(Hypertension. 1996;27:1134-1139.)
© 1996 American Heart Association, Inc.
Articles |
From the Section on Epidemiology and Genetics, Research Division, Joslin Diabetes Center, and the Department of Medicine, Harvard Medical School, Boston, Mass.
Correspondence to Andrzej S. Krolewski, MD, PhD, Section on Epidemiology and Genetics, Joslin Diabetes Center, One Joslin Place, Boston, MA 02215.
| Abstract |
|---|
|
|
|---|
2=1.2,
P=NS with 2 df). Under a recessive model,
allele 235T homozygotes had a 1.6-fold risk of developing
nephropathy relative to carriers of other
genotypes, but this value was not significantly different from
1 (95% CI=0.8 to 3.5). The strength of the association did not improve
after stratification by degree of glycemic control. With respect to the
hypertension in these IDDM patients, no association with allele
235T was found. Allele 235T frequencies in normotensive and
hypertensive individuals were 0.363 and 0.353, respectively,
among normoalbuminuric IDDM individuals
(
2=0.01, P=NS) and 0.411 and 0.414
among microalbuminuric IDDM subjects
(
2=0.0, P=NS). We conclude that the
angiotensinogen polymorphism M235T might influence
susceptibility to nephropathy in insulin-dependent
diabetes, but its effect, if any, is rather small and independent of
hypertension.
Key Words: genetics insulin-dependent diabetes nephropathy angiotensinogen
| Introduction |
|---|
|
|
|---|
We and others have recently reported that DNA polymorphisms in the angiotensin-converting enzyme gene, a locus involved in blood pressure regulation, are associated with increased susceptibility to nephropathy in IDDM.16 17 This effect, however, appears to be independent of a predisposition to hypertension, consistent with other evidence that the angiotensin-converting enzyme gene is not linked to essential hypertension.18 Moreover, the association with nephropathy has not been confirmed in other populations.19 20 Thus, other genetic factors, presumably related to essential hypertension, are likely to play a role as determinants of susceptibility to nephropathy.
One of the several genes that have been implicated in essential hypertension is AGT,21 22 which is involved in blood pressure regulation by coding for the precursor of angiotensin II, the effector peptide of the renin-angiotensin system having vasoconstrictor and sodium-retaining effects.23 Evidence of linkage between the AGT locus (1q4) and essential hypertension has been consistently found in white and African Caribbean populations.21 22 24 Among whites, a polymorphism in exon 2, consisting of two alleles coding for a methionine or a threonine at position 235, has been proposed as the polymorphic site responsible for these findings.21 In the same population in which linkage was originally reported, the threonine allele (235T) was significantly more frequent among hypertensive cases than normotensive control subjects and was associated with high serum levels of AGT.21 In the present study, we have investigated whether the AGT polymorphism M235T also contributes to the genetic susceptibility to nephropathy in IDDM.
| Methods |
|---|
|
|
|---|
To enlarge the number of cases with microalbuminuria and overt proteinuria, we selected patients with a confirmed diagnosis of persistent microalbuminuria or overt proteinuria from a study of the natural history of microalbuminuria in IDDM patients that is being conducted at the Joslin Clinic.3 The selection and evaluation of patients for this study have been described in detail previously.3 In brief, all patients enrolled in this study (n=1613) are white residents of Massachusetts and had the onset of IDDM before age 41 years. They came to the Joslin Clinic soon after the diagnosis of IDDM (on average, 3 years) and have remained under the care of the clinic ever since. Renal status was evaluated by multiple random urine samples collected at the time of clinic visits during 1991-1993. These were screened for overt albuminuria with reagent strips read by an optical scanner (Multistix, Ames Division, Miles Laboratory). In samples that were not strongly positive for overt albuminuria (<2+ on Multistix), urinary albumin concentration was measured by immunonephelometry with N Albumin kits (Behring). Urinary creatinine concentrations were measured by colorimetry (modified Jaffé reaction) on an Astra-7 automated system (Beckman Instruments). Normoalbuminuria was defined as an ACR less than 1.9 mg/mmol (17 µg/mg) for men and less than 2.8 mg/mmol (25 µg/mg) for women. Overt proteinuria was defined as an ACR greater than or equal to 28.2 mg/mmol (250 µg/mg) for men or greater than or equal to 40.2 mg/mmol (355 µg/mg) for women or a reagent strip reading 2+ or higher. When converted to albumin excretion rates, these lower and upper cut points for the ACR correspond to 30 and 300 µg/min, respectively{25}. Microalbuminuria was defined as an ACR in the range between normoalbuminuria and overt proteinuria. Classification of a patient's renal status was based on a consensus of two of three determinations.3 Of the 1613 patients screened, 295 had microalbuminuria and 201 had overt proteinuria.3 From among those with well-documented renal disease, 136 microalbuminuric (microalbuminuria group 2) and 98 proteinuric (overt proteinuria group 2) individuals were selected for the present study. Patients were considered hypertensive if they were on antihypertensive drugs or the average of two supine measurements of systolic or diastolic blood pressure was greater than or equal to 140 or 90 mm Hg, respectively. An index of long-term glycemic control was based on the geometric mean of hemoglobin A1 measurements taken during 1990 and 1991 as previously described.3
Nondiabetic Control Subjects
Eighty-three unrelated white subjects with normal fasting
glycemia and no clinical manifestation of diabetes, mostly Joslin
Clinic employees, served as a representative sample of
the general population of Massachusetts. This group was used for
assessment of whether an association exists between IDDM and allele
235T.
