Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 1996;27:1009-1017

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brasier, A. R.
Right arrow Articles by Wimbish, K. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brasier, A. R.
Right arrow Articles by Wimbish, K. A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH

(Hypertension. 1996;27:1009-1017.)
© 1996 American Heart Association, Inc.


Articles

Tumor Necrosis Factor Activates Angiotensinogen Gene Expression by the Rel A Transactivator

Presented in part at the 67th Scientific Sessions of the American Heart Association, Dallas, Tex, November 14-17, 1994.

Allan R. Brasier; Junyi Li; Kenneth A. Wimbish

From the Departments of Medicine (A.R.B., J.L., K.A.W.) and Human Biological Chemistry and Genetics and the Sealy Center for Molecular Science (A.R.B.), University of Texas Medical Branch, Galveston.

Correspondence to Allan R. Brasier, Division of Endocrinology, MRB 3.142, University of Texas Medical Branch, 301 University Blvd, Galveston, TX 77555-1060.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract Angiotensinogen encodes the only known precursor of angiotensin II, a critical regulator of the cardiovascular system. Transcriptional control of angiotensinogen in hepatocytes is an important regulator of circulating angiotensinogen concentrations. Angiotensinogen transcription is increased by the inflammatory cytokine tumor necrosis factor (TNF)-{alpha} by a nuclear factor–{kappa}B–like protein binding to an inducible enhancer called the acute-phase response element. By gel mobility shift assays, we observe two specific acute-phase response element–binding complexes, C1 and C2. The abundance of C2 is not changed by TNF treatment. In contrast, C1 is faintly detected in untreated cells, and its abundance increases by fivefold after stimulation. We identify the nuclear factor–{kappa}B subunits in these complexes using subunit-specific antibodies in the gel mobility "supershift" assay. The transcriptionally inert nuclear factor–{kappa}B DNA-binding subunit NF-{kappa}B1 is present in both control and stimulated hepatocyte nuclei. Its abundance changes weakly upon TNF stimulation. In contrast, the potent transactivating protein Rel A is not found in unstimulated hepatocyte nuclei and is recruited by TNF-{alpha} into the C1 DNA-binding complex. Overexpression of Rel A results in acute-phase response element transcription. Cotransfection of a chimeric GAL4–Rel A protein with GAL4 DNA-binding sites is a strategy that allows for selective study of Rel A. The GAL4:Rel A chimera is a TNF-{alpha}–inducible transactivator. Deletion of the amino-terminal 254 amino acids of Rel A produces a constitutive activator (that is no longer TNF-{alpha} inducible). The cytokine induction of Rel A, then, is mediated through its amino-terminal 254 amino acids. We conclude that Rel A:NF-{kappa}B1 is a crucial cytokine-inducible transcription factor complex regulating angiotensinogen gene synthesis in hepatocytes and may be involved in controlling the activity of the renin-angiotensin system.


Key Words: nuclear factor kappa B • renin-angiotensin system • angiotensinogen • acute-phase reaction


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The AGT gene encodes the only known glycoprotein precursor of the potent vasopressor Ang II and is transcriptionally activated in hepatocytes during the acute-phase response.1 2 Although AGT is expressed in a variety of tissues in which local AGT formation probably plays an important role in organ function,3 4 hepatic expression of AGT controls to a large extent the circulating levels of AGT within plasma. Because the hepatocyte lacks the ability to store presynthesized proteins, changes in AGT gene expression are directly coupled to changes in AGT protein secretion.5 6 These observations, in conjunction with numerous physiological and genetic studies indicating AGT concentrations to be rate-limiting for Ang II formation in the intravascular space,7 8 9 10 11 12 argue that transcriptional induction of hepatic AGT expression is an important control point for the activity of the intravascular RAS.

AGT gene expression in liver is tightly controlled through the influence of multiple hormonal stimuli, including (1) the steroid hormones: glucocorticoids,6 13 14 15 16 estrogens,3 17 and triiodothyronine18 19 ; (2) the peptide product of AGT processing, Ang II20 21 22 23 ; (3) the state of cellular differentiation24 25 26 27 ; and (4) cytokine hormones elaborated as a consequence of systemic inflammation (the APR1 2 28 29 ). These hormones alter AGT expression under physiological conditions by affecting the abundance of transcription factors that bind to the AGT promoter in hepatic nuclei.

One well-characterized physiological activator of AGT expression is the hepatic APR, a stereotypical response of the mammalian liver to the initiation of inflammation. In the APR, local injury or inflammation results in cytokine elaboration (IL-1 and TNF-{alpha}); these hormones induce a switch in hepatic gene synthesis to producing proteins involved in macrophage opsonization and wound repair. The APR, initiated experimentally by intraperitoneal lipopolysaccharide and effected by the production of TNF-{alpha}, is a potent inducer of hepatic AGT expression. Study of AGT regulation during the APR has revealed insights into transcriptional control elements and DNA-binding proteins that control expression of the rat AGT gene (reviewed in Reference 30). One crucial DNA control element, located between -531 and -557 in the rat gene 5' to the transcription start site, contains the sequence 5'-AGTTGGGATTTCCCAACC-3' that we have called the APRE. The APRE is a TNF-{alpha}–inducible enhancer that confers TNF-{alpha} induction onto an inert minimal promoter.1

The APRE functions because it is a binding site for the potent transcription factor complex NF-{kappa}B. NF-{kappa}B is a multiprotein complex encoded by different genes but sharing a homologous 250–amino acid N-terminal DNA-binding domain. These members include Rel A (p65), Rel B, NF-{kappa}B1 (NF-{kappa}B p50), and NF-{kappa}B2 (NF-{kappa}B p49) (reviewed in Reference 31). Rel A is a powerful transactivating NF-{kappa}B family member that binds to DNA sequences either as homodimers or as a heterodimer with one of the strong DNA-binding subunits, NF-{kappa}B1 or NF-{kappa}B2. In resting cells, NF-{kappa}B is sequestered in the cytoplasm through reversible interactions with a family of inhibitory proteins called I{kappa}B.32 33 34 Cytokines such as TNF-{alpha} activate NF-{kappa}B by disrupting the I{kappa}B complex through a coupled phosphorylation/degradation step, allowing the NF-{kappa}B complex to enter the nucleus, bind to inducible promoters, and stimulate their transcription.

Mutations of the APRE that disrupt NF-{kappa}B binding also prevent cytokine induction of the AGT promoter.1 That NF-{kappa}B binds to the AGT APRE has been argued circumstantially on the basis of similar methylation-interference patterns, the existence of latent cytoplasmic APRE binding activity, and cross-competition experiments in in vitro DNA-binding assays.2 14 Characterization of the NF-{kappa}B subunit composition that binds the AGT APRE is important because the heteromeric complexes Rel A:Rel A,35 Rel A:Rel B,36 Rel B:NF-{kappa}B1,37 and Rel A:NF-{kappa}B138 have all been observed to bind to similar DNA sequences with distinct transactivational activities and modes of regulation. What are the relevant NF-{kappa}B subunits controlling hepatic AGT expression?

In this article, we characterize the subunit composition of the NF-{kappa}B members that bind the AGT APRE in control and TNF-{alpha}–stimulated human hepatoblastoma (HepG2) nuclei. TNF-{alpha} induces APRE transcriptional activity in a dose-dependent fashion. In parallel, TNF increases the DNA binding of an NF-{kappa}B–specific complex of unique mobility. Using NF-{kappa}B subunit–specific antibodies in the gel mobility "supershift" assay, we identify the NF-{kappa}B subunits NF-{kappa}B1 and Rel A as the relevant NF-{kappa}B members controlling AGT expression.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Transfection and Cell Culture
The human hepatoblastoma cell line HepG2 was obtained from the American Type Collection Catalog and maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 100 µg/mL penicillin, 100 µg/mL streptomycin, 0.025 µg/mL fungizone, 10 mmol/L nonessential amino acids, and 1 mmol/L sodium pyruvate in an atmosphere of 5% CO2. Transient transfections were performed with the calcium phosphate technique14 39 in triplicate 60-mm plates using 10 µg luciferase reporter, 4 µg CMV–ß-Gal (internal control), the indicated CMV–Rel A expression plasmid, and carrier pGEM7Z plasmid to constitute a total of 20 µg for each set of triplicate plates. CMV–ß-Gal was chosen as an internal control because the CMV promoter is a high-level–expression promoter in HepG2 cells whose activity is not influenced by TNF-{alpha} treatment. The 1.25 µg concentration is selected to produce galactosidase expression that accurately reflects changes in transfection efficiency. In the experiments in which transient overexpression is used, the expression plasmid is included in place of carrier pGEM DNA to maintain the same DNA concentration per plate. Twenty-four hours after transfection, cells were washed, fresh medium was added, and cells were cultured for an additional 20 hours. Four hours before harvest, recombinant human TNF-{alpha} was added at the indicated concentrations.

