(Hypertension. 1996;27:1009-1017.)
© 1996 American Heart Association, Inc.
Articles |
Presented in part at the 67th Scientific Sessions of the American Heart Association, Dallas, Tex, November 14-17, 1994.
From the Departments of Medicine (A.R.B., J.L., K.A.W.) and Human Biological Chemistry and Genetics and the Sealy Center for Molecular Science (A.R.B.), University of Texas Medical Branch, Galveston.
Correspondence to Allan R. Brasier, Division of Endocrinology, MRB 3.142, University of Texas Medical Branch, 301 University Blvd, Galveston, TX 77555-1060.
| Abstract |
|---|
|
|
|---|
by a
nuclear factor
Blike protein binding to an inducible enhancer
called the acute-phase response element. By gel mobility shift
assays, we observe two specific acute-phase response
elementbinding complexes, C1 and C2. The abundance of C2 is not
changed by TNF treatment. In contrast, C1 is faintly detected in
untreated cells, and its abundance increases by fivefold after
stimulation. We identify the nuclear factor
B subunits in these
complexes using subunit-specific antibodies in the gel mobility
"supershift" assay. The transcriptionally inert nuclear
factor
B DNA-binding subunit NF-
B1 is present in both
control and stimulated hepatocyte nuclei. Its abundance
changes weakly upon TNF stimulation. In contrast, the potent
transactivating protein Rel A is not found in unstimulated
hepatocyte nuclei and is recruited by TNF-
into the C1
DNA-binding complex. Overexpression of Rel A results in acute-phase
response element transcription. Cotransfection of a chimeric GAL4Rel
A protein with GAL4 DNA-binding sites is a strategy that allows for
selective study of Rel A. The GAL4:Rel A chimera is a
TNF-
inducible transactivator. Deletion of the
amino-terminal 254 amino acids of Rel A produces a constitutive
activator (that is no longer TNF-
inducible). The
cytokine induction of Rel A, then, is mediated through its
amino-terminal 254 amino acids. We conclude that Rel A:NF-
B1 is
a crucial cytokine-inducible transcription factor complex
regulating angiotensinogen gene synthesis in
hepatocytes and may be involved in controlling the
activity of the renin-angiotensin system.
Key Words: nuclear factor kappa B renin-angiotensin system angiotensinogen acute-phase reaction
| Introduction |
|---|
|
|
|---|
AGT gene expression in liver is tightly controlled through the influence of multiple hormonal stimuli, including (1) the steroid hormones: glucocorticoids,6 13 14 15 16 estrogens,3 17 and triiodothyronine18 19 ; (2) the peptide product of AGT processing, Ang II20 21 22 23 ; (3) the state of cellular differentiation24 25 26 27 ; and (4) cytokine hormones elaborated as a consequence of systemic inflammation (the APR1 2 28 29 ). These hormones alter AGT expression under physiological conditions by affecting the abundance of transcription factors that bind to the AGT promoter in hepatic nuclei.
One well-characterized physiological activator of
AGT expression is the hepatic APR, a
stereotypical response of the mammalian liver to the initiation of
inflammation. In the APR, local injury or inflammation results in
cytokine elaboration (IL-1 and TNF-
); these hormones induce
a switch in hepatic gene synthesis to producing proteins involved in
macrophage opsonization and wound repair. The APR, initiated
experimentally by intraperitoneal
lipopolysaccharide and effected by the production
of TNF-
, is a potent inducer of hepatic AGT expression.