DNA Analysis
For each individual, the genotype of the
polymorphism M235T of the AGT gene was determined by PCR
amplification of genomic DNA followed by denaturing gradient gel
electrophoresis (DGGE). DNA was extracted from whole blood by the
phenol chloroform technique according to standard
protocols.26 The 3' portion (354 bp) of exon 2 was
amplified by PCR with the primers described by Jeunemaitre at
al21 (primer 1: GATGCGCACAAGGTCCTGTC, primer 2:
GCGCGCGCCAGCAGAGAGGTTTGCCT). Primer 2 was slightly modified
by the addition of a 6-bp "GC-clamp" at the 5' end (in boldface)
to facilitate the DGGE analysis. PCR was carried out from 1
µg of DNA in 50 µL containing 10 mmol/L Tris-HCl, pH 8.3, 50 mmol/L
KCl, 1.5 mmol/L MgCl2, 0.001% gelatin, 0.2 mmol/L
each dNTP, 1 µmol/L primers 1 and 2, and 25 U/mL Taq
polymerase (Amplitaq, Perkin-Elmer) for 30 cycles (60 seconds at
95°C, 60 seconds at 55°C, 60 seconds at 72°C) in a Perkin-Elmer
Thermal Cycler 480. DGGE was performed according to a previously
described protocol27 in a 10% polyacrylamide gel
with a linear gradient of denaturants from 35% to 70% (100%=7 mol/L
urea in 40% formamide) in 1x Tris-acetate
EDTA buffer at a
constant temperature of 60°C at 10 V/cm for 4 hours. In agreement
with the melting characteristics of the two alleles (Fig 1A
), the allele coding for a threonine (235T, codon
ACG) stops in the gel at a higher concentration of
denaturant (48.5%) than the allele coding for a methionine (235M,
codon ATG) (48%) (Fig 1B
). Homozygotes are then detected as
a single band (two identical homoduplexes) at 48.5% or 48% of
denaturant concentration, whereas heterozygotes are identified as four
bands (Fig 1B
) because of the presence of two heteroduplexes that form
during the annealing step of PCR, in addition to the two homoduplexes,
and melt at lower denaturant concentrations. Occasionally, the band
corresponding to allele 235T migrates slightly lower than usual
because of the simultaneous presence of the rare variant
Y248C, which is also located in the 3' part of exon 2.21
Genotype distributions determined with this method did not
depart significantly from Hardy-Weinberg equilibrium in any of the
study groups (
2 values ranging between 0.01 and
2.9, P=NS with 1 df).
|
Data Analysis
Allele frequencies were computed from genotype
frequencies. The distributions of genotypes and alleles
were compared between study groups by
2
tests.30 As a descriptive measure of association between
genotypes and outcomes, OR values are given along with 95%
CI.30
| Results |
|---|
|
|
|---|
|
AGT 235 Alleles and Diabetic
Nephropathy
The frequency of AGT allele 235T in the
normoalbuminuria group (0.36) was comparable to that
among nondiabetic control subjects (0.373) (Table 2
).