Reporter Assays
Transfected cells were harvested by washing two times in PBS and lysed on the plate by the addition of 0.3 mL of lysis buffer (25 mmol/L Tris-phosphate, pH 7.8, 2 mmol/L DTT, 2 mmol/L 1,2-diaminocyclohexane-N,N,N',N'-tetraacetic acid, 10% glycerol, 1% Triton X-100). After cells were incubated in lysis buffer for 15 minutes at room temperature, plates were scraped, and lysates were transferred to 1.5-mL Eppendorf centrifuge tubes and spun in a microcentrifuge at 10 000 rpm for 5 minutes. Cytoplasmic lysate (100 µL) was assayed for luciferase reporter activity by injection of 100 µL of luciferase assay reagent (20 mmol/L Tricine, 1.07 mmol/L [MgCO3]Mg[OH]2 · 5H2O, 2.67 mmol/L MgSO4, 0.1 mmol/L EDTA, 33.3 mmol/L DTT, 270 µmol/L coenzyme A, 470 µmol/L luciferin, 530 µmol/L ATP). Light output was measured over 16 seconds in a refrigerated Berthold 953 luminometer. ß-Gal activity was measured separately by 100 µL to the synthetic substrate ONPG, and quantification of the product was determined spectrophotometrically. Luciferase activity was determined by subtracting machine blank and normalizing each plate to ß-Gal activity. The mean and SD were then calculated for each independently transfected set of triplicate plates. Activity (in multiples) was calculated by dividing the normalized luciferase activity by that determined for the same reporter in the absence of TNF-{alpha} stimulation.

Gel Mobility Shift Assays of Nuclear Extracts
To extract nuclear protein from treated cells, the cytoplasmic lysate was aspirated from the nuclear pellet, 50 µL of nuclear extract buffer (in mmol/L: HEPES 10, pH 7.8, KCl 400, EGTA 0.1, EDTA 0.1, PMSF 1, and DTT 1) was added, and nuclear protein was extracted by gentle agitation at 4°C to allow lysis of the nuclei and extraction of the DNA-binding proteins. The insoluble chromatin and membranes were removed by centrifugation for 5 minutes in a microcentrifuge at maximal speed (10 000 rpm), and the supernatant was saved for analysis of DNA-binding activity. Typically, we obtain nuclear protein at 2 to 5 µg/mL (representing 100 to 250 µg/60 min plates).

Gel mobility shift assays were performed as previously described,1 2 14 39 using the indicated amounts of nuclear extract incubated with 2x104 cpm of duplex oligonucleotide (labeled by Klenow "fill-in" using [{alpha}-32P]dATP). After binding for 15 minutes at 22°C, samples were electrophoresed on 6% to 7% nondenaturing polyacrylamide gel in 1x TBE (25 mmol/L Tris, 25 mmol/L boric acid, and 0.5 mmol/L EDTA) at 180 V (constant voltage) for 2 hours. Competition was performed by the addition of excess nonradioactive double-stranded oligonu-cleotide competitor at the time of addition of radioactive probe. The sequences of the APRE are as follows: APRE WT GATCCACCACAGTTGGGATTTCCCAACCTGACCA

GAGGTGTCAACCCTAAAGGGTTGGACTGGTCTAG

*** APRE M6 GATCCACCACAGTTGTGATTTCACAACCTGACCA

GTGGTGTCAACACTAAAGTGTTGGACTGGTCTAG APRE M2 GATCCACCACATGTTGGATTTCCGATACTGACCA

GTGGTGTACAACCTAAAGGCTATGACTGGTCTAG (Asterisks indicate points of NF-{kappa}B contact using the methylation interference assay.1 )

After electrophoresis, gels were dried and exposed overnight at -70°C to Kodak X-AR film or for quantification to a PhosphorImager cassette and analyzed by ImageQuant software with a Molecular Dynamics 425E PhosphorImager.

Antibody supershift assays were performed by addition to the binding reaction of 1 µL of unfractionated antibody in serum and incubation for 20 minutes at 22°C. The antibody:NF-{kappa}B:DNA complexes were electrophoresed on a softer polyacrylamide gel (5%); the free probe and bromphenol blue tracking dyes were electrophoresed off the gel to allow visualization of the antibody:NF-{kappa}B:DNA complexes. Anti–NF-{kappa}B1 antibody was produced by immunizing rabbits with a bacterially expressed polyhistidine-tagged NF-{kappa}B1 protein. This NF-{kappa}B1 protein was produced by use of the T7 promoter/polymerase in Escherichia coli and purified to homogeneity by nickel-agarose (Ni-NTA, Qiagen) affinity chromatography. The NF-{kappa}B1 domain is a unique region in the C-terminus not conserved with other NF-{kappa}B family members (amino acids 410-480). This antibody binds and supershifts recombinant full-length NF-{kappa}B1 protein. Anti–Rel A, anti–c-Rel, and anti–NF-{kappa}B2 antibodies were obtained commercially (Santa Cruz Biotech). Anti–Rel A does not cross-react with recombinant NF-{kappa}B1 and recognizes a 65-kD protein in HepG2 nuclear extracts, and thus is subunit specific.

Plasmid Construction
APRE-LUC consists of the trimerized rat AGT APRE WT sequences ligated through BamHI/Bgl II ends into the p59 rat AGT minimal promoter driving the expression of the firefly luciferase reporter gene.1 2 14 26 40 Site mutations of the rat AGT APRE were constructed by the same strategy.

The eukaryotic expression vector encoding full-length human Rel A was produced by ligating the 2.2-kb coding sequences (1-551) of Rel A into the BamHI site of the eukaryotic expression vector pcDNAI (InVitrogen Inc). This expression vector produces Rel A mRNA under the direction of the powerful eukaryotic CMV long-terminal repeat. Dideoxynucleotide sequencing using the SP6 primer site was used to confirm its authenticity. The GAL4–Rel A expression vector was constructed by use of the eukaryotic expression vector pSG42441 that produces GAL4 (1-147) under control of the SV40 early region promoter/enhancer. The multiple cloning site was altered to place a BamHI restriction site in frame with the GAL4 coding sequences (pGAL4 Ad). Rel A (1-551) was then cloned as a BamHI fragment into the pGAL4 Ad plasmid. Rel A (255-551) was produced by amplifying in the polymerase chain reaction the Rel A (255-551) coding sequences, restricting the PCR fragment with BamHI and Xba I, and ligating into pGAL4 Ad restricted with BamHI and Xba I. The upstream oligonucleotide used for the Rel A amplification was 5'-GCC ATT GAA TTC T CTA GATTAG GAG CTG ATC TGA CTC AGC AGG-3' (the Xba I site is underlined and stop codon indicated in bold). Sequencing of the GAL4–Rel A coding sequences was performed to ensure authenticity of the coding sequences. The UAS-LUC reporter plasmid was constructed by use of the tandem GAL4 binding sites ligated upstream from the -59 rat AGT minimal promoter. The UAS sequences are GATCCCGGAGGACTGTCCTCCGCGGAGGACTGTCCTCCGA and GGCCTCCTGACAGGAGGCGCCTCCTGACAGGAGGCTCTAG. All plasmids were prepared on cesium chloride gradients before transfection, and their concentrations were determined spectrophotometrically.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
To study induction of the NF-{kappa}B proteins, we constructed a sensitive reporter plasmid for measuring the transcriptional activation of the APRE. The plasmid consists of three copies of the rat AGT APRE ligated upstream from the -59 rat AGT promoter in the sensitive luciferase reporter gene (APRE-LUC). APRE-LUC has previously been demonstrated to initiate transcription at the nucleotide (nt) +1 cap site in exon 1 of the rat AGT gene.2 APRE-LUC was transfected into HepG2 cells along with internal control plasmid CMV–ß-Gal, an activity that is independently measured to normalize for plate-to-plate changes in luciferase reporter activity; transfectants were stimulated for 4 hours (44 hours after transfection) with the indicated increasing concentrations of recombinant human TNF-{alpha}, and reporter activity was measured. Fig 1Down summarizes the mean±SD of three independent transfections. Relative to unstimulated control, TNF-{alpha} increased APRE transcriptional activity 7.5-fold at 0.3 ng/mL to 27-fold at 30 ng/mL. Mediation of the TNF-{alpha} induction by specific DNA sequences on the APRE is indicated by measurement of the TNF-{alpha} induction of APRE site mutations (APRE M6 and APRE M2) ligated into the same promoter. As shown in Fig 1Down, reporter gene activity produced by either APRE M6-LUC or APRE M2-LUC is inert to TNF-{alpha} stimulation.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 1. Bar graph showing that TNF-{alpha} induces AGT APRE transcriptional activity in transient transfections of HepG2 cells. Human HepG2 cells were transiently transfected with reporter genes driven by APRE DNA binding sites and site mutations ligated upstream of the rat AGT gene promoter. Twenty-four hours after transfection the medium was changed, and cells were cultured for an additional 20 hours. Four hours before harvest, triplicate plates of cells were stimulated with recombinant human TNF-{alpha} at the indicated concentrations. Data represent the mean±SD of three independent transfections of independently assayed luciferase and internal control ß-Gal reporter activities. At 30 ng/mL, TNF-{alpha} activates APRE WT (open bars) reporter activity 25-fold, whereas the site mutations of the APRE, APRE M6 (solid bars), and APRE M2 (hatched bars) are not reproducibly TNF-{alpha} inducible.