Study of AGT regulation during the APR has revealed insights
into transcriptional control elements and DNA-binding proteins that
control expression of the rat AGT gene (reviewed in
Reference 30). One crucial DNA control element, located between
-531 and -557 in the rat gene 5' to the transcription start
site, contains the sequence 5'-AGTTGGGATTTCCCAACC-3' that we have
called the APRE. The APRE is a TNF-
inducible enhancer that
confers TNF-
induction onto an inert minimal
promoter.1
The APRE functions because it is a binding site for the potent
transcription factor complex NF-
B. NF-
B is a multiprotein complex
encoded by different genes but sharing a homologous 250amino acid
N-terminal DNA-binding domain. These members include Rel A (p65), Rel
B, NF-
B1 (NF-
B p50), and NF-
B2 (NF-
B p49) (reviewed in
Reference 31). Rel A is a powerful transactivating NF-
B family
member that binds to DNA sequences either as homodimers or as a
heterodimer with one of the strong DNA-binding subunits, NF-
B1 or
NF-
B2. In resting cells, NF-
B is sequestered in the cytoplasm
through reversible interactions with a family of inhibitory
proteins called I
B.32 33 34 Cytokines such as
TNF-
activate NF-
B by disrupting the I
B complex
through a coupled phosphorylation/degradation step,
allowing the NF-
B complex to enter the nucleus, bind to inducible
promoters, and stimulate their transcription.
Mutations of the APRE that disrupt NF-
B binding also prevent
cytokine induction of the AGT promoter.1 That
NF-
B binds to the AGT APRE has been argued
circumstantially on the basis of similar methylation-interference
patterns, the existence of latent cytoplasmic APRE binding activity,
and cross-competition experiments in in vitro DNA-binding
assays.2 14 Characterization of the NF-
B subunit
composition that binds the AGT APRE is important because the
heteromeric complexes Rel A:Rel A,35 Rel A:Rel
B,36 Rel B:NF-
B1,37 and Rel
A:NF-
B138 have all been observed to bind to similar DNA
sequences with distinct transactivational activities and modes of
regulation. What are the relevant NF-
B subunits controlling hepatic
AGT expression?
In this article, we characterize the subunit composition of the NF-
B
members that bind the AGT APRE in control and
TNF-
stimulated human hepatoblastoma (HepG2) nuclei. TNF-
induces APRE transcriptional activity in a dose-dependent fashion.
In parallel, TNF increases the DNA binding of an NF-
Bspecific
complex of unique mobility. Using NF-
B subunitspecific
antibodies in the gel mobility "supershift" assay, we identify
the NF-
B subunits NF-
B1 and Rel A as the relevant NF-
B members
controlling AGT expression.
| Methods |
|---|
|
|
|---|
treatment. The 1.25 µg concentration is
selected to produce galactosidase expression that accurately reflects
changes in transfection efficiency. In the experiments in which
transient overexpression is used, the expression plasmid is included in
place of carrier pGEM DNA to maintain the same DNA concentration per
plate. Twenty-four hours after transfection, cells were washed,
fresh medium was added, and cells were cultured for an additional 20
hours. Four hours before harvest, recombinant human TNF-
was added
at the indicated concentrations.
Reporter Assays
Transfected cells were harvested by washing two times in PBS and
lysed on the plate by the addition of 0.3 mL of lysis buffer (25 mmol/L
Tris-phosphate, pH 7.8, 2 mmol/L DTT, 2 mmol/L
1,2-diaminocyclohexane-N,N,N',N'-tetraacetic
acid, 10% glycerol, 1% Triton X-100). After cells were
incubated in lysis buffer for 15 minutes at room temperature, plates
were scraped, and lysates were transferred to 1.5-mL Eppendorf
centrifuge tubes and spun in a microcentrifuge at
10 000 rpm for 5 minutes. Cytoplasmic lysate (100 µL) was assayed
for luciferase reporter activity by injection of 100 µL of luciferase
assay reagent (20 mmol/L Tricine, 1.07 mmol/L
[MgCO3]Mg[OH]2 · 5H2O, 2.67
mmol/L MgSO4, 0.1 mmol/L EDTA, 33.3 mmol/L
DTT, 270 µmol/L coenzyme A, 470 µmol/L luciferin, 530 µmol/L
ATP). Light output was measured over 16 seconds in a refrigerated
Berthold 953 luminometer. ß-Gal activity was measured separately by
100 µL to the synthetic substrate ONPG, and quantification of the
product was determined spectrophotometrically. Luciferase activity
was determined by subtracting machine blank and normalizing each plate
to ß-Gal activity. The mean and SD were then calculated for each
independently transfected set of triplicate plates. Activity (in
multiples) was calculated by dividing the normalized luciferase
activity by that determined for the same reporter in the absence of
TNF-
stimulation.
Gel Mobility Shift Assays of Nuclear Extracts
To extract nuclear protein from treated cells, the cytoplasmic
lysate was aspirated from the nuclear pellet, 50 µL of nuclear
extract buffer (in mmol/L: HEPES 10, pH 7.8, KCl 400, EGTA 0.1, EDTA
0.1, PMSF 1, and DTT 1) was added, and nuclear protein was extracted by
gentle agitation at 4°C to allow lysis of the nuclei and extraction
of the DNA-binding proteins. The insoluble chromatin and membranes were
removed by centrifugation for 5 minutes in a
microcentrifuge at maximal speed (10 000 rpm), and the
supernatant was saved for analysis of DNA-binding activity.
Typically, we obtain nuclear protein at 2 to 5 µg/mL
(representing 100 to 250 µg/60 min plates).
Gel mobility shift assays were performed as previously
described,1 2 14 39 using the indicated amounts of nuclear
extract incubated with 2x104 cpm of duplex
oligonucleotide (labeled by Klenow "fill-in"
using [
-32P]dATP). After binding for 15 minutes at
22°C, samples were electrophoresed on 6% to 7% nondenaturing
polyacrylamide gel in 1x TBE (25 mmol/L Tris, 25 mmol/L boric
acid, and 0.5 mmol/L EDTA) at 180 V (constant voltage) for 2 hours.
Competition was performed by the addition of excess nonradioactive
double-stranded oligonu-cleotide
competitor at the time of addition of radioactive probe. The sequences
of the APRE are as follows: APRE WT
GATCCACCACAGTTGGGATTTCCCAACCTGACCA
GAGGTGTCAACCCTAAAGGGTTGGACTGGTCTAG
*** APRE M6 GATCCACCACAGTTGTGATTTCACAACCTGACCA
GTGGTGTCAACACTAAAGTGTTGGACTGGTCTAG APRE M2 GATCCACCACATGTTGGATTTCCGATACTGACCA
GTGGTGTACAACCTAAAGGCTATGACTGGTCTAG (Asterisks indicate
points of NF-
B contact using the methylation interference
assay.1 )
After electrophoresis, gels were dried and exposed overnight at -70°C to Kodak X-AR film or for quantification to a PhosphorImager cassette and analyzed by ImageQuant software with a Molecular Dynamics 425E PhosphorImager.
Antibody supershift assays were performed by addition to the binding
reaction of 1 µL of unfractionated antibody in serum and incubation
for 20 minutes at 22°C. The antibody:NF-
B:DNA complexes were
electrophoresed on a softer polyacrylamide gel (5%); the free
probe and bromphenol blue tracking dyes were electrophoresed off the
gel to allow visualization of the antibody:NF-
B:DNA complexes.
AntiNF-
B1 antibody was produced by immunizing rabbits with a
bacterially expressed polyhistidine-tagged NF-
B1 protein. This
NF-
B1 protein was produced by use of the T7 promoter/polymerase in
Escherichia coli and purified to homogeneity by
nickel-agarose (Ni-NTA, Qiagen) affinity
chromatography. The NF-
B1 domain is a unique region
in the C-terminus not conserved with other NF-
B family members
(amino acids 410-480). This antibody binds and supershifts recombinant
full-length NF-
B1 protein. AntiRel A, antic-Rel, and
antiNF-
B2 antibodies were obtained commercially (Santa Cruz
Biotech). AntiRel A does not cross-react with recombinant
NF-
B1 and recognizes a 65-kD protein in HepG2 nuclear extracts, and
thus is subunit specific.