These values were consistent with the frequency reported for
normotensive individuals (0.36) in the original article describing the
polymorphism.14 The two series of
microalbuminuria cases did not differ significantly
with respect to allele 235T frequency
(
2=0.005, P=NS with 1
df). Hence, for further analysis, all
individuals with microalbuminuria were considered as
one group. Similarly, the difference between the two series of casess
with overt proteinuria was not significant
(
2=0.9, P=NS with 1
df), so they were combined in one group. Allele
235T, which has been found to be associated with essential hypertension
in the general population,21 was slightly more frequent
among the chromosomes of cases with microalbuminuria
(0.412) and overt proteinuria (0.396) than among those with
normoalbuminuria (0.36) (Table 2
). However, this
difference was not statistically significant with this sample size
(
2=1.2, P=NS with 2
df). The strength of the association was not affected
by the degree of long-term glycemic control, which was similar
among individuals with an index of hyperglycemia or glycosylated
hemoglobin above and below the median (data not shown). The results
also were not statistically significant after
microalbuminuric and proteinuric individuals were grouped
together as nephropathy cases (235T frequency=0.405
compared with 0.360 in the normoalbuminuria group,
2=1.02, P=NS).
|
The slight excess of 235T allele among nephropathy
cases was related to an increased proportion of 235T/235T homozygotes
in the microalbuminuria and overt proteinuria groups
compared with normoalbuminuric individuals (Table 3
). The risk of nephropathy
(microalbuminuria and proteinuria combined) for
allele 235T homozygotes was 1.6 times that of other
genotypes, but this value was not significantly different from
1 with this sample size (95% CI=0.8 to 3.5).
|
AGT 235 Alleles and Hypertension in
IDDM
The frequencies of allele 235T among the chromosomes of
normotensive and hypertensive IDDM individuals were separately compared
within the normoalbuminuria group and the two combined
series of microalbuminuria cases (Table 4
). Patients with overt proteinuria, who were mostly
hypertensive, were not considered in this analysis. No
association between AGT allele 235T and hypertension
could be observed in this sample of IDDM individuals (Table 4
).
Homozygotes for allele 235T had a risk of hypertension similar to
that of other genotypes (OR=1.0 [95% CI=0.2 to 5.1] in the
normoalbuminuria group and OR=0.7 [95% CI=0.3 to
1.6] in the microalbuminuria group). The results did
not change after stratification by duration of diabetes (above and
below the median) or use of a more stringent definition of hypertension
(ie, systolic or diastolic pressure higher than 160
or 95 mm Hg, respectively) (data not shown).
|
| Discussion |
|---|
|
|
|---|
Our data on the association of the risk of nephropathy with homozygosity for allele 235T are consistent with a preliminary report from Northern Ireland.31 The relative risk in that study (OR=2.7, 95% CI=1.15 to 6.7) is not significantly different from that of our study (Breslow-Day test), and the summary relative risk based on the two studies is 2.0 (95% CI=1.2 to 3.6).
The interest in the AGT M235T polymorphism as a candidate locus for diabetic nephropathy arose from the observation of a significant association between allele 235T and essential hypertension among nondiabetic individuals, both whites and Japanese.21 32 This association, however, has been questioned recently by two reports from Great Britain.22 24 While confirming the linkage between the AGT locus and essential hypertension, these studies have failed to find any relation between the AGT M235T polymorphism and increased blood pressure in whites and African Caribbeans.22 24 Also, in the present study, allele 235T was not associated with hypertension, although that finding must be interpreted with caution considering the relatively young age and small number of our IDDM subjects, the mild degree of hypertension in our cases, and the fact that hypertension related to IDDM may be different from essential hypertension.
If we assume that AGT allele 235T and a predisposition to essential hypertension are associated as reported by Jeunemaitre et al,21 the finding of a nonsignificant association between AGT M235T and diabetic nephropathy in the present study may be explained by one of the following issues. The first is sample size. The reported association between allele 235T and essential hypertension was fairly weak.21 In the original study by Jeunemaitre et al, the AGT M235T polymorphism was estimated to contribute only 3% to 6% of the cases of essential hypertension before age 60 years.21 Susceptibility to diabetic nephropathy is genetically heterogeneous,9 and a predisposition to essential hypertension presumably contributes to only a subset of that susceptibility.11 Therefore, the contribution of the AGT M235T locus to diabetic nephropathy would be even smaller than that to hypertension. This small effect may not be detected at the conventional significance level in a study of this size.
The second issue is the matter of competing risk. The concurrence of diabetic nephropathy, which is a strong risk factor for coronary artery disease,33 and AGT allele 235T, which predisposes to hypertension,21 may result in early cardiovascular events and death. Therefore, our study group of nephropathy cases may have been depleted of cases carrying AGT allele 235T. In support of this hypothesis, the frequency of allele 235T was lower in the second than in the first series of overt proteinuria cases. The second series was a cross-sectional sample and more susceptible to this selection mechanism than the first series, which was based on an inception cohort.
The third issue is whether the power of our study was diminished by misclassification of nephropathy status when based on determinations of microalbuminuria. However, most of the normoalbuminuric control subjects and the first series of cases have been confirmed as such at follow-up visits, and the second series of cases was selected on the basis of repeated ACR determinations.3 Therefore, the effect of misclassification should have been minor.
