.31 Furthermore, the locations of bNOS- and sGC-producing neurons in the brain are not always overlapping. For example, little sGC has been found in neurons of the PVN and SON,40 where some of the highest concentrations of NOS neurons are found. Finally, it has been suggested that sGC may not be the only receptor/target for NO, and a possible alternate pathway for the action of NO may involve reactions with membrane-bound thiol groups on the N-methyl-D-aspartate receptor/channel complex.1 41
To the best of our knowledge, this is the first demonstration of alterations in gene expression of bNOS and sGC in association with hypertension. In a recent study, no differences in bNOS levels were found in whole cortex, cerebellum, or brain stem among spontaneously hypertensive rats, stroke-prone spontaneously hypertensive rats, and control rats,42 but tissue blocks used in this study may have been too large to discern alterations in bNOS in small populations of cells if they were present. We believe that the changes described here for bNOS are due to increases in gene expression within neurons that normally express these genes and not to recruitment of new populations of neurons, because preliminary evidence indicates that numbers of hypothalamic and medullary neurons immunoreactive for bNOS are not changed in 2K1C hypertensive rats 3 weeks after clipping of the renal artery (T.L. Krukoff, unpublished data, 1995).
In conclusion, this study has shown that, compared with their respective controls, gene expression of bNOS is altered in the hypothalamus and CVLM of 2K1C hypertensive rats 3 and 6 weeks after clipping of the renal artery. Alterations in sGC gene expression also occurred but not always in parallel with those for bNOS. These results provide evidence that NO production is altered in response to changes in arterial blood pressure and suggest that bNOS and sGC gene expression may be differentially regulated in some parts of the brain.
|
Acknowledgments |
|---|
This work was supported by the Medical Research Council of Canada and the Bundesministerium für Forschung und Technik. We thank Drs Jack Jhamandas, Bruce Stevenson, and Theodor Petrov for their critical comments about the manuscript. The technical and statistical assistance of Eway Chan and Dr Gerald Buzzell, respectively, is appreciated.
Received January 18, 1995; first decision February 22, 1995; accepted April 24, 1995.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Schuman EM, Madison DV. Nitric oxide and synaptic function. Annu Rev Neurosci. 1994;17:153-183. [Medline] [Order article via Infotrieve]
2.
Togashi H, Sakuma I, Yoshioka M, Kobayashi T, Yasuda
H, Kitabake A, Saito H, Gross SS, Levi R. A central nervous
system action of nitric oxide in blood pressure regulation.
J Pharmacol Exp Ther. 1992;262:343-347.
3. Dinerman JL, Lowenstein CJ, Snyder SH. Molecular mechanisms of nitric oxide regulation: potential relevance to cardiovascular disease. Circulation. 1993;73:217-222.
4. Lewis SJ, Ohta H, Machado B, Bates JN, Talman WT. Microinjection of S-nitrosocysteine into the nucleus tractus solitarii decreases arterial pressure and heart rate via activation of soluble guanylate cyclase. Eur J Pharmacol. 1991;202:135-136. [Medline] [Order article via Infotrieve]
5.
Sakuma I, Togashi H, Yoshida M, Saito H, Yanagida M,
Tamura M, Kobayashi T, Yasuda H, Gross SS, Levi R.
NG-methyl-L-arginine,
an inhibitor of L-arginine–derived nitric
oxide synthesis, stimulates renal sympathetic nerve activity in vivo: a
role for nitric oxide in the central regulation of sympathetic
tone? Circ Res. 1992;70:607-611.
6.
Harada S, Okunaga S, Momohara M, Masaki H, Tagawa T,
Imaizumi T, Takeshita A. Inhibition of nitric oxide formation in
the nucleus tractus solitarius increases renal sympathetic nerve
activity in rabbits. Circ Res. 1993;72:511-516.
7. DiPaola ED, Vidal MN, Nistico G. L-Glutamate evokes the release of an endothelium-derived relaxing factor-like substance from the rat nucleus tractus solitarius. J Cardiovasc Pharmacol. 1991;17:5269-5272.
8.
Horn T, Smith PM, McLaughlin BE, Bauce L, Marks GS,
Pittman QJ, Ferguson AV. Nitric oxide actions in
paraventricular nucleus: cardiovascular and
neurochemical implications. Am J Physiol. 1994;266:R306-R313.
9.
Lahera V, Salom MG, Miranda-Guardiola F, Moncada S,
Romero VC. Effects of
NG-nitro-L-arginine
methylester on renal function and blood pressure. Am J
Physiol. 1991;261:F1033-F1037.
10. Bredt DS, Hwang PM, Snyder SH. Localization of nitric oxide synthase indicating a neural role for nitric oxide. Nature. 1990;347:768-770. [Medline] [Order article via Infotrieve]
11. Arévalo R, Sánchez F, Alonso JR, Carretero J, Vázquez R, Aijón J. NADPH-diaphorase activity in the hypothalamic magnocellular neurosecretory nuclei of the rat. Brain Res Bull. 1992;28:599-603. [Medline] [Order article via Infotrieve]
12. Vincent SR, Kimura H. Histochemical mapping of nitric oxide synthase in the rat brain. Neuroscience. 1992;46:755-784. [Medline] [Order article via Infotrieve]
13. Miyagawa A, Okamura H, Ibata Y. Coexistence of oxytocin and NADPH-diaphorase in magnocellular neurons of the paraventricular and the supraoptic nuclei of the rat hypothalamus. Neurosci Lett. 1994;171:13-16. [Medline] [Order article via Infotrieve]
14. Sánchez F, Alonso JR, Arévalo R, Blanco E, Aijón J, Vázquez R. Coexistence of NADPH-diaphorase with vasopressin and oxytocin in the hypothalamic magnocellular neurosecretory nuclei of the rat. Cell Tissue Res. 1994;276:31-34. [Medline] [Order article via Infotrieve]
15. Swanson LW, Sawchenko PE. Hypothalamic integration: organization of the paraventricular and supraoptic nuclei. Annu Rev Neurosci. 1983;6:269-324. [Medline] [Order article via Infotrieve]
16. Dun NJ, Dun SL, Förstermann U. Nitric oxide synthase immunoreactivity in rat pontine medullary neurons. Neuroscience. 1994;59:429-445. [Medline] [Order article via Infotrieve]
17. Ohta A, Takagi H, Matsui T, Hamai Y, Iida S, Esumi H. Localization of nitric oxide synthase-immunoreactive neurons in the solitary nucleus and ventrolateral medulla oblongata of the rat: their relation to catecholaminergic neurons. Neurosci Lett. 1993;158:33-35. [Medline] [Order article via Infotrieve]
18. Lü Y, King Y-Q, Qin B-Z, Li J-S. The distribution and origin of axon terminals with NADPH diaphorase activity in the nucleus of the solitary tract of the rat. Neurosci Lett. 1994;171:70-72. [Medline] [Order article via Infotrieve]
19. Ciriello J, Caverson MM, Polosa C. Function of the ventrolateral medulla in the control of the circulation. Brain Res Dev Brain Res. 1986;11:359-391.
20. Calaresu FR, Yardley CP. Medullary basal sympathetic tone. Annu Rev Physiol. 1988;50:511-524.[Medline] [Order article via Infotrieve]
21. Ruggiero DA, Cravo SL, Arango V, Reis DJ. Central control of the circulation by the rostral ventrolateral reticular nucleus: anatomical substrates. Prog Brain Res. 1989;81:49-79. [Medline] [Order article via Infotrieve]
22.
Martinez-Maldonado M. Pathophysiology of
renovascular hypertension. Hypertension. 1991;17:707-719.
23. Garthwaite J, Charles SL, Chess-Williams R. Endothelium-derived relaxing factor release on activation of NMDA receptors suggests role as intercellular messenger in the brain. Nature. 1988;336:385-388. [Medline] [Order article via Infotrieve]
24. Paxinos G, Watson C. The Rat Brain in Stereotaxic Coordinates. 2nd ed. New York, NY: Academic Press Inc; 1986.
25. Auffray C, Rougeon F. Purification of mouse immunoglobulin heavy chain mRNAs from total myeloma tumor RNA. Eur J Biochem. 1980;18:303-314.
26. Bredt DS, Hwang PM, Glatt CE, Lowenstein C, Reed RR, Snyder SH. Cloned and expressed nitric oxide synthase structurally resembles cytochrome P-450 reductase. Nature. 1991;351:714-718. [Medline] [Order article via Infotrieve]
27. Nakane M, Saheki S, Kuno T, Ishii K, Murad F. Molecular cloning of a cDNA coding for 70 kilodalton subunit of soluble guanylyl cyclase from rat lung. Biochem Biophys Res Commun. 1988;157:1139-1147. [Medline] [Order article via Infotrieve]
28.
Wang AM, Doyle MV, Mark DF. Quantification of
mRNA by the polymerase chain reaction. Proc Natl Acad Sci
U S A. 1989;86:9717-9721.
29. Paul M, Wagner J, Dzau VJ. Gene expression of the renin-angiotensin system in human tissues: quantitative analysis by the polymerase chain reaction. J Clin Invest. 1993;91:2058-2064.
30. Gilliland G, Perrin S, Bunn HF. Competitive PCR. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR Protocols: A Guide to Methods and Applications. San Diego, Calif: Academic Press Inc; 1990:60-69.
31. Giuili G, Luzi A, Poyard M, Guellaën G. Expression of mouse brain soluble guanylyl cyclase and NO synthase during ontogeny. Dev Brain Res. 1994;81:269-283. [Medline] [Order article via Infotrieve]
32. Ota M, Crofton JT, Fastavan GT, Share L. Evidence that nitric oxide can act centrally to stimulate vasopressin release. Neuroendocrinology. 1993;57:955-959. [Medline] [Order article via Infotrieve]
33.
Mohring J, Mohring B, Petri M, Maack D. Plasma
vasopressin concentrations and effects of vasopressin antiserum on
blood pressure in rats with malignant two-kidney Goldblatt
hypertension. Circ Res. 1978;42:17-22.
34.
Ichikawa I, Ferrone RA, Duchin DL, Manning M, Dzau VJ,
Brenner BM. Relative contribution of vasopressin and
angiotensin II to the altered renal microcirculatory
dynamics in two-kidney Goldblatt hypertension.
Circ Res. 1983;53:592-602.
35. Gauquelin-GU, Schiffrin EL, Cantin M, Garcia R. Atrial natriuretic factor: specific binding to renal glomeruli during the development of two-kidney, one clip hypertension in the rat. J Hypertens. 1988;6:587-592. [Medline] [Order article via Infotrieve]
36. Iadecola C, Faris PL, Harman BK, Xu X. Localization of NADPH diaphorase in neurons of the rostral ventral medulla: possible role of nitric oxide in central autonomic regulation and oxygen chemoreception. Brain Res. 1993;603:173-179. [Medline] [Order article via Infotrieve]
37.
Arnold WP, Mittal CK, Katsuko S, Murad F. Nitric
oxide activates gyanylate cyclase and increases guanosine
3':5'-cyclic
monophosphate levels in various tissue preparations. Proc
Natl Acad Sci U S A. 1977;74:3203-3207.
38. Miki N, Kawabe Y, Kuriyama K. Activation of cerebral guanylate cyclase by nitric oxide. Biochem Biophys Res Commun. 1977;75:851-856. [Medline] [Order article via Infotrieve]
39. Garthwaite J. Glutamate, nitric oxide and cell-cell signalling in the nervous system. Trends Neurosci. 1991;14:60-67. [Medline] [Order article via Infotrieve]
40. Burgunder J-M, Cheung PT. Expression of soluble guanylyl cyclase gene in adult rat brain. Eur J Neurosci. 1994;6:211-217. [Medline] [Order article via Infotrieve]
41. Lei SZ, Pan Z-H, Aggarwal SK, Chen H-SV, Hartman J, Sucher NJ, Lipton SA. Effect of nitric oxide production on the redox modulatory site of the NMDA receptor-channel complex. Neuron. 1992;8:1087-1099. [Medline] [Order article via Infotrieve]
42. Clavier N, Tobin FR, Kirsch JR, Izuta M, Traystman RJ. Brain nitric oxide synthase activity in normal, hypertensive, and stroke-prone rats. Stroke. 1994;25:1674-1678.[Abstract]
This article has been cited by other articles:
 |
|
 |
|
  C. Dechow, C. Morath, J. Peters, I. Lehrke, R. Waldherr, V. Haxsen, E. Ritz, and J. Wagner Effects of all-trans retinoic acid on renin-angiotensin system in rats with experimental nephritis Am J Physiol Renal Physiol, November 1, 2001; 281(5): F909 - F919. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. E. De Wardener The Hypothalamus and Hypertension Physiol Rev, October 1, 2001; 81(4): 1599 - 1658. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Ruetten, U. Zabel, W. Linz, and H. H. H. W. Schmidt Downregulation of Soluble Guanylyl Cyclase in Young and Aging Spontaneously Hypertensive Rats Circ. Res., September 17, 1999; 85(6): 534 - 541. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Zanzinger Role of nitric oxide in the neural control of cardiovascular function Cardiovasc Res, August 15, 1999; 43(3): 639 - 649. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. WAGNER, F. GEHLEN, A. CIECHANOWICZ, and E. RITZ Angiotensin II Receptor Type 1 Gene Expression in Human Glomerulonephritis and Diabetes Mellitus J. Am. Soc. Nephrol., March 1, 1999; 10(3): 545 - 551. [Abstract] [Full Text]
|
|
|
|
 |
|
 M. Kadekaro, M. L. Terrell, H. Liu, S. Gestl, V. Bui, and J. Y. Summy-Long Effects of L-NAME on cerebral metabolic, vasopressin, oxytocin, and blood pressure responses in hemorrhaged rats Am J Physiol Regulatory Integrative Comp Physiol, April 1, 1998; 274(4): R1070 - R1077. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Takeda, I. Miyamori, T. Yoneda, K. Furukawa, S. Inaba, R. Takeda, and H. Mabuchi Brain Nitric Oxide Synthase Messenger RNA in Central Mineralocorticoid Hypertension Hypertension, October 1, 1997; 30(4): 953 - 956. [Abstract] [Full Text]
|
|
|
|
|
|
M. Sander, J. Hansen, and R. G. Victor The Sympathetic Nervous System Is Involved in the Maintenance but Not Initiation of the Hypertension Induced by N{omega}-Nitro-L-Arginine Methyl Ester Hypertension, July 1, 1997; 30(1): 64 - 70. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||