Plasmid Construction
APRE-LUC consists of the trimerized rat AGT APRE WT
sequences ligated through BamHI/Bgl II ends into
the p59 rat AGT minimal promoter driving the expression of
the firefly luciferase reporter gene.1 2 14 26 40 Site
mutations of the rat AGT APRE were constructed by the same
strategy.
The eukaryotic expression vector encoding full-length human Rel A was produced by ligating the 2.2-kb coding sequences (1-551) of Rel A into the BamHI site of the eukaryotic expression vector pcDNAI (InVitrogen Inc). This expression vector produces Rel A mRNA under the direction of the powerful eukaryotic CMV long-terminal repeat. Dideoxynucleotide sequencing using the SP6 primer site was used to confirm its authenticity. The GAL4Rel A expression vector was constructed by use of the eukaryotic expression vector pSG42441 that produces GAL4 (1-147) under control of the SV40 early region promoter/enhancer. The multiple cloning site was altered to place a BamHI restriction site in frame with the GAL4 coding sequences (pGAL4 Ad). Rel A (1-551) was then cloned as a BamHI fragment into the pGAL4 Ad plasmid. Rel A (255-551) was produced by amplifying in the polymerase chain reaction the Rel A (255-551) coding sequences, restricting the PCR fragment with BamHI and Xba I, and ligating into pGAL4 Ad restricted with BamHI and Xba I. The upstream oligonucleotide used for the Rel A amplification was 5'-GCC ATT GAA TTC T CTA GATTAG GAG CTG ATC TGA CTC AGC AGG-3' (the Xba I site is underlined and stop codon indicated in bold). Sequencing of the GAL4Rel A coding sequences was performed to ensure authenticity of the coding sequences. The UAS-LUC reporter plasmid was constructed by use of the tandem GAL4 binding sites ligated upstream from the -59 rat AGT minimal promoter. The UAS sequences are GATCCCGGAGGACTGTCCTCCGCGGAGGACTGTCCTCCGA and GGCCTCCTGACAGGAGGCGCCTCCTGACAGGAGGCTCTAG. All plasmids were prepared on cesium chloride gradients before transfection, and their concentrations were determined spectrophotometrically.
| Results |
|---|
|
|
|---|
B proteins, we constructed a
sensitive reporter plasmid for measuring the transcriptional activation
of the APRE. The plasmid consists of three copies of the rat
AGT APRE ligated upstream from the -59 rat
AGT promoter in the sensitive luciferase reporter gene
(APRE-LUC). APRE-LUC has previously been demonstrated to initiate
transcription at the nucleotide (nt) +1 cap site in exon 1
of the rat AGT gene.2 APRE-LUC was transfected into HepG2
cells along with internal control plasmid CMVß-Gal, an activity
that is independently measured to normalize for plate-to-plate
changes in luciferase reporter activity; transfectants were stimulated
for 4 hours (44 hours after transfection) with the indicated increasing
concentrations of recombinant human TNF-
, and reporter activity was
measured. Fig 1
increased APRE transcriptional activity 7.5-fold at 0.3 ng/mL to
27-fold at 30 ng/mL. Mediation of the TNF-
induction by specific DNA
sequences on the APRE is indicated by measurement of the TNF-
induction of APRE site mutations (APRE M6 and APRE M2) ligated into the
same promoter. As shown in Fig 1
stimulation.
|
To identify the TNF-
inducible APRE binding proteins, nuclear
extracts from control and TNF-
stimulated HepG2 cells were
prepared and analyzed by EMSA. In the absence of TNF-
, a
strong DNA-binding complex (C2) is detectable, and a slower mobility
complex (C1) is faintly detectable (Fig 2
). Upon TNF-
treatment, the
slower-mobility C1 complex increases its binding to the APRE in a
dose-dependent fashion (see also Fig 3
). Binding
specificity of the TNF-
inducible C1 complex is shown in Fig 3
, in which unlabeled oligonucleotides
containing site mutations with the APRE are included in the binding
assay as competitors. Inclusion of unlabeled APRE WT DNA as a
competitor but not the site mutations APRE M6 or APRE M2 DNA inhibits
both the constitutive C2 complex and the TNF-
inducible C1
complex, indicating that both C1 and C2 complexes have
"NF-
Blike" DNA-binding specificity.
|
|
Gel mobility "supershift" assays were used to identify which
NF-
B subunits are contained within the C1 and C2 nucleoprotein
complexes. This assay relies on NF-
B subunitspecific
antibodies to produce a more slowly migrating supershift
antibody/NF-
B/DNA complex that allows for the unambiguous
identification of that protein in the DNA complex. In Fig 4
, the antibody supershift assay was used on control
(unstimulated) or TNF-
stimulated HepG2 cell nuclear
extracts. In control nuclear extracts, the APRE binding complexes were
not affected by the addition of preimmune antibodies or antibodies
directed against NF-
B2 (p49), c-Rel (Rel B), or Rel A (p65)
subunits. However, addition of antiNF-
B1 antibodies produced an
additional supershifted complex, indicating that NF-
B1 protein is
the predominant NF-
B protein contained within the C2 complex in
unstimulated HepG2 cells. The intensity of supershifted NF-
B1
increases with TNF-
treatment. In control nuclear extracts, addition
of antiRel A antibodies does not produce a detectable supershifted
complex, indicating that the nuclear DNA binding activity of Rel A is
low. In contrast, antiRel A antibodies produce a strong supershift in
the TNF-
stimulated nuclear extracts containing the C1 complex,
indicating that the C1 nucleoprotein complex contains Rel A. We
interpret these studies as indicating that NF-
B1 is the predominant
NF-
B subunit binding the APRE (C2 complex) in unstimulated HepG2
nuclei and that DNA-binding activity of Rel A, and to a lesser
extent of NF-
B1, is induced in HepG2 nuclei in response to TNF-
treatment.
|
Previous studies indicate that NF-
B1 and Rel A have distinct
transactivation potentials,22 42 43 44 with NF-
B1 being a
transcriptionally inert DNA-binding protein and Rel A being a potent
transcriptional activator. To demonstrate that the
activator Rel A is involved in the stimulation of the
AGT APRE, we transiently overexpressed Rel A in the HepG2
transfection assay using APRE-LUC as a reporter gene. Fig 5
demonstrates the mean±SD (of three independent
experiments) of transfections using increasing amounts of a
eukaryotic expression vector producing Rel A under the
direction of the potent CMV long-terminal repeat (pcDNARel A).
Using this potent expression vector, we can achieve levels of Rel A
high enough to saturate available I
B, allowing Rel A to function as
a constitutive activator. Overexpression of pcDNARel A
results in a dose-dependent increase in luciferase reporter
activity. Consistent with earlier reports, in separate
experiments we have tested the ability of an NF-
B1 expression vector
to activate the APRE-LUC reporter and were unable to stimulate
its activity (not shown).
|
Transient overexpression of Rel A using APRE-linked reporter genes
cannot distinguish the individual contributions of the various NF-
B
family members because both NF-
B1 and Rel A bind to the APRE (Figs 2 through 4![]()
![]()
). To isolate the study of Rel A, we constructed a
eukaryotic expression vector that encodes Rel A protein
fused in frame to a DNA-binding domain of a yeast transcription factor
(GAL4) that is not expressed in mammalian cells. This chimeric protein,
GAL4-Rel A, will uniquely bind to GAL4 binding sites (called UAS) and
allows for the isolated study of the transcriptional properties of Rel
A in response to TNF-
. The strategy of fusing GAL4 DNA-binding
domains to other transactivators is a standard
technique that has been applied to study members of other transcription
factors individually.41 45 46 The concept is schematically
diagrammed in Fig 6A
. Fig 6B
demonstrates the results of a transient transfection assay in which the
GAL4Rel A expression vector is cotransfected with UAS-LUC reporter
genes into HepG2 cells. In the presence of the full-length Rel A
protein (1-551), a dose-dependent increase in UAS-LUC reporter
activity is measured. To identify the domain of Rel A that is
responsive to TNF-
, we deleted the sequences coding the N-terminal
255 amino acids of the Rel homology domain and fused this coding
sequence to the GAL-4 DNA binding domain GAL4-Rel A (255-551). This
protein contains the activation surfaces of the Rel A transcription
factor but lacks the DNA-binding and I
B-interactive domains. In
parallel transient transfection experiments, the GAL4Rel A (255-551)
was a potent activator of UAS-LUC reporter activity but was
no longer TNF-
inducible. Taken together, these data
demonstrate not only that Rel A (1-551) is a TNF-
inducible
activator but also that the N-terminal DNA-binding and
I
B interaction domain is absolutely required for the effect.
|
| Discussion |
|---|
|
|
|---|
or IL-1 induction of
AGT gene expression. Moreover, this enhancer is a
high-affinity DNA-binding site for BPi. In previous studies, this
association was argued on the basis of multiple lines of evidence: (1)
The BPi produced a methylation interference pattern on the APRE
identical to that produced by purified NF-
B from bovine spleen; (2)
both BPi and NF-
B recognized canonical NF-
B binding sites; (3)
BPi and NF-
B were both activated in hepatocytes
by phorbol esters in the absence of new protein synthesis; and (4) BPi
and NF-
B could be identified in a sequestered form in
hepatocyte cytoplasmic extracts.
The demonstration that the multiprotein NF-
B complex has distinct
transcription properties based on its subunit
association35 36 37 38 demands that these subunits be identified
for a complete understanding of AGT gene expression in
hepatocytes.
In this article, we report the identification of the constitutive and
TNF-
inducible NF-
B subunits that bind to the APRE. NF-
B
subunitspecific antibodies used in the supershift assay
demonstrate that NF-
B1 binds the APRE in both resting and
TNF-
stimulated nuclei. Its abundance is only slightly changed
by TNF-
treatment. In contrast, Rel A binding activity is not
detectable in unstimulated nuclear extracts and is strongly induced by
TNF-
. Rel A is a potent activator of APRE transcription,
as shown by transient overexpression assays using the APRE-linked
luciferase reporter gene. That Rel A is TNF-
inducible is
argued not only by the gel mobility supershift assays but also by
transcriptional analysis of GAL4:Rel A chimeras in response to
TNF-
. Moreover, we demonstrate that the N-terminus of Rel A (amino
acids 1-254) is absolutely required for TNF-
induction, because its
deletion abolishes TNF-
inducibility and results in a potent
constitutive activator of GAL4 binding sites.
The NF-
B family is regulated through multiple protein interactions
that modify their transcriptional and DNA-binding activities. NF-
B1
is an inert DNA-binding protein representing an N-terminal
proteolytic product of a 105-kD precursor as a consequence of
processing from the ubiquitin-proteasome pathway.47 48
NF-
B1 can exist in a cytoplasmic location in certain cell types,
apparently depending on the relative expression of cytoplasmic Rel A,
with which NF-
B1 dimerizes efficiently, and the oncoprotein BCl-3, a
nuclear protein that alters the activity and subnuclear distribution of
NF-
B1.49 50 In HepG2 cells, our supershift assays
clearly demonstrate that NF-
B1 DNA binding is present in the
nuclei of unstimulated cells. On the basis of comparison of the APRE
sequence with optimally defined NF-
B binding sites produced by
PCR-based binding site selection strategy of random
oligonucleotides, the APRE represents a
predicted high-affinity NF-
B1 binding site. Consistent
with earlier reports of NF-
B1 as a transcriptionally silent
DNA-binding protein,31 42 47 we are unable to
transactivate the APRE by overexpressing NF-
B1 alone.
Thus, NF-
B1 binding is transcriptionally silent on the
AGT promoter.
Our data indicate that the C2 complex is probably composed of
homodimeric NF-
B1, whereas the C1 complex is probably composed of
NF-
B1:Rel A heterodimers. This statement is based on the following
points. (1) Both C1 and C2 bind DNA with NF-
B specificity. (2)
NF-
B1 is the only supershifted NF-
B subunit in unstimulated
nuclei in which the C2 complex strongly binds the APRE. (3) The
abundance of supershifted NF-
B1 increases after TNF-
treatment,
whereas the amount of complex C2 does not change (Fig 3
), indicating that NF-
B1 is probably contained
within the C1 complex. (4) Recombinant Rel A (as a homodimer) does not
bind with high affinity to the APRE (data not shown) and probably
requires NF-
B1 to target it to the APRE. We note that APRE
transcription occurs parallel with the appearance of the C1
nucleoprotein complex. Taken together, the weight of the evidence
argues that Rel A is the relevant APRE transactivator
in response to TNF-
treatment.
The potent transcriptional activator Rel A is encoded by a
separate gene but is related to NF-
B1 by amino acid homology in the
first
250 amino acids (called the Rel homology domain), a region
first described in the C-Rel proto-oncogene and the drosophila
morphogen dorsal.31 47 In resting cells, Rel A is
sequestered in the cytoplasm through reversible interactions with I
B
proteins32 ; one I
B protein identified in rat liver is
the homologue of human MAD3 (I
B-
).51 I
B contacts
dimeric Rel A through a conserved domain with erythrocyte ankyrin,
inactivates its DNA-binding activity, and masks its nuclear
localization signal.52 More detailed study will be
required to identify how the N-terminal Rel homology domain confers
TNF-
induction. This domain is involved in DNA binding, interaction
with I
B, nuclear localization, and dimerization and also contains
protein kinase A and protein kinase C phosphoacceptor
sites.53 54 55 In the GAL4:Rel A chimera, the GAL4
DNA-binding domain supplies DNA binding, nuclear localization, and
dimerization activity for the fusion protein. Thus, we believe that the
most likely mechanism for loss of TNF-
induction is that amino acids
1-254 are necessary for I
B interaction. The deletion of the Rel
homology domain prevents sequestration of Rel A in the cytoplasm,
allowing Rel A to enter the nucleus independent of the TNF-
hormone
and stimulate reporter gene activity. Consistent with this
view, we note that the activity of GAL4:Rel A (1-551) is less than
GAL4:RelA (255-551) in control (nonTNF-
stimulated) HepG2
hepatocytes. Immunofluorescence assays
of transfected HepG2 cells using an antibody specific for the chimeric
protein will be important to demonstrate this mechanism.
Recruitment of Rel A, the NF-
B subunit with potent transactivation
properties, into the APRE:NF-
B1 complex is vital to the
process of transactivation. In COS cells and T lymphocytes, Rel A
contains a potent C-terminal transactivating region necessary for
promoter activation.44 54 The observation that GAL4:Rel A
(255-551) is a constitutive activator of GAL4 binding sites
indicates that the location of the Rel A transactivating domain is also
within the C-terminus in HepG2 cells. The C-terminal transactivating
region of Rel A is composed of an acidic amino acid residuerich
region contained in a putative amphipathic
-helix.44 This Rel A acidic activator
domain may be necessary to recruit coactivator binding
onto the AGT promoter. We also note that Rel A:NF-
B1
bends DNA upon binding,56 which perhaps could result in
either promoter looping or alterations in AGT chromatin
structure. The distinction among these various mechanisms will require
additional study.
How is Rel A regulated by TNF-
? Although the mechanism will need to
be validated for hepatocytes, we believe that our data are
consistent with the general "working model" of TNF-
action based on studies in T lymphocytes and other cell lines. These
studies have shown that TNF-
activates Rel A by disrupting
the Rel A:I
B complex; this allows the potent Rel A
transactivator to enter the nucleus and stimulate
transcription. Activation of the TNF receptor results in activation of
phosphatidyl-cholinespecific phospholipase C and
production of 1,2-diacylglycerol. 1,2-Diacylglycerol in turn
activates an acidic sphingomyelinase that is thought to be the
primary regulator of the Rel A:I
B complex through a
ceramide-activated kinase or phosphatase
activity.57 58 59 The I
B molecule is then directly
phosphorylated and proteolyzed.60 61 62 Thus,
TNF-
activates Rel A through a posttranslational
modification of its inhibitory subunit, resulting in the
nuclear appearance of Rel A (schematically diagrammed in Fig 7
). Indeed, we have previously shown that induction of
NF-
B DNA-binding activity is independent of new protein
synthesis.1 40
|
Our studies have focused on mechanisms of AGT gene
activation by inflammation, particularly as a consequence of the
hepatic acute-phase response. Why is AGT an acute-phase
reactant? Overwhelming bacterial infection is a known hypotensive
insult; for example, bacterial endotoxin
(lipopolysaccharide) administration in humans produces
circulatory collapse.63 In this setting, AGT synthesis
would be a homeostatic mechanism as a source for Ang II
production in the setting of increased AGT
metabolism. AGT may have functions other than serving as an
intravascular reservoir for the Ang II peptides. We note that
AGT is expressed at extremely high concentrations in fat
depots3 64 65 and that TNF-
is a potent regulator of
fat metabolism.25 In particular, local
production of TNF-
may have important roles in regulating
lipolysis, insulin sensitivity, and AGT expression in the
"local" RAS in fat depots.66 67
Is TNF-
activation of NF-
B a relevant mechanism for other
physiological mediators of AGT
expression? One obvious example is the physiology of CHF. CHF is a
condition in which hypoperfusion results in the
pathophysiological activation of the RAS and
the resultant peripheral vasoconstriction and diminished
glomerular filtration rate by the vasoactive effects of Ang
II. In several studies, circulating TNF-
levels are increased in
patients with CHF, and the magnitude of increase is predictive of
short-term mortality.68 69 We speculate that in CHF,
TNF-
activation of AGT expression may be, in fact,
sustaining Ang II production. Finally, NF-
B (Rel A) is
activated by multiple second messengers, including
activators of protein kinase C, free radicals, IL-1, and UV
light.47 Our demonstration that Rel A is an AGT
activator may implicate these other agents as modifiers of
circulating or local RAS function. These latter questions are now
directly approachable experimentally.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
Received May 16, 1995; first decision July 11, 1995; accepted August 14, 1995.
| References |
|---|
|
|
|---|
B by I
B.
Genes Dev. 1989;3:1689-1698.
B/Rel DNA-binding motifs: interaction of both subunits of
NF-
B with DNA is required for transcriptional activation.
Mol Cell Biol. 1992;12:4412-4421.
B and c-Rel binds to a DNA element involved in the phorbol ester
induction of the human urokinase gene. EMBO J. 1992;11:205-213. [Medline]
[Order article via Infotrieve]
B.
Mol Cell Biol. 1992;12:674-684.
B. EMBO J. 1991;12:3805-3817.
B1 precursor protein and the activation of
NF-
B. Cell. 1994;78:773-785. [Medline]
[Order article via Infotrieve]
B proteins. Mol Cell Biol. 1994;14:3915-3926.
B that inhibits NF-
B, RelB-p50, and C-Rel-p50)
and PHF, a novel
B site-binding complex. Mol Cell
Biol. 1992;12:2898-2908.
B activity to NF-
B p105 and
I
B/MAD-3. EMBO J. 1993;12:2781-2788. [Medline]
[Order article via Infotrieve]
B
in vivo is regulated by multiple
phosphorylations. EMBO J. 1994;13:4597-4607. [Medline]
[Order article via Infotrieve]
B by
TNF. J Biol Chem. 1990;265:8339-8343.