If we assume, instead, that the AGT allele 235T is not associated with hypertension, as was reported by Caulfield et al22 24 and was the case in our IDDM population, the slight excess of this allele among nephropathy cases may be due to an effect of this allele on susceptibility to diabetic nephropathy, independent of systemic blood pressure. This effect may be mediated by a local action of the polymorphism on renal microcirculation, which is under the control of the renin-angiotensin system.23 Abnormalities of kidney hemodynamics, such as increased intraglomerular pressure and glomerular filtration rate, have been described as important determinants of renal damage in diabetes.34 Alternatively, the slight differences in allele frequencies between nephropathy cases and normoalbuminuric control subjects may be due to chance. Rather than at position 235, the locus conferring susceptibility to hypertension and diabetic nephropathy might be placed in the 5' or 3' untranscribed regions of the AGT gene, at which elements regulating gene transcription are located.35 In the two studies by Caulfield et al,22 24 an association with essential hypertension was absent at position 235 but could be detected at a microsatellite locus flanking the AGT gene on the 3' side.
In conclusion, our data indicate that the effect of the AGT polymorphism M235T on the susceptibility to nephropathy in IDDM, if any, is rather small and independent of a predisposition to hypertension. It should be noted, however, that even a small effect, if significant, may be relevant in the context of a complex disorder such as diabetic nephropathy. It will be important to obtain more precise risk estimates in larger populations. It must also be considered that our results do not apply to the whole AGT gene. Although the association between hypertension and the M235T polymorphism is controversial, linkage between the AGT locus and increased blood pressure has been reported consistently.21 22 Thus, further studies are needed to assess whether other polymorphisms at this locus are more specific markers of a predisposition to hypertension and nephropathy in IDDM than AGT M235T.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
Received December 4, 1995; first decision January 8, 1996; accepted February 1, 1996.
| References |
|---|
|
|
|---|
2. Andersen AR, Christiansen JS, Andersen JK, Kreiner S, Deckert T. Diabetic nephropathy in type I (insulin-dependent) diabetes: an epidemiologic study. Diabetologia. 1983;25:496-501. [Medline] [Order article via Infotrieve]
3. Krolewski AS, Laffel LMB, Krolewski M, Quinn M, Warram JH. Glycated hemoglobin and risk of microalbuminuria in patients with insulin-dependent diabetes mellitus. N Engl J Med. 1995;332:1252-1255.
4.
DCCT Research Group. The effect of intensive treatment
of diabetes on the development and progression of long term
complications in insulin-dependent diabetes mellitus. N
Engl J Med. 1995;329:977-986.
5. Krolewski AS, Warram JH, Christlieb AR, Busick EJ, Kahn CR. The changing natural history of nephropathy in type I diabetes. Am J Med. 1985;78:785-794. [Medline] [Order article via Infotrieve]
6. Seaquist ER, Goetz FC, Rich S, Barbosa J. Familial clustering of diabetic kidney disease: evidence for genetic susceptibility to diabetic nephropathy. N Engl J Med. 1989;320:1161-1165. [Abstract]
7. Borch-Johnsen K, Nørgaard K, Hommel E, Mathiesen ER, Jensen JS, Deckert T, Parving HH. Is diabetic nephropathy an inherited complication? Kidney Int. 1992;41:719-722. [Medline] [Order article via Infotrieve]
8. Quinn M, Angelico MC, Warram JH, Krolewski AS. Familial factors determine the development of diabetic nephropathy in patients with IDDM. Diabetologia. In press.
9. Doria A, Warram JH, Krolewski AS. Genetic susceptibility to nephropathy in IDDM: from epidemiology to molecular genetics. Diabetes Metab Rev. 1995;11:287-314. [Medline] [Order article via Infotrieve]
10. Viberti GC, Keen H, Wiseman MJ. Raised arterial pressure in parents of proteinuric insulin dependent diabetics. Br Med J. 1987;295:515-517.
11. Krolewski AS, Canessa M, Warram JH, Laffel LMB, Christlieb AR, Knowler WC, Rand LI. Predisposition to hypertension and susceptibility to renal disease in insulin-dependent diabetes mellitus. N Engl J Med. 1988;318:140-145. [Abstract]
12. Mangili R, Bending JJ, Scott G, Li K, Gupta A, Viberti GC. Increased sodium-lithium countertransport activity in red blood cells of patients with insulin-dependent diabetes and nephropathy. N Engl J Med. 1988;318:146-150. [Abstract]
13. Barzilay J, Warram JH, Bak M, Laffel LMB, