(Hypertension. 1996;27:1018-1024.)
© 1996 American Heart Association, Inc.
Articles |
Evidence for Cell-Specific Regulation of Transcription of the Rat 
2A-Adrenergic Receptor Gene
From the Hypertension and Atherosclerosis Section, Department of Medicine, Boston University School of Medicine (Mass).
Correspondence to Diane E. Handy, W520, Boston University School of Medicine, 80 E Concord St, Boston, MA 02118.
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract We investigated the transcriptional activity of the -131 to -92 region of the rat
2A-adrenergic
receptor gene. In HT29 cells, this region has a positive effect on
transcription, whereas in RINm5F cells, this region has a negative
effect on transcription. The -131 to -92 region has a GC
box (GGGGCGG) surrounded by overlapping GGAGG repeats. To
analyze nuclear factor binding to this region, we made a series
of sequence substitutions in the GGAGG repeats, the GC box, or both
regions. Gel mobility shift assays indicated that most of the nuclear
factor complexes formed between the wild-type -131/-92
sequence and either HT29 or RINm5F extracts were specific for Sp1 or
related proteins that recognize a GC box. Mutation of either the GGAGG
repeats or the GC box did not eliminate the binding of Sp1 or related
nuclear factors, suggesting that both the GGAGG repeats and the GC box
could bind Sp1-related factors. Mutation of both these sites eliminated
the binding of Sp1-related factors. In the absence of Sp1 binding
sites, this region had a negative effect on transcription in HT29 and a
positive effect on transcription in RINm5F cells. These data support
the notion that Sp1 and/or a related factor may control both positive
and negative gene expression and suggest that the -131/-92
region may be involved in regulating tissue-specific levels of
2A-adrenergic receptor gene expression.
Key Words: receptors, adrenergic, alpha • transcription, genetic • molecular biology
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
It has been determined that
2A-adrenergic receptors (2-AR) are
involved in the central and peripheral regulation of
cardiovascular functions. Centrally,
2-AR control the outflow of
catecholamines,1 whereas in the periphery
these receptors contribute to vasoconstriction2 and
regulate Na+ in the kidney by stimulating the
Na+/H+ antiporter and
Na+-K+-ATPases.3 4 The
2-AR are actually a group of three receptor subtypes,
designated 2A, 2B, and
2C, that differ in their primary sequence, have
different patterns of tissue-specific expression, and may use
different patterns of signal transduction.5 6 7 8 9 Several
studies have implicated 2-AR in the development and
maintenance of hypertension, suggesting that alterations in the
function or expression of 2-AR may contribute to
hypertension (for review, see Reference 10).
We studied the transcriptional regulation of the 2-AR
since one of the principal controls of expression is through gene
transcription. The transcription of eukaryotic genes is
controlled by interactions of regulatory gene sequences with specific
DNA binding proteins that control tissue-specific gene expression,
gene expression during differentiation and development, and gene
expression in response to intracellular and extracellular signals, such
as metabolites and hormones.11 12 13 14 15 16
Previously, we characterized the promoter elements of the human and rat
2A-AR gene.17 18 Both genes have a TATAAA
motif and two proximal sites of nuclear factor binding, which include a
10-bp palindrome (CCCACGTGGG) and a GC box (GGGGCGG). The palindrome is
a unique site for nuclear factor binding,17 18 whereas the
GC box is the consensus binding site for the nuclear factor Sp1, a zinc
finger protein that is a positive activator of
transcription.19 20 We have shown that the palindromic
sequence of the rat 2A-AR has a positive effect on
transcription, whereas a region from -131/-92, which
includes the GC box, has a negative effect on transcription in RINm5F,
even though this region can bind to Sp1 in RINm5F nuclear
extracts.18 Several recent reports show similar repressor
function of GC box regions that can bind to Sp1.21 22 23 The
negative activity of these regions has been attributed to the presence
of overlapping nuclear factor binding sites that allow repressors, such
as egr1,21 G/C homopolymer binding
factor (GBF),22 or TGGG binding factor23 to
bind. In other systems, the presence of Sp1 inhibitors that
are released in the presence of the retinoblastoma protein has
repressed the transcriptional activity of Sp1.24 It has
also been suggested that other GC box–specific proteins may
function as repressors.25 26 We have previously shown that
egr1 does not bind the GC box region in RINm5F
cells.18 However, we have suggested that overlapping GGAGG
repeats upstream of the GC box may play a role in the negative activity
of the -131/-92 region of the rat 2A-AR
gene. In this report we analyze the role of the GGAGG repeats
and the GC box on transcription in HT29 and RINm5F cells. We show that
the -131/-92 region has the opposite effect on
transcription in HT29 cells. In addition, we show that the GGAGG
repeats form a variant GC box capable of binding Sp1 and related
nuclear factors and suggest that GC box-specific nuclear factors
control the transcriptional activity of this region.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Cell Culture
RINm5F cells, a rat insulinoma cell line that expresses the rat
2A-AR,18 27 were maintained in RPMI 1640
medium supplemented with 10% fetal calf serum (INTERGEN Co), as
described previously.28 HT29, a human colon carcinoma cell
line that expresses the human 2A-AR,29 were maintained
in McCoy's 5A medium with 10% fetal calf serum. Media were obtained
from Gibco/BRL Life Technologies.
