(Hypertension. 1996;27:558-563.)
© 1996 American Heart Association, Inc.
Articles |
Polymorphisms of Renin-Angiotensin Genes Among Nigerians, Jamaicans, and African Americans
From the Department of Preventive Medicine and Epidemiology, Loyola University Stritch School of Medicine, Maywood, Ill (C.R., A.P., R.C.); the Tropical Metabolism Research Unit, University of the West Indies, Mona, Jamaica (N.M.-A., T.F.); University College Hospital, Ibadan, Nigeria (O.O.); and the Department of Human Genetics, University of Utah, Salt Lake City (L.M., R.W.).
 |
Abstract |
|---|
 Top Abstract IntroductionMethods Results Discussion References |
|---|
Abstract Within the context of an international collaborative study of the evolution of hypertension in the black diaspora, we determined the allelic distribution of hypertension candidate genes for the renin-angiotensin system in three populations of African origin. The insertion/deletion (I/D) polymorphism of the angiotensin-converting enzyme (ACE) and the M235T and T174M variants of the angiotensinogen (AGT) gene were examined in individuals from Nigeria, Jamaica, and the United States. Large differences in the prevalence of hypertension were recorded in door-to-door surveys, ranging from 16% in Nigeria to 33% in the United States. The frequency of the D allele was similar in all groups (54%, 59%, and 63% in Nigeria, Jamaica, and the United States, respectively). The 235T allele of the AGT gene was found in 81% of US and Jamaican blacks and 91% of Nigerians; very little variation was seen for the T174M marker. Despite large differences in hypertension rates, genetic variation at the index loci among these groups was modest. Overall, the frequency of the ACE*D allele was only slightly higher than that reported for European and Japanese populations, whereas the AGT 235T allele was twice as common. Compared with blacks in the western hemisphere, Nigerians had a higher frequency of the 235T allele, which is consistent with 25% European admixture in Jamaica and the United States. The results indicate the potential for etiologic heterogeneity in genetic factors related to hypertension across ethnic groups while suggesting that environmental exposures most likely explain the gradient in risk in the comparison among black populations.
Key Words: angiotensinogen • angiotensin-converting enzyme • genetics • hypertension, genetic • blacks
|
Introduction |
|---|
|
TopAbstractIntroductionMethods Results Discussion References |
|---|
Hypertension prevalence rates vary markedly among the genetically related black populations of West Africa, the Caribbean, and the United States.1 2 3 4 Although this differential must be primarily a result of varying levels of exposure to environmental risk factors, the extent to which genetic factors also play a role is undetermined.1 The importance of the role of the components of the RAS in the pathogenesis of cardiovascular disease is now well documented,5 6 7 and DNA polymorphisms of the genes for the RAS have been extensively examined as candidate loci for hypertension and coronary heart disease.8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27
An important aspect of the RAS as a model system for hypertension research is the availability of physiological intermediates that make it possible to define the activity of the system at each level. Consistent evidence now links increased activity of several components of the RAS as a contributing factor in hypertension.8 9 10 11 12 13 14 15 16 17 18 Plasma AGT, the substrate for the RAS, has been shown to be correlated with blood pressure and is increased in the offspring of hypertensive subjects compared with normotensive subjects.8 9 Evidence of genetic linkage has also been demonstrated between the M235T and T174M molecular variants of the AGT gene, plasma AGT level, and hypertension.10 11 12 13 14 Similarly, the I/D polymorphism in the ACE gene influences circulating ACE concentrations15 16 17 18 and in some studies has been associated with increased risk for myocardial infarction and left ventricular hypertrophy.19 20 21 22 23 24 A less consistent finding has been reported in relation to this ACE polymorphism and hypertension.25 26 27 28 29 30 31 32 33 34 35 36 37 We have recently described consistent if quantitatively weak relationships among the ACE I/D polymorphism, serum ACE activity, AGI level, and blood pressure among Jamaicans.17 These findings suggest that the RAS would be a useful physiological mechanism to study in attempting to unravel the genetic underpinnings of hypertension.
The evolution of hypertension risk among populations of the African diaspora remains poorly understood.1 In the course of an international collaborative study on the evolution of hypertension risk among blacks,38 we examined the population frequency of these genetic polymorphisms in the RAS. These data were obtained to characterize genetic resemblance among these populations at a set of hypertension candidate loci and help determine the feasibility of association and linkage studies within each group.
|
Methods |
|---|
|
TopAbstractIntroductionMethods Results Discussion References |
|---|
Participants
The frequency of the targeted RAS alleles was determined among residents of Nigeria, Jamaica, and the United States. Nigerian participants included men and women recruited from a traditional Yoruba community (Idikan) in Ibadan, Nigeria, as part of an ongoing community survey38 and a small number of patients attending the general outpatient clinic of the University College Hospital, Ibadan. Patients were not recruited specifically because of hypertension status, although some of these individuals had been diagnosed as hypertensive. Jamaican participants were identified during a house-to-house survey of three enumeration districts in the Kingston and St Andrew metropolitan areas of Jamaica.17 Subjects were recruited from the top and bottom of the blood pressure distribution in roughly equal proportions. These three districts were identified as being representative of the population demographics of Jamaica. Black ethnicity was determined on the basis of at least three of four grandparents of predominantly African origin.
The US participants were recruited from an ongoing population survey of hypertension in the village of Maywood, Ill, a suburb of Chicago.38 Blocks were randomly selected and a representative sample was drawn with the probability-proportional-to-size method. Both hypertensive and normotensive individuals were recruited in this site in proportion to their prevalence in the population. Ethnicity was based on self-identification.
Hypertension prevalence varied across the three study sites; for example, a larger percentage of participants in the US sample were hypertensive. However, the percentage of hypertensive subjects in each site was proportional to that found in the respective general populations.
The protocol for the study was reviewed and approved by the human subjects committee at each institution.
For the purposes of comparison, data on allele and, if available, genotype frequencies at the loci of interest were abstracted from other published studies. Whenever possible, the sampling methods and the type of patients enrolled were specified; unfortunately, it was not always possible to make this determination on the basis of the information given. In addition, in a report32 that included a sample of Samoans and Yanomami, the number of individuals examined was small, and if the surveys were restricted to a single community, related individuals may have been studied; these data were therefore omitted from the comparisons.
Blood Collection and DNA Extraction
A 10-mL sample of venous
blood was obtained from subjects at
each of the three sites. The buffy coat was separated by
centrifugation of EDTA blood at 800 to 900g
for 10 minutes and stored at -70°C until shipment to the
Department of Human Genetics at the University of Utah. Genomic DNA was
extracted from the buffy coat according to standard methods.
Identification of ACE (I/D)
Genotype
The 287-bp I/D polymorphism in intron 16 of the
ACE gene was examined by PCR.39 40 After
amplification, the products were loaded on a 1.5% agarose gel
containing EtBR and electrophoresed at 100 V for 1 hour; the resulting
fragment was visualized under UV light. Genotypes were scored
as a function of fragment sizes. We also reamplified all apparent DD
homozygotes using an Alu-specific primer and a primer that
spans the Alu insertion site.41 These
procedures ensured against misclassifying heterozygotes as homozygotes
(because of preferential amplification of the shorter ancestral
allele). A dot blot procedure was also performed to rule out any
further ambiguity by use of a wild-type allele probe that spans
the insertion sequence and a mutant allele probe that is
complementary to the characteristic Alu repeat
motif.40
Identification of AGT Variants
We used the first set
of second exon primers described by
Jeunemaitre et al10 and followed their PCR protocol, as
previously described.42 In brief, after amplification, the
DNA was denatured and 100 mL of the denatured DNA was spotted onto each
of two nylon membranes (wild type and mutant). The blots were
neutralized, the DNA was cross-linked to the membrane, and each
membrane was hybridized overnight with one of the following
radiolabeled probes: GGCTCCCATCAGGGAGC (wild type=235-Met) and
GCTCCCTGACGGGAGCC (mutant=235-Thr). Autoradiographs were obtained and
the presence or absence of the 235-Met and 235-Thr alleles was
scored from each blot. Homozygotes were defined by exhibiting a spot on
only one of the membranes, whereas heterozygotes had spots on both
membranes. Each membrane was then denatured to strip the 235 probe and
rehybridized with the following probes for the 174 variants:
CTGCTGTCCACGGTGGTGGGC (wild type=174-Thr) and CTGCTGTCCATGGTGGTGGGC
(mutant=174-Met). Autoradiographs were then obtained and the membranes
scored to identify genotypes as above.
GT Repeats
Genotypes of the dinucleotide repeat
located in the AGT 3' flanking region were determined by PCR
amplification followed by denaturing gel electrophoresis as described
by Jeunemaitre et al.10
Statistical Analyses
Differences in the distribution of
genotypes between
groups were determined by the 
2 procedure.
Statistical significance occurred if a computed two-tailed
probability value was less than 5% (P<.05).
|
Results |
|---|
|
TopAbstractIntroductionMethods Results Discussion References |
|---|
The findings of the prevalence surveys from which participants were recruited have been described in detail elsewhere (References 38 and 43 and unpublished observations). Age-adjusted rates of hypertension in the study populations ranged from 10% in Nigeria to 33% in the United States (Figure
).
|
The results of the ACE genotype analysis as
defined by the I/D polymorphism are shown in Table 1.
The frequency of the D allele was similar in the three black
populations, with a slight stepwise increase from Nigeria (54%) to
Jamaica (59%) to the United States (63%). However, none of the
computed 2 statistics that compared the
genotype frequency across sites reached significance.
|
The genotype and allele frequencies of the AGT
variants are displayed in Tables 2 and 3. The
235T variant had the highest prevalence in the Nigerian sample (91%)
and was at a lower level among the US and Jamaican participants (81%),
which is consistent with the amount of European admixture that
has occurred in these populations. There was no significant
among-group variation in the frequency of the T174 M
allele (Table 3).
|
The genetic relatedness of the populations was further examined by
analysis of a microsatellite marker at the AGT
locus. The distribution of GT repeat sequences was very similar across
groups (Table 4).
|
For comparison, an overview was performed of data reported in other
major population groups. The observed frequency of the D allele in
the black populations studied in our surveys was similar to that
reported among Europeans (Table 5). The allele frequency
observed among the Nigerian participants was consistent with
estimates from a recently published study32 of working
class individuals recruited from the same metropolitan area of Nigeria.
To provide a summary overview, data from studies of European, Asian,
and African populations were pooled (Table 6). Overall, the
D allele was just slightly more common among African-origin
populations, with no other groups reaching a frequency of 60%. Among
the Asian groups in particular, the D allele was less common
(P<.01). Several caveats should be expressed regarding
these comparisons, however. Some of the series listed here
represent patients with cardiovascular disease,
among whom this allele may be more common.
|
|
Among Europeans, the 235T allele was about half as common as that
among blacks (Table 7). A summary analysis of these
data suggested that the European population was a clear outlier, and a
significant difference in allele frequency was also apparent
between the Nigerian and Japanese samples (Table 8). The
frequency was similar among the Japanese and western hemisphere blacks.
In contrast, the frequency of the 174M allele among whites was
approximately twice the value previously reported for blacks (range,
5% to 8%; Table 9). Again, the summary analysis
demonstrated clear heterogeneity among the European and
African-origin population samples (Table 10).
|
|
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethods Results Discussion References |
|---|
Considerable evidence now suggests that genes of the RAS may condition risk for cardiovascular disease. The frequency of the I/D polymorphism of the ACE gene observed in these black populations is similar to previously reported estimates among Europeans and is higher than that among Asians. Although the findings are not entirely consistent, positive associations have been observed between the ACE D allele and essential hypertension, myocardial infarction, and left ventricular hypertrophy.19 20 21 22 23 24 Clinical trials have also shown the benefits of ACE inhibitors in hypertension and congestive heart failure and in reducing the risk of reinfarction in patients who experienced acute myocardial infarction.44 45 Furthermore, among whites and Japanese, the DD genotype has been associated with higher concentrations of circulating ACE.15 16 17 18 In a previous study in Jamaica, we likewise demonstrated a significant correlation between the I/D polymorphism and ACE activity, with a weak relationship to blood pressure.17 The weight of the evidence therefore suggests that this gene contributes to cardiovascular disease risk. This polymorphism therefore holds promise as a focus for genetic studies among blacks, given the high rate of cardiovascular diseases experienced by this group.
In studies from different geographic regions, genetic linkage and association between two variants of the AGT gene and hypertension have been identified.10 11 12 13 14 However, the high frequency of the 235T variant observed among blacks in the present study, especially among Nigerians (91%), makes it unlikely that this variant will be useful as a marker for hypertension risk within these populations. Because African Americans and Jamaicans are primarily of West African descent and share a common genetic ancestry,46 the lower frequency of the 235T allele observed among them relative to Nigerians presumably reflects the consequence of European admixture, which is currently estimated at 25% for US blacks.46 47 It is possible that selective pressure during the 400 years since African populations migrated to the western hemisphere has altered the frequency of the alleles being studied in one or more populations. The current data do not permit a test of that hypothesis, however. Since we are not yet able to demonstrate strong links between genotype and phenotype, including hypertension status, it is not possible to propose a construct for how selection might have occurred. In addition, the markers examined in this paper are not sufficiently refined to permit discrimination of European versus African ancestry at the level of the individual. Availability of high-resolution haplotypes at these loci will make it possible to carry out those analyses in the future, however.
As stable estimates on the distribution of markers for the candidate genes become available, the question arises whether they play a role in determining between-population differences in the prevalence of hypertension or other cardiovascular diseases. If in fact the 235T allele is associated with risk of hypertension, blacks as a group would be at greater risk. As our earlier report showed, however, no association was observed among US blacks, and the nonsignificant relationship had a protective effect if any.42 Without evidence that the marker is a functional mutation, the implied risk relationship must be verified within each population before comparisons can be made across groups. In addition, microsatellite markers suggest that the mutation leading to the threonine substitution among persons of African origin has a different evolutionary history than the same mutation among Europeans (R. Ward, unpublished observations, 1994). All of these effects that result from variation at a single loci will likewise be conditioned by the accompanying genetic background, which will vary across groups as well. For example, atherosclerotic cardiovascular diseases are rare in Nigeria and hypertension is uncommon by US standards, suggesting that if this polymorphism plays a role in black populations, its impact will fall under the modifying influence of environmental factors, including diet.48 As we have argued elsewhere, available data, including findings from migrant studies,49 suggest that variations in hypertension prevalence are not likely to be due to differences in the frequency of presumed genetic risk factors but are much more likely to be due to differences in environmental risk factors, such as those associated with lifestyle. Therefore, extreme caution must be exercised in making inferences regarding aggregate population risk on the basis of studies of genetic markers.
In summary, the findings of the present study underscore the importance of including different ethnic groups in the continued search for candidate genes of the various constituents of the RAS. The loci being studied conform to expectations regarding the relatedness of these populations. Gene-environment interactions could be examined fruitfully in this setting, since the widely varying rates of hypertension occur in different environmental conditions against a common genetic background.
|
Selected Abbreviations and Acronyms |
|---|
|
|
|
Acknowledgments |
|---|
This work was supported by grants from the NIH (No. HL-45508 and No. HL-47910) and the Wellcome Trust (United Kingdom). We would like to thank Stacey Chin and Vivienne Clarke of the Tropical Metabolism Research Unit for technical assistance.
|
Footnotes |
|---|
Reprint requests to Dr C. Rotimi, Dept of Preventive Medicine, Loyola University Stritch School of Medicine, Maywood, IL 60153.
|
References |
|---|
|
TopAbstractIntroductionMethods Results Discussion References |
|---|
1. Cooper RS, Rotimi CN. Hypertension in populations of West African origin: is there a genetic predisposition? J Hypertens. 1994;12:215-227. [Medline] [Order article via Infotrieve]
2. Ogunlesi A, Osotimehin B, Abbiyessuku F, Kadiri S, Akinkugbe O, Liao Y, Cooper R. Blood pressure and educational level among factory workers in Ibadan, Nigeria. J Hum Hypertens. 1991;5:375-380. [Medline] [Order article via Infotrieve]
3. Foster C, Rotimi C, Fraser H, Sundarum C, Liao Y, Gibson E, Holder Y, Hoyos M, Mellanson-King R. Hypertension, diabetes and obesity in Barbados: findings from a recent population-based survey. Ethn Dis. 1993;3:404-412. [Medline] [Order article via Infotrieve]
4. Akinkubge OO. World epidemiology of hypertension in blacks. In: Hall WD, Saunders E, Shulman NB, eds. Hypertension in Blacks. Chicago, Ill: Year Book Medical Publishers Inc; 1985:3-16.
5. MacGregor GA, Markandu ND, Rouiston JE, Jones JC, Morton JJ. Maintenance of blood pressure by the renin-angiotensin system in normal man. Nature. 1981;291:329-331. [Medline] [Order article via Infotrieve]
6. Dzau VJ. Circulating versus local renin-angiotensin system in cardiovascular homeostasis. Circulation. 1988;77(6 pt 2):I4-I13.
7. Dzau VJ, Burt DW, Pratt RE. Molecular biology of the renin-angiotensin system. Am J Physiol. 1988;255:563-573.
8.
Walker WG, Whelton PK, Saito H, Russel RP, Hermann
J. Relationship between blood pressure and renin, renin
substrate, angiotensin II, aldosterone and
urinary sodium and potassium in 574 ambulatory subjects.
Hypertension. 1979;1:287-291.
9. Fasola AF, Martz BL, Helmer OM. Plasma renin activity during supine exercise in offspring of hypertensive parents. J Appl Physiol. 1968;25:410-415.
10. Jeunemaitre X, Soubrier F, Kotelevtsev YV, Lifton RP, Williams CS, Charru A, Hunt SC, Hopkins PN, Williams RP, Lalouel JM, Corvol P. Molecular basis of human hypertension: role of angiotensinogen. Cell. 1992;71:169-180. [Medline] [Order article via Infotrieve]
11. Hata A, Namikawa C, Sasaki M, Sato K, Nalamura T, Tamura K, Lalouel JM. Angiotensinogen as a risk factor for essential hypertension in Japan. J Clin Invest. 1994;93:1285-1287.
12.
Caulfield M, Lavender P, Newell-Price J, Farrall M,
Daniel H, Kamdar S, Lawson M, Fogarty P, Clark AJL. Linkage of
the angiotensinogen gene to human essential hypertension in
African Caribbeans. N Engl J Med. 1994;330:1629-1633.
13.
Hegele RA, Brunt JH, Connelly PW. A
polymorphism of the angiotensinogen gene associated
with variation in blood pressure in a genetic isolate.
Circulation. 1994;90:2207-2212.
14. Bennett C, Schrader A, Morris B. Cross-sectional analysis of Met235, the variant of angiotensinogen gene, in severe, familial hypertension. Biochem Biophys Res Commun. 1993;197:833-839. [Medline] [Order article via Infotrieve]
15. Tiret L, Rigat B, Viskivis S, Breda C, Corvol P, Cambien F, Soubrier F. Evidence from combined segregation and linkage analysis that a variant of the angiotensin converting enzyme (ACE) gene controls plasma ACE levels. Am J Hum Genet. 1992;51:197-205. [Medline] [Order article via Infotrieve]
16.
Nakai K, Itoh C, Miura Y, Hotta K, Musha T, Itoh T,
Miyakawa T, Iwasaki R, Hiramori K. Deletion polymorphism of
the angiotensin I-converting enzyme gene is associated with
serum ACE concentration and increased risk for CAD in the
Japanese. Circulation. 1994;90:2199-2202.
17. Forrester T, Cooper R, Bennet F, McFarlane-Anderson N, Puras A, Rotimi C, Durazo R, Tewksbury D, Ward R. Angiotensinogen and blood pressure among blacks: findings from a community survey in Jamaica. J Hypertens. In press.
18. Rigat B, Hubert C, Alhenc-Gelas F, Cambien F, Corvol P, Soubrier F. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest. 1990;86:1343-1346.
19. Raynolds MV, Bristow MR, Bush EW, Abraham WT, Lowes BD, Zisman LS, Taft CS, Perry MB. Angiotensin-converting enzyme DD genotype in patients with ischaemic or idiopathic cardiomyopathy. Lancet. 1993;342:1065-1066. [Medline] [Order article via Infotrieve]
20.
Cambien F, Costerousse O, Tiret L, Poirier O, Lecerf L,
Gonzales MF, Evans A, Arveiler D, Cambou JP, Luc G, Rakotovao R,
Ducimetiere P, Soubrier F, Alhenc-Gelas F. Plasma level and gene
polymorphism of angiotensin-converting enzyme in
relation to myocardial infarction.
Circulation. 1994;90:669-676.
21. Tiret L, Kee F, Poirier O, Nicaud V, Lecerf L, Evans A, Cambou J, Arveiler D, Luc G, Amouyel P, Cambien F. Deletion polymorphism in angiotensin-converting enzyme gene associated with parental history of myocardial infarction. Lancet. 1993;341:991-992. [Medline] [Order article via Infotrieve]
22. Cambien F, Poirier O, Lecerf L, Evans A, Cambou JP, Arveiler D, Luc G, Bard JM, Bara L, Ricard S, Tiret L, Amouyel P, Alhenc-Gelas F, Soubrier F. Deletion polymorphism in the gene for angiotensin-converting enzyme is a potent risk factor for myocardial infarction. Nature. 1992;359:641-644. [Medline] [Order article via Infotrieve]
23.
Schunkert H, Hense H-W, Holmer SR, Stender M, Perz S,
Keil U, Lorell BH, Riegger GAJ. Association between a deletion
polymorphism of the
angiotensin-converting-enzyme gene and left
ventricular hypertrophy. N
Engl J Med. 1994;330:1634-1638.
24.
Mattu R, Needham E, Galton D, Frangos E, Clark A,
Caulfield M. A DNA variant at the
angiotensin-converting enzyme gene locus associates
with coronary artery disease in the Caerphilly Heart
Study. Circulation. 1995;91:270-274.
25. Zee RYL, Lou Y, Griffiths LF, Morris BJ. Association of a polymorphism of the angiotensin I-converting enzyme (ACE) gene with essential hypertension. Biochem Biophys Res Commun. 1992;184:9-15. [Medline] [Order article via Infotrieve]
26. Lee E. Population genetics of the angiotensin-converting enzyme in Chinese. Br J Clin Pharmacol. 1994;37:212-214. [Medline] [Order article via Infotrieve]
27. Ishigami T, Iwamoto T, Tamura K, Yamaguchi S, Iwasawa K, Uchino K, Umemura S, Ishii M. Angiotensin I converting enzyme (ACE) gene polymorphism and essential hypertension in Japan: ethnic difference of ACE genotype. Am J Hypertens. 1995;8:95-97. [Medline] [Order article via Infotrieve]
28. Higashimori K, Zhao Y, Higaki J, Kamitanii A, Katsuya T, Nakura J, Miki T, Mikami H, Ogihara T. Association analysis of a polymorphism of the angiotensin converting enzyme gene with essential hypertension in the Japanese population. Biochem Biophys Res Commun. 1993;191:399-404. [Medline] [Order article via Infotrieve]
29. Rutledge D, Browe C, Kubilis P, Ross E. Analysis of two variants of the angiotensinogen gene in essential hypertensive African-Americans. Am J Hypertens. 1994;7:651-654. [Medline] [Order article via Infotrieve]
30.
Harrap SB, Davidson HR, Connor JM, Soubrier F, Corvol
P, Fraser R, Foy CFW, Watt GCM. The angiotensin
I-converting enzyme gene and predisposition to high blood
pressure. Hypertension. 1993;21:455-460.
31. Jeunemaitre X, Lifton RP, Hunt SC, Williams RR, Lalouel JM. Absence of linkage between the angiotensin converting enzyme locus and human essential hypertension. Nat Genet. 1992;1:72-75. [Medline] [Order article via Infotrieve]
32. Barley J, Blackwood A, Carter N, Crews D, Cruickshank K, Jeffery S, Ogulesi A, Sagnella G. Angiotensin converting enzyme insertion/deletion polymorphism: association with ethnic origin. J Hypertens. 1994;12:955-957. [Medline] [Order article via Infotrieve]
33. Duru K, Farrow S, Wang J, Locketteb W, Kurtz T. Frequency of a deletion polymorphism in the gene for angiotensin converting enzyme is increased in African-Americans with hypertension. Am J Hypertens. 1994;7:759-762. [Medline] [Order article via Infotrieve]
34. Kamdar S, Daniel H, Fogarty P, Lawson M, Munroe P, Caulfield M. ACE insertion/deletion polymorphism in Vincentian African Caribbeans with essential hypertension. J Hum Hypertens. 1994;8:611. Abstract. [Medline] [Order article via Infotrieve]
35. Schmidt S, Van Hooft IMS, Grobbee DE, Ganten D, Eberhard R. Polymorphism of the angiotensin I-converting enzyme gene is apparently not related to high blood pressure: Dutch Hypertension and Offspring Study. J Hypertens. 1993;11:345-348. [Medline] [Order article via Infotrieve]
36. Berge KE, Berg K. No effect of insertion/deletion polymorphism at the ACE locus on normal blood pressure level or variability. Clin Genet. 1994;45:169-174. [Medline] [Order article via Infotrieve]
37. Gu X, Spaepen M, Guo C, Fagard R, Amery A, Lijnen P, Cassiman JJ. Lack of association between the I/D polymorphism of the angiotensin-converting enzyme gene and essential hypertension in a Belgian population. J Hum Hypertens. 1994;8:683-685. [Medline] [Order article via Infotrieve]
38. Ataman S, Cooper R, Rotimi C, Osotimehin B, Muna W, Kingue S, Fraser H, McGee D. Standardization of blood pressure in an international collaborative study. J Clin Epidemiol. In press.
39.
Rigat B, Hubert C, Corvol P, Soubrier F. PCR
detection of the insertion/deletion polymorphism of the human
angiotensin-converting enzyme gene (DCP 1 dipeptidyl
carboxypeptidase). Nucleic Acids Res. 1992;20:1433.
40.
Ludwig E, Corneli PS, Anderson JL, Marshal HW, Lalouel
J-M, Ward RH. Coronary stenosis precedes
increased genetic risk of myocardial infarction associated with the
angiotensin-converting enzyme gene.
Circulation. 1995;91:2120-2124.
41. Shanmugan V, Sell KW, Saha BK. Mistyping ACE heterozygotes. PCR Methods Appl. 1993;3:120-121. [Medline] [Order article via Infotrieve]
42.
Rotimi C, Morrison L, Cooper R, Oyejide C, Effiong E,
Ladipo M, Osotimehin B, Ward R. Angiotensinogen gene
in human hypertension: lack of an association of the 235T allele
among African Americans. Hypertension. 1994;24:591-594.
43. Rotimi CN, Cooper RS, Ataman SL, McGee D, Osotimehin B, Kadiri S, Muna W, Kingue S, Fraser H, Cruickshank K. Distribution of anthropometric variables and the prevalence of obesity in populations of West African origin: the International Collaborative Study on Hypertension in Blacks. Obesity Res. 1995;3(suppl 2):95S-106S.
44. The Acute Infarction Ramipril Efficacy (AIRE) Study Investigators. Effect of ramipril on mortality and morbidity of survivors of acute myocardial infarction with clinical evidence of heart failure. Lancet. 1993;342:821-828. [Medline] [Order article via Infotrieve]
45. Pfeffer MA, Braunwald E, Moye LA, Basta L, Brown EJ, Cuddy TE, Davis BR, Geltman EM, Goldman S, Flaker GC, Klein M, Lamas GA, Packer M, Roulea J, Rouleau JL, Rutherford J, Wertheimer JH, Hawkins CM, on behalf of the SAVE Investigators. Effect of captopril on mortality and morbidity in patients with left ventricular dysfunction after myocardial infarction: results of the Survival and Ventricular Enlargement Trial. N Engl J Med. 1992;327:669-677. [Abstract]
46.
Adams JP, Ward RH. Admixture studies and the
detection of selection. Science. 1973;180:1137-1143.
47. Chakraborty R, Kamboh MI, Nwanko M, Ferrell RE. Caucasian genes in American blacks: new data. Am J Hum Genet. 1992;50:145-155. [Medline] [Order article via Infotrieve]
48. Cooper RS, Rotimi CN. Establishing the epidemiologic basis for prevention of cardiovascular diseases in Africa. Ethn Dis. 1993;3:S13-S23.
49. Ward RH. Familial aggregation and genetic epidemiology of blood pressure. In: Laragh JH, Brenner BM, eds. Hypertension: Pathophysiology, Diagnosis and Management. New York, NY: Raven Press Publishers; 1990:83-102.
This article has been cited by other articles:
 |
|
 |
|
  L. D. Jenkins, R. W. Powers, M. Cooper, M. J. Gallaher, N. Markovic, R. Ferrell, R. B. Ness, and J. M. Roberts Preeclampsia Risk and Angiotensinogen Polymorphisms M235T and AGT -217 in African American and Caucasian Women Reproductive Sciences, September 1, 2008; 15(7): 696 - 701. [Abstract] [PDF]
|
|
|
|
 |
|
 I. Goldenberg, A. J. Moss, D. Ryan, S. McNitt, S. W. Eberly, and W. Zareba Polymorphism in the Angiotensinogen Gene, Hypertension, and Ethnic Differences in the Risk of Recurrent Coronary Events Hypertension, October 1, 2006; 48(4): 693 - 699. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. J. Benjamin, D. K. Arnett, and J. Loscalzo Discovering the Full Spectrum of Cardiovascular Disease: Minority Health Summit 2003: Report of the Basic Science Writing Group Circulation, March 15, 2005; 111(10): e120 - e123. [Full Text] [PDF]
|
|
|
|
 |
|
 A. Bouzamondo, J.-S. Hulot, P. Sanchez, and P. Lechat Beta-blocker benefit according to severity of heart failure Eur J Heart Fail, June 1, 2003; 5(3): 281 - 289. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. R. Palmer, A. P. Pilbrow, T. G. Yandle, C. M. Frampton, A. M. Richards, M. G. Nicholls, and V. A. Cameron Angiotensin-converting enzyme gene polymorphism interacts with left ventricular ejection fraction and brain natriuretic peptide levels to predict mortality after myocardial infarction J. Am. Coll. Cardiol., March 5, 2003; 41(5): 729 - 736. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. Price, N. D.L. Fisher, M. C. Lansang, R. Stevanovic, G. H. Williams, and N. K. Hollenberg Renal Perfusion in Blacks: Alterations Caused by Insuppressibility of Intrarenal Renin With Salt Hypertension, August 1, 2002; 40(2): 186 - 189. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 The Beta-Blocker Evaluation of Survival Trial Inve A Trial of the Beta-Blocker Bucindolol in Patients with Advanced Chronic Heart Failure N. Engl. J. Med., May 31, 2001; 344(22): 1659 - 1667. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Gleiberman and J. E. Dimsdale Salt, Hypertension, Evolution Response Psychosom Med, March 1, 2001; 63(2): 325 - 327. [Full Text] [PDF]
|
|
|
|
|
|
J. V. Gainer, C. M. Stein, T. Neal, D. E. Vaughan, and N. J. Brown Interactive Effect of Ethnicity and ACE Insertion/Deletion Polymorphism on Vascular Reactivity Hypertension, January 1, 2001; 37(1): 46 - 51. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Okamura, M. Ohishi, H. Rakugi, T. Katsuya, Y. Yanagitani, S. Takiuchi, Y. Taniyama, K. Moriguchi, H. Ito, Y. Higashino, et al. Pharmacogenetic Analysis of the Effect of Angiotensin-Converting Enzyme Inhibitor on Restenosis After Percutaneous Transluminal Coronary Angioplasty Angiology, October 1, 1999; 50(10): 811 - 822. [Abstract] [PDF]
|
|
|
|
|
|
C. N. Rotimi, R. S. Cooper, G. Cao, O. Ogunbiyi, M. Ladipo, E. Owoaje, and R. Ward Maximum-Likelihood Generalized Heritability Estimate for Blood Pressure in Nigerian Families Hypertension, March 1, 1999; 33(3): 874 - 878. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. MALIARIK, B. A. RYBICKI, E. MALVITZ, R. G. SHEFFER, M. MAJOR, J. POPOVICH Jr., and M. C. IANNUZZI Angiotensin-converting Enzyme Gene Polymorphism and Risk of Sarcoidosis Am. J. Respir. Crit. Care Med., November 1, 1998; 158(5): 1566 - 1570. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Ishigami, S. Umemura, K. Tamura, K. Hibi, N. Nyui, M. Kihara, M. Yabana, Y. Watanabe, Y. Sumida, T. Nagahara, et al. Essential Hypertension and 5' Upstream Core Promoter Region of Human Angiotensinogen Gene Hypertension, December 1, 1997; 30(6): 1325 - 1330. [Abstract] [Full Text]
|
|
|
|
|
|
R. Kunz, R. Kreutz, J. Beige, A. Distler, and A. M. Sharma Association Between the Angiotensinogen 235T-Variant and Essential Hypertension in Whites : A Systematic Review and Methodological Appraisal Hypertension, December 1, 1997; 30(6): 1331 - 1337. [Abstract] [Full Text]
|
|
|
|
|
|
C. Rotimi, R. Cooper, O. Ogunbiyi, L. Morrison, M. Ladipo, D. Tewksbury, and R. Ward Hypertension, Serum Angiotensinogen, and Molecular Variants of the Angiotensinogen Gene Among Nigerians Circulation, May 20, 1997; 95(10): 2348 - 2350. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||