To identify the TNF-{alpha}–inducible APRE binding proteins, nuclear extracts from control and TNF-{alpha}–stimulated HepG2 cells were prepared and analyzed by EMSA. In the absence of TNF-{alpha}, a strong DNA-binding complex (C2) is detectable, and a slower mobility complex (C1) is faintly detectable (Fig 2Down). Upon TNF-{alpha} treatment, the slower-mobility C1 complex increases its binding to the APRE in a dose-dependent fashion (see also Fig 3Down). Binding specificity of the TNF-{alpha}–inducible C1 complex is shown in Fig 3Down, in which unlabeled oligonucleotides containing site mutations with the APRE are included in the binding assay as competitors. Inclusion of unlabeled APRE WT DNA as a competitor but not the site mutations APRE M6 or APRE M2 DNA inhibits both the constitutive C2 complex and the TNF-{alpha}–inducible C1 complex, indicating that both C1 and C2 complexes have "NF-{kappa}B–like" DNA-binding specificity.



View larger version (59K):
[in this window]
[in a new window]
 
Figure 2. TNF-{alpha} induces AGT APRE DNA-binding activity in a dose-dependent fashion. Human HepG2 cells were stimulated with TNF-{alpha} at the indicated concentrations for 4 hours before the harvest and extraction of nuclear protein according to our previously published techniques.39 Shown is an autoradiogram of a 7% EMSA using radiolabeled APRE in the presence of 2 µg poly dI-dC as a nonspecific competitor and 15 µg nuclear protein. Two nucleoprotein complexes are seen, labeled complex 1 (C1) and C2. C2 is the predominant complex in untreated control cells (C1 is only faintly detectable). TNF-{alpha} induces the abundance of C1 in a dose-dependent manner. The abundance of C2 does not change with TNF-{alpha} treatment (see also Fig 3Up).



View larger version (88K):
[in this window]
[in a new window]
 
Figure 3. The TNF-{alpha}–inducible DNA-binding complex binds the APRE in a sequence-specific fashion. Forty micrograms of nuclear extract from unstimulated and TNF-{alpha}–stimulated HepG2 cells was used in the EMSA in the absence or presence of unlabeled APRE DNA binding competitor DNA. Shown is the autoradiogram with radiolabeled APRE WT DNA. Here and in Fig 4Up, poly dA-dT was used as a nonspecific competitor to abolish the binding of a nonspecific complex that closely comigrates with C2. Both C1 and C2 are completely competed with a 100-fold excess of unlabeled APRE WT DNA but not APRE M6 or APRE M2 DNA-binding sites. These observations indicate that the constitutive C2 complex and the TNF-{alpha}–inducible C1 complex both bind DNA in a sequence-specific manner.

Gel mobility "supershift" assays were used to identify which NF-{kappa}B subunits are contained within the C1 and C2 nucleoprotein complexes. This assay relies on NF-{kappa}B subunit–specific antibodies to produce a more slowly migrating supershift antibody/NF-{kappa}B/DNA complex that allows for the unambiguous identification of that protein in the DNA complex. In Fig 4Down, the antibody supershift assay was used on control (unstimulated) or TNF-{alpha}–stimulated HepG2 cell nuclear extracts. In control nuclear extracts, the APRE binding complexes were not affected by the addition of preimmune antibodies or antibodies directed against NF-{kappa}B2 (p49), c-Rel (Rel B), or Rel A (p65) subunits. However, addition of anti–NF-{kappa}B1 antibodies produced an additional supershifted complex, indicating that NF-{kappa}B1 protein is the predominant NF-{kappa}B protein contained within the C2 complex in unstimulated HepG2 cells. The intensity of supershifted NF-{kappa}B1 increases with TNF-{alpha} treatment. In control nuclear extracts, addition of anti–Rel A antibodies does not produce a detectable supershifted complex, indicating that the nuclear DNA binding activity of Rel A is low. In contrast, anti–Rel A antibodies produce a strong supershift in the TNF-{alpha}–stimulated nuclear extracts containing the C1 complex, indicating that the C1 nucleoprotein complex contains Rel A. We interpret these studies as indicating that NF-{kappa}B1 is the predominant NF-{kappa}B subunit binding the APRE (C2 complex) in unstimulated HepG2 nuclei and that DNA-binding activity of Rel A, and to a lesser extent of NF-{kappa}B1, is induced in HepG2 nuclei in response to TNF-{alpha} treatment.



View larger version (70K):
[in this window]
[in a new window]
 
Figure 4. Gel mobility "supershift" assay demonstrates NF-{kappa}B subunits within the APRE nucleoprotein complex. Nuclear extracts from unstimulated and TNF-{alpha}–stimulated HepG2 cells were used in the gel mobility supershift assay with radiolabeled APRE DNA in the presence of subunit-specific NF-{kappa}B antibodies against NF-{kappa}B1 (p50), NF-{kappa}B2 (p49), c-Rel (Rel B), and Rel A (p65). This assay will produce an additional slower-mobility supershift band composed of antibody:NF-{kappa}B subunit:DNA complex. In this assay, a 5% EMSA was used to visualize the supershift bands, and the free probe was electrophoresed off the gel, resulting in a smeared DNA complex. As with preimmune serum (PI), the addition of anti–NF-{kappa}B2 and c-Rel antibodies do not perturb the nucleoprotein complex. The addition of anti–NF-{kappa}B1 antibodies produces an additional complex both in the control and TNF-{alpha}–stimulated extracts. The intensity of the supershifted NF-{kappa}B1 increases slightly with TNF-{alpha} treatment. Addition of anti–Rel A antibodies produces a supershift complex only in the TNF-{alpha}–stimulated extracts (containing C1). No Rel A supershifting is seen in untreated nuclear extracts. These observations indicate that the major effect of TNF-{alpha} is to induce the abundance of Rel A binding activity in HepG2 nuclei.

Previous studies indicate that NF-{kappa}B1 and Rel A have distinct transactivation potentials,22 42 43 44 with NF-{kappa}B1 being a transcriptionally inert DNA-binding protein and Rel A being a potent transcriptional activator. To demonstrate that the activator Rel A is involved in the stimulation of the AGT APRE, we transiently overexpressed Rel A in the HepG2 transfection assay using APRE-LUC as a reporter gene. Fig 5Down demonstrates the mean±SD (of three independent experiments) of transfections using increasing amounts of a eukaryotic expression vector producing Rel A under the direction of the potent CMV long-terminal repeat (pcDNA–Rel A). Using this potent expression vector, we can achieve levels of Rel A high enough to saturate available I{kappa}B, allowing Rel A to function as a constitutive activator. Overexpression of pcDNA–Rel A results in a dose-dependent increase in luciferase reporter activity. Consistent with earlier reports, in separate experiments we have tested the ability of an NF-{kappa}B1 expression vector to activate the APRE-LUC reporter and were unable to stimulate its activity (not shown).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 5. Bar graph showing that transient overexpression of Rel A activates AGT APRE in HepG2 cells. The NF-{kappa}B subunit Rel A was transiently overexpressed in the presence of the APRE/p59ratLuc reporter plasmid. Forty-eight hours after transfection, cells were harvested for independent assay of luciferase and internal control ß-Gal activity (data represent the mean±SD of three independent experiments). The pcDNA–Rel A expression vector activated APRE/p59ratLuc reporter activity in a dose-dependent fashion sevenfold. In this experimental paradigm, Rel A constitutively transactivates the APRE because its expression saturates the I{kappa}B inhibitor. These data indicate that Rel A is a potent activator of APRE transcriptional activity.

Transient overexpression of Rel A using APRE-linked reporter genes cannot distinguish the individual contributions of the various NF-{kappa}B family members because both NF-{kappa}B1 and Rel A bind to the APRE (Figs 2 through 4UpUpUp). To isolate the study of Rel A, we constructed a eukaryotic expression vector that encodes Rel A protein fused in frame to a DNA-binding domain of a yeast transcription factor (GAL4) that is not expressed in mammalian cells. This chimeric protein, GAL4-Rel A, will uniquely bind to GAL4 binding sites (called UAS) and allows for the isolated study of the transcriptional properties of Rel A in response to TNF-{alpha}. The strategy of fusing GAL4 DNA-binding domains to other transactivators is a standard technique that has been applied to study members of other transcription factors individually.41 45 46 The concept is schematically diagrammed in Fig 6ADown. Fig 6BDown demonstrates the results of a transient transfection assay in which the GAL4–Rel A expression vector is cotransfected with UAS-LUC reporter genes into HepG2 cells. In the presence of the full-length Rel A protein (1-551), a dose-dependent increase in UAS-LUC reporter activity is measured. To identify the domain of Rel A that is responsive to TNF-{alpha}, we deleted the sequences coding the N-terminal 255 amino acids of the Rel homology domain and fused this coding sequence to the GAL-4 DNA binding domain GAL4-Rel A (255-551). This protein contains the activation surfaces of the Rel A transcription factor but lacks the DNA-binding and I{kappa}B-interactive domains. In parallel transient transfection experiments, the GAL4–Rel A (255-551) was a potent activator of UAS-LUC reporter activity but was no longer TNF-{alpha}–inducible. Taken together, these data demonstrate not only that Rel A (1-551) is a TNF-{alpha}–inducible activator but also that the N-terminal DNA-binding and I{kappa}B interaction domain is absolutely required for the effect.




View larger version (33K):
[in this window]
[in a new window]
 
Figure 6. A chimeric GAL4:Rel A protein is a TNF-{alpha}–inducible transactivator. A, Schematic view of the GAL4:Rel A protein. The similar DNA-binding characteristics of the NF-{kappa}B proteins preclude their isolated study. To circumvent this problem, a chimeric protein of Rel A fused to the 147–amino acid yeast DNA-binding domain of the GAL4 transcription factor (not expressed in mammalian cells) is constitutively expressed in transiently transfected hepatocytes. Transcriptional activity of the GAL4:Rel A protein can then be selectively measured by basal and TNF-{alpha}–stimulated activity of the GAL4 DNA-binding sites (UAS-LUC). Top, Schematic view of the GAL4:Rel A (1-551) chimera in unstimulated hepatocytes. The I{kappa}B interactive domain of the Rel A molecule inactivates the protein in the absence of hormonal stimulation. Bottom, GAL4:Rel A chimera after TNF-{alpha} stimulation. TNF-{alpha}, upon interacting with the 55-kD TNF receptor (TNFR), results in disruption of the Rel A:I{kappa}B complex. The GAL4:Rel A protein then enters the nucleus, where the GAL4 DNA-binding domain recognizes the UAS-linked luciferase reporter and stimulates its transcription. B, Bar graph showing that GAL4:Rel A transcriptional activity is activated by TNF-{alpha}. HepG2 cells were transiently transfected with GAL4:Rel A expression vectors and the UAS-LUC reporter. Forty-four hours after transfection, cells were stimulated for 4 hours in the absence or presence of increasing concentrations of recombinant human TNF-{alpha} (at the indicated doses). UAS luciferase reporter activity was increased 4.5-fold in a dose-dependent fashion by TNF-{alpha} relative to untreated controls in response to the full-length Rel A (1-551) fused to GAL 4. Deletion of the 254 N-terminal amino acids of Rel A [GAL 4–Rel A (255-551)] resulted in a constitutive activator of GAL4 binding sites not further inducible by TNF-{alpha} (data represent the mean±SD of three independent experiments).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Transcriptional regulation of the AGT gene in hepatocytes influences the activity of the intravascular RAS. In earlier studies, we identified a multihormone-responsive enhancer in the 5' flanking region of the rat AGT gene between -615 and -470 that integrates hormonal signals from both glucocorticoids and cytokines. Within this enhancer, one element is a bona fide cytokine-inducible enhancer (the APRE) that is absolutely required for TNF-{alpha} or IL-1 induction of AGT gene expression. Moreover, this enhancer is a high-affinity DNA-binding site for BPi. In previous studies, this association was argued on the basis of multiple lines of evidence: (1) The BPi produced a methylation interference pattern on the APRE identical to that produced by purified NF-{kappa}B from bovine spleen; (2) both BPi and NF-{kappa}B recognized canonical NF-{kappa}B binding sites; (3) BPi and NF-{kappa}B were both activated in hepatocytes by phorbol esters in the absence of new protein synthesis; and (4) BPi and NF-{kappa}B could be identified in a sequestered form in hepatocyte cytoplasmic extracts.

The demonstration that the multiprotein NF-{kappa}B complex has distinct transcription properties based on its subunit association35 36 37 38 demands that these subunits be identified for a complete understanding of AGT gene expression in hepatocytes.

In this article, we report the identification of the constitutive and TNF-{alpha}–inducible NF-{kappa}B subunits that bind to the APRE. NF-{kappa}B subunit–specific antibodies used in the supershift assay demonstrate that NF-{kappa}B1 binds the APRE in both resting and TNF-{alpha}–stimulated nuclei. Its abundance is only slightly changed by TNF-{alpha} treatment. In contrast, Rel A binding activity is not detectable in unstimulated nuclear extracts and is strongly induced by TNF-{alpha}. Rel A is a potent activator of APRE transcription, as shown by transient overexpression assays using the APRE-linked luciferase reporter gene. That Rel A is TNF-{alpha}–inducible is argued not only by the gel mobility supershift assays but also by transcriptional analysis of GAL4:Rel A chimeras in response to TNF-{alpha}. Moreover, we demonstrate that the N-terminus of Rel A (amino acids 1-254) is absolutely required for TNF-{alpha} induction, because its deletion abolishes TNF-{alpha} inducibility and results in a potent constitutive activator of GAL4 binding sites.

The NF-{kappa}B family is regulated through multiple protein interactions that modify their transcriptional and DNA-binding activities. NF-{kappa}B1 is an inert DNA-binding protein representing an N-terminal proteolytic product of a 105-kD precursor as a consequence of processing from the ubiquitin-proteasome pathway.47 48 NF-{kappa}B1 can exist in a cytoplasmic location in certain cell types, apparently depending on the relative expression of cytoplasmic Rel A, with which NF-{kappa}B1 dimerizes efficiently, and the oncoprotein BCl-3, a nuclear protein that alters the activity and subnuclear distribution of NF-{kappa}B1.49 50 In HepG2 cells, our supershift assays clearly demonstrate that NF-{kappa}B1 DNA binding is present in the nuclei of unstimulated cells. On the basis of comparison of the APRE sequence with optimally defined NF-{kappa}B binding sites produced by PCR-based binding site selection strategy of random oligonucleotides, the APRE represents a predicted high-affinity NF-{kappa}B1 binding site. Consistent with earlier reports of NF-{kappa}B1 as a transcriptionally silent DNA-binding protein,31 42 47 we are unable to transactivate the APRE by overexpressing NF-{kappa}B1 alone. Thus, NF-{kappa}B1 binding is transcriptionally silent on the AGT promoter.

Our data indicate that the C2 complex is probably composed of homodimeric NF-{kappa}B1, whereas the C1 complex is probably composed of NF-{kappa}B1:Rel A heterodimers. This statement is based on the following points. (1) Both C1 and C2 bind DNA with NF-{kappa}B specificity. (2) NF-{kappa}B1 is the only supershifted NF-{kappa}B subunit in unstimulated nuclei in which the C2 complex strongly binds the APRE. (3) The abundance of supershifted NF-{kappa}B1 increases after TNF-{alpha} treatment, whereas the amount of complex C2 does not change (Fig 3Up), indicating that NF-{kappa}B1 is probably contained within the C1 complex. (4) Recombinant Rel A (as a homodimer) does not bind with high affinity to the APRE (data not shown) and probably requires NF-{kappa}B1 to target it to the APRE. We note that APRE transcription occurs parallel with the appearance of the C1 nucleoprotein complex. Taken together, the weight of the evidence argues that Rel A is the relevant APRE transactivator in response to TNF-{alpha} treatment.

The potent transcriptional activator Rel A is encoded by a separate gene but is related to NF-{kappa}B1 by amino acid homology in the first {approx}250 amino acids (called the Rel homology domain), a region first described in the C-Rel proto-oncogene and the drosophila morphogen dorsal.31 47 In resting cells, Rel A is sequestered in the cytoplasm through reversible interactions with I{kappa}B proteins32 ; one I{kappa}B protein identified in rat liver is the homologue of human MAD3 (I{kappa}B-{alpha}).51 I{kappa}B contacts dimeric Rel A through a conserved domain with erythrocyte ankyrin, inactivates its DNA-binding activity, and masks its nuclear localization signal.52 More detailed study will be required to identify how the N-terminal Rel homology domain confers TNF-{alpha} induction. This domain is involved in DNA binding, interaction with I{kappa}B, nuclear localization, and dimerization and also contains protein kinase A and protein kinase C phosphoacceptor sites.53 54 55 In the GAL4:Rel A chimera, the GAL4 DNA-binding domain supplies DNA binding, nuclear localization, and dimerization activity for the fusion protein. Thus, we believe that the most likely mechanism for loss of TNF-{alpha} induction is that amino acids 1-254 are necessary for I{kappa}B interaction. The deletion of the Rel homology domain prevents sequestration of Rel A in the cytoplasm, allowing Rel A to enter the nucleus independent of the TNF-{alpha} hormone and stimulate reporter gene activity. Consistent with this view, we note that the activity of GAL4:Rel A (1-551) is less than GAL4:RelA (255-551) in control (non–TNF-{alpha}–stimulated) HepG2 hepatocytes. Immunofluorescence assays of transfected HepG2 cells using an antibody specific for the chimeric protein will be important to demonstrate this mechanism.

Recruitment of Rel A, the NF-{kappa}B subunit with potent transactivation properties, into the APRE:NF-{kappa}B1 complex is vital to the process of transactivation. In COS cells and T lymphocytes, Rel A contains a potent C-terminal transactivating region necessary for promoter activation.44 54 The observation that GAL4:Rel A (255-551) is a constitutive activator of GAL4 binding sites indicates that the location of the Rel A transactivating domain is also within the C-terminus in HepG2 cells. The C-terminal transactivating region of Rel A is composed of an acidic amino acid residue–rich region contained in a putative amphipathic {alpha}-helix.44 This Rel A acidic activator domain may be necessary to recruit coactivator binding onto the AGT promoter. We also note that Rel A:NF-{kappa}B1 bends DNA upon binding,56 which perhaps could result in either promoter looping or alterations in AGT chromatin structure. The distinction among these various mechanisms will require additional study.

How is Rel A regulated by TNF-{alpha}? Although the mechanism will need to be validated for hepatocytes, we believe that our data are consistent with the general "working model" of TNF-{alpha} action based on studies in T lymphocytes and other cell lines. These studies have shown that TNF-{alpha} activates Rel A by disrupting the Rel A:I{kappa}B complex; this allows the potent Rel A transactivator to enter the nucleus and stimulate transcription. Activation of the TNF receptor results in activation of phosphatidyl-choline–specific phospholipase C and production of 1,2-diacylglycerol. 1,2-Diacylglycerol in turn activates an acidic sphingomyelinase that is thought to be the primary regulator of the Rel A:I{kappa}B complex through a ceramide-activated kinase or phosphatase activity.57 58 59 The I{kappa}B molecule is then directly phosphorylated and proteolyzed.60 61 62 Thus, TNF-{alpha} activates Rel A through a posttranslational modification of its inhibitory subunit, resulting in the nuclear appearance of Rel A (schematically diagrammed in Fig 7Down). Indeed, we have previously shown that induction of NF-{kappa}B DNA-binding activity is independent of new protein synthesis.1 40



View larger version (16K):
[in this window]
[in a new window]
 
Figure 7. Schematic model of TNF-{alpha} activation of AGT APRE transcriptional activity through the Rel A:NF-{kappa}B1 heterodimer. NF-{kappa}B1 homodimers are the predominant APRE binding proteins in unstimulated HepG2 cells. Rel A:NF-{kappa}B1 heterodimers are activated in the cytoplasm of HepG2 hepatoblastoma cells through interactions with the inhibitory (I{kappa}B) proteins. TNF-{alpha} activates nuclear translocation of Rel A:NF-{kappa}B1 complexes by disruption of the NF-{kappa}B:I{kappa}B complex. The Rel A:NF-{kappa}B1 heterodimers then associate with the AGT APRE and stimulate its transcriptional activity.

Our studies have focused on mechanisms of AGT gene activation by inflammation, particularly as a consequence of the hepatic acute-phase response. Why is AGT an acute-phase reactant? Overwhelming bacterial infection is a known hypotensive insult; for example, bacterial endotoxin (lipopolysaccharide) administration in humans produces circulatory collapse.63 In this setting, AGT synthesis would be a homeostatic mechanism as a source for Ang II production in the setting of increased AGT metabolism. AGT may have functions other than serving as an intravascular reservoir for the Ang II peptides. We note that AGT is expressed at extremely high concentrations in fat depots3 64 65 and that TNF-{alpha} is a potent regulator of fat metabolism.25 In particular, local production of TNF-{alpha} may have important roles in regulating lipolysis, insulin sensitivity, and AGT expression in the "local" RAS in fat depots.66 67

Is TNF-{alpha} activation of NF-{kappa}B a relevant mechanism for other physiological mediators of AGT expression? One obvious example is the physiology of CHF. CHF is a condition in which hypoperfusion results in the pathophysiological activation of the RAS and the resultant peripheral vasoconstriction and diminished glomerular filtration rate by the vasoactive effects of Ang II. In several studies, circulating TNF-{alpha} levels are increased in patients with CHF, and the magnitude of increase is predictive of short-term mortality.68 69 We speculate that in CHF, TNF-{alpha} activation of AGT expression may be, in fact, sustaining Ang II production. Finally, NF-{kappa}B (Rel A) is activated by multiple second messengers, including activators of protein kinase C, free radicals, IL-1, and UV light.47 Our demonstration that Rel A is an AGT activator may implicate these other agents as modifiers of circulating or local RAS function. These latter questions are now directly approachable experimentally.


*    Selected Abbreviations and Acronyms
 
ß-Gal = ß-galactosidase
AGT = angiotensinogen
Ang II = angiotensin II
APR = acute-phase response
APRE = acute-phase response element
BPi = TNF-{alpha}–inducible APRE DNA-binding protein complex of the NF-{kappa}B class
C1 = TNF-{alpha}–inducible APRE DNA-binding complex
CHF = congestive heart failure
CMV = cytomegalovirus
EMSA = electrophoretic gel mobility shift assay
IL = interleukin
NF-{kappa}B = nuclear factor–{kappa}B
NF-{kappa}B1 = p50 subunit of NF-{kappa}B
RAS = renin-angiotensin system
Rel A = p65 subunit of NF-{kappa}B
TNF-{alpha} = tumor necrosis factor-{alpha}
UAS = upstream activating sequences
WT = wild-type


*    Acknowledgments
 
This study was supported by National Institutes of Health grant 1R29 HL-45500 to Dr Brasier. Dr Brasier is an Established Investigator of the American Heart Association. We thank Rebecca Soliz for expert secretarial assistance.

Received May 16, 1995; first decision July 11, 1995; accepted August 14, 1995.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Ron D, Brasier AR, Wright KA, Tate JE, Habener JF. An inducible 50-kilodalton NF kappa B-like protein and a constitutive protein both bind the acute-phase response element of the angiotensinogen gene. Mol Cell Biol. 1990;10:1023-1032. [Abstract/Free Full Text]

2. Brasier AR, Ron D, Tate JE, Habener JF. A family of constitutive C/EBP-like DNA binding proteins attenuate the IL-1 alpha induced, NF kappa B mediated trans-activation of the angiotensinogen gene acute-phase response element. EMBO J. 1990;9:3933-3944. [Medline] [Order article via Infotrieve]

3. Campbell DJ, Habener JF. Angiotensinogen gene is expressed and differentially regulated in multiple tissues of the rat. J Clin Invest. 1986;78:31-39.

4. Campbell DJ. Circulating and tissue angiotensin systems. J Clin Invest. 1987;79:1-6.

5. Cassio D, Weiss MC, Ott M-O, Sala-Trepat JM, Fries J, Erdos T. Expression of the albumin gene in rat hepatoma cells and their dedifferentiated variants. Cell. 1981;27:351-358. [Medline] [Order article via Infotrieve]

6. Coezy E, Bouhnik J, Clauser E, Pinot F, Philippe M, Menard J, Corvol P. Effects of glucocorticoids and antiglucocorticoids on angiotensinogen production by hepatoma cells in culture. In Vitro. 1984;20:528-534. [Medline] [Order article via Infotrieve]

7. Peach MJ. Renin-angiotensin system: biochemistry and mechanisms of action. Physiol Rev. 1977;57:313-370. [Free Full Text]

8. Reid IA, Morris BJ, Ganong WG. The renin-angiotensin system. Annu Rev Physiol. 1978;40:377-410. [Medline] [Order article via Infotrieve]

9. Caulfield M, Lavender P, Farrall M, Munroe P, Lawson M, Turner P, Clark AJ. Linkage of the angiotensinogen gene to essential hypertension. N Engl J Med. 1994;330:1629-1633. [Abstract/Free Full Text]

10. Jeunemaitre X, Soubrier F, Kotelevtsev YV, Lifton RP, Williams CS, Charru A, Hunt SC, Hopkins PN, Williams RR, Lalouel JM. Molecular basis of human hypertension: role of angiotensinogen. Cell. 1992;71:169-180. [Medline] [Order article via Infotrieve]

11. Watt GCM, Harrap SB, Foy CJW, Holton DW, Edwards HV, Davidson HR, Connor JM, Lever AF, Fraser R. Abnormalities of glucocorticoid metabolism and the renin-angiotensin system: a four corners approach to the identification of genetic determinants of blood pressure. J Hypertens. 1992;10:473-482. [Medline] [Order article via Infotrieve]

12. Walker WG, Whelton PK, Saito H, Russel RP, Hermann J. Relation between blood pressure and renin, renin substrate, Ang II, aldosterone and urinary sodium and potassium in 574 ambulatory subjects. Hypertension. 1979;1:287-291. [Abstract/Free Full Text]

13. Brasier AR, Philippe J, Campbell DJ, Habener JF. Novel expression of the angiotensinogen gene in a rat pancreatic islet cell line: transcriptional regulation by glucocorticoids. J Biol Chem. 1986;261:16148-16154. [Abstract/Free Full Text]

14. Brasier AR, Ron D, Tate JE, Habener JF. Synergistic enhansons located within an acute phase responsive enhancer modulate glucocorticoid induction of angiotensinogen gene transcription. Mol Endocrinol. 1990;4:1921-1933. [Abstract/Free Full Text]

15. Ben-Ari ET, Lynch KR, Garrison JC. Glucocorticoids induce the accumulation of novel angiotensinogen gene transcripts. J Biol Chem. 1989;264:13074-13079. [Abstract/Free Full Text]

16. Sernia C, Clements JA, Funder JW. Regulation of liver angiotensinogen mRNA by glucocorticoids and thyroxine. Mol Cell Endocrinol. 1989;61:147-156. [Medline] [Order article via Infotrieve]

17. Gordon MS, Chin WW, Shupnik MA. Regulation of angiotensinogen gene expression by estrogen. J Hypertens. 1992;10:361-366. [Medline] [Order article via Infotrieve]

18. Hong-Brown LQ, Deschepper CF. Effects of thyroid hormones on angiotensinogen gene expression in rat liver, brain, and cultured cells. Endocrinology. 1992;130:1231-1237. [Abstract/Free Full Text]

19. Kimura S, Iwao H, Fukui K, Abe Y, Tanaka S. Effect of thyroid hormone on angiotensinogen and renin mRNA levels in rat. Jpn J Pharmacol. 1990;52:281-285. [Medline] [Order article via Infotrieve]

20. Eggena P, Zhu JH, Clegg K, Barrett JD. Nuclear angiotensin receptors induce transcription of renin and angiotensinogen mRNA. Hypertension. 1993;22:496-501. [Abstract/Free Full Text]

21. Hilgenfeldt U, Schwind S. Angiotensin II is the mediator of the increase in hepatic angiotensinogen synthesis after bilateral nephrectomy. Am J Physiol. 1993;265:E414-E418. [Abstract/Free Full Text]

22. Schmid RM, Perkins ND, Duckett CS, Andrews PC, Nabel GJ. Cloning of an NF-kappa B subunit which stimulates HIV transcription in synergy with p65. Nature. 1991;352:733-736. [Medline] [Order article via Infotrieve]

23. Nakamura A, Iwao H, Fukui K, Kimura S, Tamaki T, Nakanishi S, Abe Y. Regulation of liver angiotensinogen and kidney renin mRNA levels by angiotensin II. Am J Physiol. 1990;258:E1-E6. [Abstract/Free Full Text]

24. Saye JA, Cassis LA, Sturgill TW, Lynch KR, Peach MJ. Angiotensinogen gene expression in mouse 3T3-L1 cells. Am J Physiol. 1989;256:C448-C451.[Abstract/Free Full Text]

25. Ron D, Brasier AR, McGehee RE Jr, Habener JF. Tumor necrosis factor-induced reversal of adipocytic phenotype of 3T3-L1 cells is preceded by a loss of nuclear CCAAT/enhancer binding protein (C/EBP). J Clin Invest. 1992;89:223-233.