2A-AR Gene
Constructs
To compare the transcriptional efficiency of potential
regulatory regions, gene constructs were made that placed regions of
the rat 2A-AR gene upstream of the bacterial
chloramphenicolacetyl transferase (CAT) gene in the vector pCAT
enhancer (pCATe) (Promega). These resulting constructs are named
according to the positions of their insert fragments relative to the
transcription initiation site (TI), ie, pCATe -824/+477 contains
the fragment from -824 bp upstream (-) of the TI site to
477 bp downstream of the TI site, where the TI site is +1 and
translation starts at +989. The constructs used in Fig 1
were made with
the use of restriction endonuclease sites, as described
previously.18 The rat 2A-AR sequence has
been submitted to GenBank (accession No. U21241). Additional constructs
of the -131/+36 fragment were made as follows: The -144/+36
region was amplified with the use of the forward primer
5'-GCCGGTGCGGGCTCTAGACCTAAGGAGGGGAGGCGCGAGG and reverse primer
5'-GGGCCCGGGAATTCTGCTGGGCGTCTGCACGGAAGCGG. The amplified material was
digested with Sal I and Sma I, gel-purified,
and cloned into the pCATe vector at the Sal I site and an
Xba I site that had been made blunt-ended with DNA
polymerase I large fragment (Klenow), creating a -92/+36 insert.
The -131/-92 fragments (W/W, W/M1, M1/M1, and M1/W) were
produced by first assembling 5'-GGAGG and 3' GC box double-strand
oligonucleotides consisting of either wild-type (W)
or mutant (M1) sequences. The 5'-GGAGG wild-type sequence (W)
consisted of the upper strand GGGAAGCTTCTAGACCTAAGGAGGGGAGG and lower
strand CGCGCCTCCCCTCCTTAGGTCTAGAAGCTTCCC; the 5'-GGAGG mutant
sequence (M1) consisted of the upper strand
GGGAAGCTTCTAGACCTAATTAGTT-TAGG
(mutations underlined) and lower strand
CGCGCCTAAACTAATTAGGTCTAGAAGCTTCCC; the 3' GC
box wild-type (W) sequence consisted of the upper strand
CGCGAGGGGCGGAGGAGGGTCGACCCC and lower strand GGGGTCGACCCTCCTCCGCCCCT;
and the 3' GC box mutant sequence (M1) consisted of the upper strand
CGCGATTGGCTTATTAGGGTCGACCCC and
lower strand
GGGGTCGACCCTAATAAGCCAAT. The
5'-GGAGG and overlapping 3'-GC box double-stranded
oligonucleotides were ligated together, then digested
with HindIII and Sal I and inserted into the
pCATe -92/+36 at the HindIII/Sal I to
reconstitute wild-type or mutant -131/+36. All constructs
were confirmed by restriction endonuclease and sequence
analyses.
|
indicates the GC
box; 
, palindrome;
, TATA box; and ,
transcription initiation site. B, Percent relative CAT activity of
the fragments in panel A in HT29 cells. All fragments were tested in a
minimum of three transfection experiments. CAT activities for each
experiment were standardized to those of the -824/+477 construct,
which was set to 100%. Bars on the graph are labeled as follows:
CAT Assays
The calcium phosphate method of transfection was used to
cotransfect 20 µg of each CAT construct and 5 µg of a
ß-galactosidase-containing plasmid. To reduce phosphate in
the cell culture medium before transfection, the McCoy's 5A medium was
replaced by Dulbecco's modified Eagle's medium with 4500 mg/L
glucose, and RPMI medium was replaced by a 9:1 mixture of RPMI 1640
with no phosphate and RPMI 1640, respectively. Fetal calf serum was
maintained at 10%. Forty-eight hours after transfection, cells
were harvested, lysed by freeze-thawing, and assayed for
ß-galactosidase and CAT enzyme activity.30 31 To
correct for transfection efficiencies, CAT assays were performed on
cell extracts that contained equivalent amounts of
ß-galactosidase activity.31 CAT activity was
measured as a percentage of acetylated chloramphenicol after a
4-hour incubation at 37°C and standardized to the activity of pCATe
-824/+477. Each construct was tested in a minimum of three
transfections. Values were compared by ANOVA followed by
Student-Newman-Keuls pairwise comparisons, P<.05 was
considered significant by this analysis. Alternatively, the CAT
activities of the -131/+36 constructs were determined by the
liquid scintillation method.32
Gel Mobility Shift
Nuclear extracts were prepared according to published
methods.33 The gel mobility shift assay was performed
essentially as described.34 Briefly, 1 to 5 µL of
nuclear extract was mixed with 0.05 to 0.1 ng of radiolabeled probe
(10 000 cpm) in a final reaction volume of 15 µL that contained 20
mmol/L Tris (pH 7.6), 50 mmol/L KCl, 1 mmol/L MgCl2,
0.2 mmol/L EDTA, 0.01% (vol/vol) Triton X-100, 5% (vol/vol) glycerol,
0.2 µg/µL polydeoxyinosinic-deoxycytidylic acid, plus or minus
50- to 100-fold molar excess Sp1 competitor DNA. Mixtures were
incubated on ice for 20 minutes. Supershift was done by adding 1 µL
of an SP1 antibody (1 µg/µL) to this mixture and incubating for an
additional 1 hour, as recommended by the manufacturer (Santa Cruz
Biotechnologies). DNA protein complexes were analyzed on a
3.5% nondenaturing polyacrylamide gel in 0.4x TBE, where 1x
TBE is 0.09 mol/L Tris-borate, 0.002 mol/L EDTA, pH 8.3. The probes
used were from -131 to -92, which overlapped the GC box.
The Sp1 double-stranded competitor was obtained from Stratagene
(GATCGATCGGGGCGGGGCGATC).
DNase Footprinting
DNase I footprinting was performed essentially as described
previously,17 with minor changes. Briefly, 10 000 to
15 000 cpm 32P-end-labeled DNA fragments were
incubated for 20 minutes in a 21-µL reaction volume of 25 mmol/L
HEPES (pH 7.6), 5 mmol/L MgCl2, 34 mmol/L KCl, and
0.05 µg/µL polydeoxyinosinic-deoxycytidylic acid containing 13
µL of either nuclear extract or nuclear extract buffer (20 mmol/L
HEPES [pH 7.9], 20% [vol/vol] glycerol, 0.1 mol/L KCl, and 0.2
mmol/L EDTA). DNase I was added, and samples were incubated on ice for
10 minutes. Reactions were stopped with the addition of 80 µL of 20
mmol/L Tris-HCl (pH 8.0), 20 mmol/L EDTA, 0.5% sodium dodecyl
sulfate, and 0.25 mol/L NaCl. DNA was purified by extraction with a 1:1
mixture of phenol and chloroform and ethanol precipitation. Samples
were analyzed on a 6% polyacrylamide, 6 mol/L urea
gel.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Effect of the GC Box on Transcription in HT29 Cells
To analyze the role of the promoter regions of the rat
2A-AR gene on expression in HT29 cells, a series of
2A-AR gene fragments (Fig 1A
) were tested
for their ability to promote transcription (Fig 1B). The region from
-824 to -131 had a negative effect on transcription, since
deletion of the region from -824 to -480 increased CAT
activity more than twofold over that of the -824/+477 construct,
and deletion of the region from -480 to -131 increased CAT
activity sevenfold over that of the -824/+477 construct. In
contrast, deletion of the region from -131 to -92 caused a
decrease in activity to only fourfold the activity of the
-824/+477 construct, indicating that the region from -131
to -92 has a positive effect on transcription. The activity of
the -92/+477 construct was significantly different from that of
the -824/+477 or the -131/+477 constructs.
Sp1 Nuclear Factor Binding to the -131/-92 Fragment
We have previously shown that the region from
-131/-92 contains a GC box surrounded by overlapping GGAGG
repeats.18 The GC box is the consensus binding site for
the nuclear factor Sp1, which has been shown to be a positive
activator of gene transcription.19 We have
previously shown that this region binds to Sp1 in nuclear extracts from
HT29 and RINm5F cells.18 In fact, nuclear extracts from
HT29 or RINm5F cells show similar patterns of binding to the
-131/-92 wild-type sequences (Fig 2, lanes 2 and
3).
|
To further analyze nuclear factor binding to this region, we
made a series of mutations in the 5' GGAGG motifs (M1/W) or in the 3'
GC box (W/M1) or in both regions (M1/M1) (Fig 3). Each
of these mutations altered the patterns of nuclear factor binding in
gel mobility shift assays (Fig 2, lanes 4 to 12). The W/M1 pattern of
nuclear factor binding is very similar to that of the W/W except for
slightly different intensities of C- and B-complex bands. The M1/W had
no A or B bands and fewer C-complex bands. The M1/M1 had no A bands,
less intense B-complex bands, and lacked most of the C-complex bands.
In addition, RINm5F nuclear extracts form the additional complexes I
and II with the M1/M1 probe. Complex I was also formed between the M1/W
probe and the RINm5F nuclear extracts.
|
To test whether Sp1 could bind to these altered sequences, competition
and gel supershift assays were performed with the use of an Sp1
consensus binding site competitor, which contains a GC box, and an
antibody specific for Sp1 (Fig 4). Our previous work
suggests that most of the gel shift bands are specific for proteins
that can bind to the GC box.18 Thus, addition of the Sp1
consensus binding site competitor eliminated most of the complexes
formed by the W/W probe and either HT29 (Fig 4A, lane 3) or RINm5F (Fig 4B, lane 3) extracts. Competition with the Sp1 competitor also
eliminated many of the complexes formed by the W/M1 probe and HT29 or
RINm5F extracts (Fig 4A and 4B, lane 6). In addition, the Sp1 antibody
can shift nuclear factor complexes formed between the W/M1 and either
HT29 or RINm5F extracts (Fig 4A and 4B, lane 7), indicating that Sp1
can bind to this probe even though the GC box has been altered.
|
A possible second site for Sp1 binding is the GGGGAGG sequence, which
has previously been described as a variant GC box capable of binding
Sp1.35 36 Mutation of the GGAGG repeats in the M1/W probe
eliminated some but not all of the complexes that can be competed by
the Sp1 consensus competitor (Fig 4A and 4B, lane 12). Sp1 was
present in the complexes formed by this probe and either the HT29
or RINm5F nuclear extracts as indicated by the supershift with the Sp1
antibody (Fig 4A and 4B, lane 13). In contrast, the M1/M1 probe formed
complexes that are not eliminated by the Sp1 consensus competitor,
indicating that nuclear factors in these complexes do not recognize the
GC box. In addition, the complexes formed between the M1/M1 and RINm5F
extracts cannot be competed by the wild-type sequences, although
they can be competed by the M1/M1 sequence (Fig 4C). Thus, the binding
of Sp1 or Sp1-related nuclear factors was eliminated from the
-131/-92 fragment only after both the variant (GGGGAGG) and
consensus (GGGGCGG) sites for Sp1 binding were eliminated.
DNase I footprinting assays (Fig 5) showed that both the
RINm5F and HT29 extracts protect the region surrounding the consensus
GC box and a region overlapping the variant GC box from digestion with
DNase I. The M1/M1 sequence has a different footprint pattern over the
mutated consensus and mutated variant GC box regions, suggesting that
different nuclear factors may be binding to the mutated sequences
compared with the wild-type sequences.
|
Effect of M1/M1 Mutations on CAT Activity
To test whether the lack of GC box binding affects
transcription, the transcriptional activities of the W/W, W/M1, M1/M1,
and M1/W were compared (Fig 6). To focus on the
transcriptional effects of this region, a minimal promoter that
included the palindrome and TATA box and only 36 bp of the 5'
untranslated region was used. Mutation of both the variant and
consensus GC site affected CAT activity in both HT29 and RINm5F cells.
The double mutation increased CAT activity 1.63±0.07-fold (SD) over
the wild-type construct in RINm5F cells (Fig 6A), whereas the
double mutation had only 0.64±0.11 (SD) the activity of the
wild-type construct in HT29 cells (Fig 6B). Mutating only the
variant or consensus GC box had little effect on CAT activity in HT29
cells (Fig 6B). In contrast, mutating the consensus GC box appeared to
have a slight effect on CAT activity in RINm5F (Fig 6A), since the
activity of the W/M1 construct is higher than that of the wild-type
construct. These data indicate that nuclear factors binding to the
-131/-92 region have different effects in RINm5F and HT29
cells.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
We have shown that the -131/-92 region of the rat
2A-AR gene has a positive effect on transcription in
HT29 cells, whereas in RINm5F cells the -131/-92 region has
a negative effect on transcription.18 The region from
-131/-92 contains a GC box and several GGAGG repeats. Our
data suggest that Sp1 and other related nuclear factors bind to both
the 3' GC box and the 5' GGAGG motifs since mutations in the consensus
GC box reduced the formation of nuclear factor complexes but did not
completely eliminate the formation of nuclear factor complexes that
were sensitive to competition with the Sp1 consensus competitor (Fig 4). Similarly, mutation of the GGAGG repeats eliminated some but not
all of the nuclear factor complexes sensitive to competition with the
Sp1 consensus competitor; in the absence of the GGAGG site, Sp1 binding
was demonstrated by supershift with the Sp1 antibody, thereby
confirming that Sp1 was able to bind to the intact GC box (Fig 4).
Thus, in addition to the consensus GC box within the
-131/-92 region, these data suggest that the 5' GGAGG
repeat forms a variant GC box capable of binding Sp1 and related
nuclear factors. We propose that the sequence GGGGAGG forms the variant
GC box. Sp1 binding to this site is consistent with reports
showing that Sp1 and related nuclear factors can bind to many different
sequences, including GGGGAGG.35 36 The GC box and variant GC box did not appear to bind identical nuclear factors, since the bands attributable to each site were different in the gel shift, suggesting that these sites may bind similar nuclear factors with different affinities. Recently, several factors have been cloned and characterized that bind to the GC box or similar sequence motifs, including three structurally similar zinc finger proteins, Sp2, Sp3, and Sp4.37 38
Mutations in both the consensus and variant GC boxes eliminated the
binding of nuclear factors specific for the GC box sequences since the
Sp1 consensus binding site did not eliminate complexes from the gel
shift with the double mutant (Fig 4) even when 500-fold excess
competitor was used (data not shown). This suggests that the bands
formed by the M1/M1 probe and either the HT29 or RINm5F nuclear
extracts were either nonspecific or specific for the mutant sequences.
We have found that none of these bands could be eliminated in a gel
shift with the wild-type sequences as a competitor, supporting the
latter (Fig 4C). In addition, the DNase I footprinting patterns of the
mutated sequence were altered from those of the wild-type
sequence.
The M1/M1 sequence changes had different effects on transcription in
HT29 and RINm5F cells. In HT29 cells, the elimination of GC box binding
inhibited CAT activity by approximately 35% compared with the
wild-type sequence. This is not surprising given work by others
that indicates the positive effect of Sp1 on transcription and a
correlation of Sp1 binding with conditions favoring transcription for a
broad range of genes expressed in many different cell types (for
examples, see References 21 and 22). In RINm5F cells, these mutations
had the opposite effect, increasing transcription by more than 60%.
One possible explanation for the increase in transcription in RINm5F
cells is the binding of additional, positive-acting nuclear factors
to the mutant sequences in the RINm5F cells. We are currently analyzing
the two additional complexes (complex I and II in Fig 2) formed between
the M1/M1 and RINm5F extracts to determine their role in
transcription.
Other gene systems have been described that have a negative activity
associated with a GC box region. For example, in the dopamine receptor
gene,23 the acetylcholinesterase gene,21 and
the acetylcholine receptor -subunit gene, binding sites for
other nuclear factors overlap the Sp1 binding site. It is thought that
these nuclear factors interfere with Sp1 binding and/or activation of
transcription. In the GC box region (-131/-92), almost all
the nuclear factor binding was due to GC box sequences, and elimination
of GC box binding was sufficient to alter transcriptional activity of
this region. Curiously, the binding patterns of HT29 and RINm5F nuclear
extracts to the wild-type -131/-92 region were nearly
identical even though this region has different transcriptional effects
in these cells. Perhaps the transcriptional activity of the nuclear
factors binding to the -131/-92 region may be determined by
posttranslational modifications that do not affect nuclear factor
binding as assessed by the gel mobility assay. However, although the
complexes appeared similar by gel shift, perhaps these complexes
actually contained different nuclear factors with opposite effects on
transcription. Alternatively, although multiple factors could bind to
this region, perhaps only a single positive- or negative-acting
nuclear factor is active in each cell line depending on nuclear factor
binding to other downstream regions. For example, both HT29 and RINm5F
extracts show different patterns of binding to the palindrome region as
assessed by DNase footprint assays (Fig 5) and gel mobility shift
assays.18 We are examining the possible synergistic
effects of the GC box and palindrome in controlling transcription.