26. Brasier AR, Tate JE, Ron D, Habener JF. Multiple cis-acting DNA regulatory elements mediate hepatic angiotensinogen gene expression. Mol Endocrinol. 1989;3:1022-1034. [Abstract/Free Full Text]

27. McGehee RE Jr, Ron D, Brasier AR, Habener JF. Differentiation-specific element: a cis-acting developmental switch required for the sustained transcriptional expression of the angiotensinogen gene during hormonal-induced differentiation of 3T3-L1 fibroblasts to adipocytes. Mol Endocrinol. 1993;7:551-560. [Abstract/Free Full Text]

28. Ron D, Brasier AR, Habener JF. Angiotensinogen gene-inducible enhancer-binding protein 1, a member of a new family of large nuclear proteins that recognize nuclear factor kappa B-binding sites through a zinc finger motif. Mol Cell Biol. 1991;11:2887-2895.[Abstract/Free Full Text]

29. Ron D, Brasier AR, Wright KA, Habener JF. The permissive role of glucocorticoids on interleukin-1 stimulation of angiotensinogen gene transcription is mediated by an interaction between inducible enhancers. Mol Cell Biol. 1990;10:4389-4395. [Abstract/Free Full Text]

30. Ron D, Brasier AR, Habener JF. Transcriptional regulation of hepatic angiotensinogen gene expression by the acute-phase response. Mol Cell Endocrinol. 1990;74:C97-C104. [Medline] [Order article via Infotrieve]

31. Baeuerle PA. The inducible transcription activator NF-kappa B: regulation by distinct protein subunits. Biochim Biophys Acta. 1991;1072:63-80. [Medline] [Order article via Infotrieve]

32. Urban MB, Baeuerle PA. The 65-kD subunit of NF-kappa B is a receptor for I kappa B and a modulator of DNA-binding specificity. Genes Dev. 1990;4:1975-1984. [Abstract/Free Full Text]

33. Baeuerle PA, Baltimore D. A 65-kDa subunit of active NF-kappaB is required for inhibition of NF-{kappa}B by I{kappa}B. Genes Dev. 1989;3:1689-1698. [Abstract/Free Full Text]

34. Beg AA, Baldwin AS Jr. The I kappa B proteins: multifunctional regulators of Rel/NF-kappa B transcription factors. Genes Dev. 1993;7:2064-2070. [Free Full Text]

35. Kunsch C, Ruben SM, Rosen CA. Selection of optimal {kappa}B/Rel DNA-binding motifs: interaction of both subunits of NF-{kappa}B with DNA is required for transcriptional activation. Mol Cell Biol. 1992;12:4412-4421. [Abstract/Free Full Text]

36. Hansen SK, Nerlov C, Zabel U, Verde P, Johnsen M, Baeuerle PA, Blasi F. A novel complex between the p65 subunit of NF-{kappa}B and c-Rel binds to a DNA element involved in the phorbol ester induction of the human urokinase gene. EMBO J. 1992;11:205-213. [Medline] [Order article via Infotrieve]

37. Ryseck R-P, Bull P, Takamiya M, Bours V, Siebenlist U, Dobrzanski P, Bravo R. RelB, a new Rel family transcription activator that can interact with p50-NF-{kappa}B. Mol Cell Biol. 1992;12:674-684. [Abstract/Free Full Text]

38. Urban MB, Schreck R, Baeuerle PA. NF-kappa B contacts DNA by a heterodimer of the p50 and p65 subunit. EMBO J. 1991;10:1817-1825. [Medline] [Order article via Infotrieve]

39. Brasier AR, Ron D. Luciferase reporter gene assay in mammalian cells. Methods Enzymol. 1992;216:386-397. [Medline] [Order article via Infotrieve]

40. Brasier AR, Tate JE, Habener JF. Optimized use of the firefly luciferase assay as a reporter gene in mammalian cell lines. Biotechniques. 1989;7:1116-1122. [Medline] [Order article via Infotrieve]

41. Sadowski I, Ptashne M. A vector for expressing GAL4 (1-147) in mammalian cells. Nucleic Acids Res. 1989;17:7539. [Free Full Text]

42. Kieran M, Blank V, Logeat F, Vandekerckhove J, Lottspeich F, Le Bail O, Urban MB, Kourilsky P, Baeuerle PA, Israel A. The DNA binding subunit of NF-kappa B is identical to factor KBF1 and homologous to the rel oncogene product. Cell. 1990;62:1007-1018. [Medline] [Order article via Infotrieve]

43. Perkins ND, Schmid RM, Duckett CS, Leung K, Rice NR, Nabel GJ. Distinct combinations of NF-kappa B subunits determine the specificity of transcriptional activation. Proc Natl Acad Sci U S A. 1992;89:1529-1533. [Abstract/Free Full Text]

44. Schmitz ML, Baeuerle PA. The p65 subunit is responsible for the strong transcription activating potential of NF-{kappa}B. EMBO J. 1991;12:3805-3817.

45. Liu F, Green MR. A specific member of the ATF transcription factor family can mediate transcription activation by the adenovirus E1a protein. Cell. 1990;61:1217-1224. [Medline] [Order article via Infotrieve]

46. Lin Y-S, Carey MF, Ptashne M, Green MR. Gal4 derivatives function alone and synergistically with mammalian activators in vitro. Cell. 1988;54:659-664. [Medline] [Order article via Infotrieve]

47. Blank V, Kourilsky P, Israel A. NF-kappa B and related proteins: Rel/dorsal homologies meet ankyrin-like repeats. Trends Biochem Sci. 1992;17:135-140. [Medline] [Order article via Infotrieve]

48. Palombella VJ, Rando OJ, Goldberg AL, Maniatis T. The ubiquitin-proteasome pathway is required for processing the NF-{kappa}B1 precursor protein and the activation of NF-{kappa}B. Cell. 1994;78:773-785. [Medline] [Order article via Infotrieve]

49. Zhang Q, DiDonato JA, Karin M, McKeithan TW. BCL3 encodes a nuclear protein which can alter the subcellular location of NF-{kappa}B proteins. Mol Cell Biol. 1994;14:3915-3926. [Abstract/Free Full Text]

50. Kerr LD, Duckett CS, Wamsley P, Zhang Q, Chiao P, Nabel G, McKeithan TW, Baeuerle PA, Verma IM. The proto-oncogene bcl-3 encodes an I kappa B protein. Genes Dev. 1992;6:2352-2363. [Abstract/Free Full Text]

51. Tewari M, Dobrzanski P, Mohn KL, Cressman DW, Hsu J-C, Bravo R, Taub R. Rapid induction in regenerating liver of RL/IF-1 (an I{kappa}B that inhibits NF-{kappa}B, RelB-p50, and C-Rel-p50) and PHF, a novel {kappa}B site-binding complex. Mol Cell Biol. 1992;12:2898-2908. [Abstract/Free Full Text]

52. Hatada EN, Naumann M, Scheidereit C. Common structural constituents confer I{kappa}B activity to NF-{kappa}B p105 and I{kappa}B/MAD-3. EMBO J. 1993;12:2781-2788. [Medline] [Order article via Infotrieve]

53. Naumann M, Scheidereit C. Activation of NF-{kappa}B in vivo is regulated by multiple phosphorylations. EMBO J. 1994;13:4597-4607. [Medline] [Order article via Infotrieve]

54. Ruben SM, Narayanan R, Klement JF, Chen CH, Rosen CA. Functional characterization of the NF-kappa B p65 transcriptional activator and an alternatively spliced derivative. Mol Cell Biol. 1992;12:444-454. [Abstract/Free Full Text]

55. Ruben SM, Dillon PJ, Schreck R, Henkel T, Chen CH, Maher M, Baeuerle PA, Rosen CA. Isolation of a rel-related human cDNA that potentially encodes the 65-kD subunit of NF-kappa B. Science. 1991;254:11. Letter. [Free Full Text]

56. Zabel U, Schreck R, Baeuerle PA. DNA binding of purified transcription factor NF-kappa B: affinity, specificity, Zn2+ dependence, and differential half-site recognition. J Biol Chem. 1991;266:252-260. [Abstract/Free Full Text]

57. Meichle A, Schutze S, Hensel G, Bruming D, Kronke M. Protein kinase C-independent activation of NF-{kappa}B by TNF. J Biol Chem. 1990;265:8339-8343. [Abstract/Free Full Text]

58. Wiegmann K, Schutze S, Machleidt T, Witte D, Kronke M. Functional dichotomy of neutral and acidic sphingomyelinases in TNF signalling. Cell. 1994;78:1005-1015. [Medline] [Order article via Infotrieve]

59. Schutze S, Potthoff K, Machleidt T, Berkovic D, Wiegmann K, Kronke M. TNF activates NF-kappa B by phosphatidylcholine-specific phospholipase C-induced `acidic' sphingomyelin breakdown. Cell. 1992;71:765-776. [Medline] [Order article via Infotrieve]

60. Mellits KH, Hay RT, Goodbourn S. Proteolytic degradation of MAD3 (I kappa B alpha) and enhanced processing of the NF-kappa B precursor p105 are obligatory steps in the activation of NF-kappa B. Nucleic Acids Res. 1993;21:5059-5066. [Abstract/Free Full Text]