Our results suggest that Sp1 and related nuclear factors may be
involved in positive and negative gene regulation of the rat
2A-AR. It has been suggested that inhibitory
proteins may reduce the transcriptional activity of Sp1 and that other
proteins, such as the retinoblastoma susceptibility gene product,
may stimulate Sp1-mediated transcription.24
Inhibitors have been described for several positive
activators of transcription, including IkB, an
inhibitor of NF-
B39 ; IP-1, an
inhibitor of FOS/JUN cyclic AMP-responsive element
modulator (CREM), cAMP-responsive element binding protein
(CREB)40 ; the protein Id, a negative regulator of
helix-loop-helix proteins41 ; and CREM, an
inhibitor of CREB.42 The presence of
inhibitors or lack of activators in RINm5F
cells may explain the negative effect of this region in gene
transcription.
On the other hand, binding of GC box proteins may directly repress transcription. A recent report shows that disruption of Sp1 nuclear factor binding to the elastin promoter correlates with increased levels of gene transcription43 in aortic smooth muscle cells, suggesting that binding of Sp1 or related nuclear factors may repress gene transcription. In addition, Sp3, a zinc finger protein that is structurally similar to Sp1 and binds to GC box sequences,37 38 is a good candidate for a GC box-specific protein that can block transcription. Sp3 has been shown to repress Sp1-mediated gene transcription in transactivation studies with promoters containing Sp1 binding sites, including the uteroglobin promoter and the HIV promoter in mammalian and a Drosophila cell line.25 26 Both Sp1 and Sp3 have been found to be ubiquitously expressed, with similar affinities for GC box and variant GC box sequences.38 The ability of either Sp1 or Sp3 to cause a positive or negative effect on transcription in a system where both are present is not understood. In the transactivation studies, it was suggested that excess Sp3 acted as a competitive inhibitor of Sp1 through binding to the GC box.37
In conclusion, we show that the region from -131 to -92 has
two sites for binding of Sp1 and related nuclear factors. We suggest
that the ability of this region to have opposing effects on
transcription in different cell lines may be related to the presence of
activators or inhibitors of Sp1 in different
cell lines. We believe the ability of this region to have a positive or
negative effect on gene transcription may provide a means to control
the relative levels of 2A-AR in different cell
types.
|
Acknowledgments |
|---|
This study was supported by the National Heart, Lung, and Blood Institute grant HL-48181 (Dr Handy). We thank Christine Hatch for her excellent technical assistance.
Received May 31, 1995; first decision July 25, 1995; accepted November 9, 1995.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Wyss JM, Oparil S, Chen Y-F. The role of the central nervous system in hypertension. In: Laragh JH, Brenner BM, eds. Hypertension: Pathophysiology, Diagnosis, and Management. New York, NY: Raven Press Publishers; 1990:679-701.
2.
Goldberg MR, Robertson D. Evidence for the
existence of vascular alpha2-adrenergic receptors in
human. Hypertension.. 1984;6:551-556.
3. Nord EP, Howard MJ, Hafezi A, Moradeshagi P, Vaystub S, Insel PA. Alpha2-adrenergic agonists stimulate Na+-H+ antiport activity in the rabbit renal proximal tubule. J Clin Invest.. 1987;80:1755-1762.
4.
Gesek FA. Stimulation of
2-adrenergic receptors increases
Na+-K+-ATPase activity in distal convoluted
tubule cells. Am J Physiol.. 1993;265:F561-F568.
5.
Bylund DB. Subtypes of 1- and
2-adrenergic receptors. FASEB J.. 1992;6:832-839. [Abstract]
6.
Lorenz W, Lomasney JW, Collins S, Regan JW, Caron MG,
Lefkowitz RJ. Expression of three 2-adrenergic
receptor subtypes in rat tissues: implications for receptor
classification. Mol Pharmacol.. 1990;38:599-603. [Abstract]
7.
Handy DE, Flordellis CS, Bogdanova NN, Bresnahan MR,
Gavras H. Diverse tissue expression of
2-adrenergic receptor genes.
Hypertension.. 1993;21:861-865.
8.
Coupry I, Duzic E, Lanier SM. Factors
determining the specificity of signal transduction by guanine
nucleotide-binding protein-coupled receptors, II:
preferential coupling of the 2C-adrenergic receptor to
the guanine nucleotide binding protein,
Go. J Biol Chem.. 1992;267:9852-9857.
9.
Flordellis CS, Berguerand M, Gouache P, Barbu V,
Gavras H, Handy DE, Béréziat G, Masliah J.
2-Adrenergic receptor subtypes expressed in Chinese
hamster ovary cells activate differentially
mitogen-activated protein kinase by a p21ras
independent pathway. J Biol Chem.. 1995;270:3491-3494.
10. Gavras H, Handy D, Gavras I. Alpha-adrenergic receptors in hypertension. In: Laragh JH, Brenner BM, eds. Hypertension: Pathophysiology, Diagnosis, and Management. New York, NY: Raven Press Publishers; 1995:853-861.
11.
Mitchell PJ, Tjian R. Transcriptional regulation
in mammalian cells by sequence-specific DNA binding
proteins. Science.. 1989;245:371-378.
12. Tjian R, Maniatis T. Transcriptional activation: a complex puzzle with few easy pieces. Cell.. 1994;77:5-8. [Medline] [Order article via Infotrieve]
13.
Georgopoulous K, Van den Elsen P, Bier E, Maxam A,
Terhorst C. A T-cell-specific enhancer is located in a DNase
I hypersensitive area at the 3' end of the CD3-
gene.
EMBO J.. 1988;7:2401-2407. [Medline]
[Order article via Infotrieve]
14. Gillies SD, Morrison SL, Oi VT, Tonegawa S. A tissue-specific transcription enhancer element is located in the major intron of a rearranged immunoglobulin heavy chain gene. Cell.. 1983;33:717-728. [Medline] [Order article via Infotrieve]
15.
Alexander MC, Lomanto M, Nasrin N, Ramaika C.
Insulin stimulates glyceraldehyde-3-phosphate
dehydrogenase gene expression through cis-acting DNA
sequences. Proc Natl Acad Sci U S A.. 1988;85:5092-5096.
16.
Roesler WJ, Vandenbark GR, Hanson RW. Cyclic AMP
and the induction of eukaryotic gene transcription.
J Biol Chem.. 1988;263:9063-9066.
17.
Handy DE, Gavras H. Promoter region of the human
2A-adrenergic receptor gene. J
Biol Chem.. 1992;267:24017-24022.
18.
Handy DE, Zanella MT, Kanemaru A, Tavares A, Flordellis
C, Gavras H. A negative regulatory element in the promoter
region of the rat 2A-adrenergic receptor gene overlaps
an Sp1 consensus binding site. Biochemical J.. 1995;311:541-547.
19. Dynan WS, Tjian R. Isolation of transcription factors that discriminate between different promoters recognized by RNA polymerase II. Cell.. 1983;32:669-680. [Medline] [Order article via Infotrieve]
20. Kadonaga JT, Carner KR, Masiarz FR, Tjian R. Isolation of cDNA encoding transcription factor Sp1 and analysis of DNA binding domain. Cell.. 1987;51:1079-1090. [Medline] [Order article via Infotrieve]
21.
Mutero A, Camp S, Taylor P. Promoter elements of
the mouse acetylcholinesterase gene: transcriptional regulation during
muscle differentiation. J Biol Chem.. 1995;270:1866-1872.
22.
Bessereau J-L, Mendelzon D, LePoupon C, Fiszna M,
Changeux J-P, Piette J. Muscle-specific expression of the
acetylcholine receptor -subunit gene requires both positive and
negative interactions between myogenic factors, SP1 and GBF
factors. EMBO J.. 1993;2:443-449.
23.
Minowa T, Minowa MT, Mouradian MM. Negative
modulator of the rat D2 dopamine receptor gene.
J Biol Chem.. 1994;269:11656-11662.
24.
Chen LI, Nishinaka T, Kwan K, Kitabayashi I, Yokoyama
K, Fu Y-HF, Grünwald S, Chiu R. The retinoblastoma gene
product RB stimulates Sp1-mediated transcription by liberating Sp1
from a negative regulator. Mol Cell Biol.. 1994;14:4380-4389.
25. Hagen G, Müller S, Beato M, Suske G. Sp1-mediated transcriptional activation is repressed by Sp3. EMBO J.. 1994;13:3843-3851. [Medline] [Order article via Infotrieve]
26.
Majello B, DeLuca P, Hagen G, Suske G, Lania L.
Different members of the Sp1 multigene family exert opposite
transcriptional regulation of the long terminal repeat of
HIV-1. Nucleic Acids Res.. 1994;22:4914-4921.
27.
Ulrich S, Wolheim CB. Characterization of
2-adrenoceptors in a plasma membrane enriched fraction
from the insulin secreting cell line RINm5F. Acta
Endocrinol.. 1989;121:525-532.
28. Praz GA, Halban PA, Wollheim CB, Blondel B, Strauss AJ, Renold AE. Regulation of immunoreactive-insulin release from a rat cell line (RINm5F). Biochem J.. 1983;210:345-352. [Medline] [Order article via Infotrieve]
29. Turner JT, Ray-Prenger C, Bylund DB. Alpha-2 adrenergic receptors in the human cell line, HT29: characterization with the full agonist radioligand [3H] UK-14,304 and inhibition of adenylate cyclase. Mol Pharmacol.. 1985;28:422-430. [Abstract]
30.
Gorman CM, Moffat LF, Howard BH. Recombinant
genomes which express chloramphenicol acetyltransferase in mammalian
cells. Mol Cell Biol.. 1982;2:1044-1051.
31. Herbomel P, Bourachot B, Yaniv M. Two distinct enhancers with different cell specificities coexist in the regulatory region of polyoma. Cell.. 1984;39:553-662.
32. Seed B, Sheen J-Y. A simple phase-extraction assay for chloramphenicol acyltransferase activity. Gene.. 1988;67:271-277. [Medline] [Order article via Infotrieve]
33. Lee KAW, Bindreif A, Green MR. A small-scale procedure for preparation of nuclear extracts that support efficient transcription and pre-mRNA splicing. Genet Anal Tech.. 1988;5:22-31.
34.
Shirayoshi Y, Miyazaka J-I, Burke PA, Hamada K, Apella
E, Ozato K. Binding of multiple nuclear factors to the 5'
upstream regulatory element of the murine major histocompatibility
class I gene. Mol Cell Biol.. 1987;7:4542-4548.
35.
Letovsky J, Dynan WS. Measurement of the binding
of transcription factor Sp1 to a single GC box recognition
sequence. Nucleic Acids Res.. 1989;17:2639-2653.
36.
Thiesen HJ, Bach C. Target detection assay
(TDA): a versatile procedure to determine DNA binding sites as
demonstrated on Sp1 protein. Nucleic Acids Res.. 1990;18:3203-3209.
37. Kingsley C, Winoto A. Cloning of GT box-binding proteins: a novel Sp1 multigene family regulating T-cell receptor gene expression. Mol Cell Biol.. 1992;20:5519-5525.
38.
Hagen G, Müller S, Beato M, Suske G.
Cloning by recognition site screening of two novel GT-box binding
proteins: a family of Sp1 related genes. Nucleic Acids
Res.. 1992;20:5519-5525.
39.
Baeuerle PA, Baltimore D. I kappa B: a specific
inhibitor of the NF-kappa B transcription factor.
Science.. 1988;242:540-546.
40. Auwerx J, Sassone-Corsi P. IP-1: a dominant inhibitor of Fos/Jun whose activity is modulated by phosphorylation. Cell.. 1991;64:983-993. [Medline] [Order article via Infotrieve]
41. Benezra R, Davis RL, Lockshon D, Turner DL, Weintraub H. The protein Id: a negative regulator of helix-loop-helix DNA binding proteins. Cell.. 1990;61:49-59. [Medline] [Order article via Infotrieve]
42. Foulkes NS, Borrelli E, Sassone-Corsi P. CREM gene: use of alternative DNA binding domains generates multiple antagonists of cAMP-induced transcription. Cell.. 1991;64:739-749. [Medline] [Order article via Infotrieve]
43.
Jensen DE, Rich CB, Terpstra AJ, Farmer SR, Foster
JA. Transcriptional regulation of the elastin gene by
insulin-like growth factor-I involves disruption of Sp1 binding:
evidence for the role of Rb in mediating Sp1 binding in aortic smooth
muscle cells. J Biol Chem.. 1995;270:6555-6563.
This article has been cited by other articles:
 |
|
 |
|
  F. Xiao, A. Mirwald, M. Papaioannou, A. Baniahmad, and J. Klug Secretoglobin 2A1 Is under Selective Androgen Control Mediated by a Peculiar Binding Site for Sp Family Transcription Factors Mol. Endocrinol., December 1, 2005; 19(12): 2964 - 2978. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Ren and G. L. Stiles A Single-Stranded DNA Binding Site in the Human A1 Adenosine Receptor Gene Promoter Mol. Pharmacol., January 1, 1998; 53(1): 43 - 51. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||