61. Ghosh S, Baltimore D. Activation in vitro of NF-kappa B by phosphorylation of its inhibitor I kappa B. Nature. 1990;344:678-682. [Medline] [Order article via Infotrieve]

62. Henkel T, Machleidt T, Alkalay I, Kronke M, Ben-Neriah Y, Baeuerle PA. Rapid proteolysis of I kappa B-alpha is necessary for activation of transcription factor NF-kappa B. Nature. 1993;365:182-185. [Medline] [Order article via Infotrieve]

63. Michie HR, Manogue KR, Spriggs DR, Revhaug A. Detection of circulating tumor necrosis factor after endotoxin administration. N Engl J Med. 1988;318:1481-1486. [Abstract]

64. Campbell DJ, Habener JF. Cellular localization of angiotensinogen gene expression in brown adipose tissue and mesentery: quantification of messenger ribonucleic acid abundance using hybridation in situ. Endocrinology. 1987;121:1616-1626. [Abstract/Free Full Text]

65. Cassis LA, Saye J, Peach MJ. Localization and regulation of rat angiotensinogen messenger RNA. Hypertension. 1988;11:591-596. [Abstract/Free Full Text]

66. Brownlee M, Cerami A, Vlassara H. Advanced glycosylation end products in tissue and the biochemical basis of diabetic complications. N Engl J Med. 1988;318:1315-1321. [Medline] [Order article via Infotrieve]

67. Green A, Dobias SB, Walters DJA, Brasier AR. Tumor necrosis factor increases the rate of lipolysis in primary cultures of adipocytes without altering levels of hormone-sensitive lipase. Endocrinology. 1994;134:2581-2588. [Abstract/Free Full Text]

68. Dutka DP, Elborn JS, Delamere F, Shale DJ, Morris GK. Tumour necrosis factor alpha in severe congestive cardiac failure. Br Heart J. 1993;70:141-143. [Abstract/Free Full Text]

69. Katz SD, Rao R, Berman JW, Schwarz M, Demopoulos L, Bijou R, LeJemtel TF. Pathophysiological correlates of increased serum tumor necrosis factor in patients with congestive heart failure: relation to nitric oxide-dependent vasodilation in the forearm circulation. Circulation. 1994;90:12-16.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
HypertensionHome page
S. Sriramula, M. Haque, D. S.A. Majid, and J. Francis
Involvement of Tumor Necrosis Factor-{alpha} in Angiotensin II-Mediated Effects on Salt Appetite, Hypertension, and Cardiac Hypertrophy
Hypertension, May 1, 2008; 51(5): 1345 - 1351.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Y. Yu, Z.-H. Zhang, S.-G. Wei, Y. Chu, R. M. Weiss, D. D. Heistad, and R. B. Felder
Central Gene Transfer of Interleukin-10 Reduces Hypothalamic Inflammation and Evidence of Heart Failure in Rats After Myocardial Infarction
Circ. Res., August 3, 2007; 101(3): 304 - 312.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Y. Ozawa, H. Kobori, Y. Suzaki, and L. G. Navar
Sustained renal interstitial macrophage infiltration following chronic angiotensin II infusions
Am J Physiol Renal Physiol, January 1, 2007; 292(1): F330 - F339.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
I. A. Arenas, S. J. Armstrong, Y. Xu, and S. T. Davidge
Tumor Necrosis Factor-{alpha} and Vascular Angiotensin II in Estrogen-Deficient Rats
Hypertension, September 1, 2006; 48(3): 497 - 503.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
M. Flesch, A. Hoper, L. Dell'Italia, K. Evans, R. Bond, R. Peshock, A. Diwan, T. A. Brinsa, C.-C. Wei, N. Sivasubramanian, et al.
Activation and Functional Significance of the Renin-Angiotensin System in Mice With Cardiac Restricted Overexpression of Tumor Necrosis Factor
Circulation, August 5, 2003; 108(5): 598 - 604.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
S. Aker, S. Belosjorow, I. Konietzka, A. Duschin, C. Martin, G. Heusch, and R. Schulz
Serum but not myocardial TNF-{alpha} concentration is increased in pacing-induced heart failure in rabbits
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2003; 285(2): R463 - R469.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
J. M. Fernandez-Real and W. Ricart
Insulin Resistance and Chronic Cardiovascular Inflammatory Syndrome
Endocr. Rev., June 1, 2003; 24(3): 278 - 301.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. Klahr and J. Morrissey
Obstructive nephropathy and renal fibrosis
Am J Physiol Renal Physiol, November 1, 2002; 283(5): F861 - F875.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
D. N. Muller, E. Shagdarsuren, J.-K. Park, R. Dechend, E. Mervaala, F. Hampich, A. Fiebeler, X. Ju, P. Finckenberg, J. Theuer, et al.
Immunosuppressive Treatment Protects Against Angiotensin II-Induced Renal Damage
Am. J. Pathol., November 1, 2002; 161(5): 1679 - 1693.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
T. Skoog, W. Dichtl, S. Boquist, C. Skoglund-Andersson, F. Karpe, R. Tang, M.G. Bond, U. de Faire, J. Nilsson, P. Eriksson, et al.
Plasma tumour necrosis factor-{alpha} and early carotid atherosclerosis in healthy middle-aged men
Eur. Heart J., March 1, 2002; 23(5): 376 - 383.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
F. C. Luft
Workshop: Mechanisms and Cardiovascular Damage in Hypertension
Hypertension, February 1, 2001; 37(2): 594 - 598.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
Z. Pausova, B. Deslauriers, D. Gaudet, J. Tremblay, T. A. Kotchen, P. Larochelle, A. W. Cowley, and P. Hamet
Role of Tumor Necrosis Factor-{alpha} Gene Locus in Obesity and Obesity-Associated Hypertension in French Canadians
Hypertension, July 1, 2000; 36(1): 14 - 19.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
G. Guo, J. Morrissey, R. McCracken, T. Tolley, and S. Klahr
Role of TNFR1 and TNFR2 receptors in tubulointerstitial fibrosis of obstructive nephropathy
Am J Physiol Renal Physiol, November 1, 1999; 277(5): F766 - F772.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Y. Han, M. S. Runge, and A. R. Brasier
Angiotensin II Induces Interleukin-6 Transcription in Vascular Smooth Muscle Cells Through Pleiotropic Activation of Nuclear Factor-{kappa}B Transcription Factors
Circ. Res., April 2, 1999; 84(6): 695 - 703.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. Hubert, J.-M. Gasc, S. Berger, G. Schütz, and P. Corvol
Effects of Mineralocorticoid Receptor Gene Disruption on the Components of the Renin-Angiotensin System in 8-Day-Old Mice
Mol. Endocrinol., February 1, 1999; 13(2): 297 - 306.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
B. Zinman, A. J. G. Hanley, S. B. Harris, J. Kwan, and I. G. Fantus
Circulating Tumor Necrosis Factor-{alpha} Concentrations in a Native Canadian Population with High Rates of Type 2 Diabetes Mellitus
J. Clin. Endocrinol. Metab., January 1, 1999; 84(1): 272 - 278.
[Abstract] [Full Text]


Home page
HypertensionHome page
N. Nyui, K. Tamura, S. Yamaguchi, M. Nakamaru, T. Ishigami, M. Yabana, M. Kihara, H. Ochiai, N. Miyazaki, S. Umemura, et al.
Tissue Angiotensinogen Gene Expression Induced by Lipopolysaccharide in Hypertensive Rats
Hypertension, October 1, 1997; 30(4): 859 - 867.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J.-M. Fernandez-Real, B. Lainez, J. Vendrell, M. Rigla, A. Castro, G. Penarroja, M. Broch, A. Perez, C. Richart, P. Engel, et al.
Shedding of TNF-alpha receptors, blood pressure, and insulin sensitivity in type 2 diabetes mellitus
Am J Physiol Endocrinol Metab, April 1, 2002; 282(4): E952 - E959.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brasier, A. R.
Right arrow Articles by Wimbish, K. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brasier, A. R.
Right arrow Articles by Wimbish, K. A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH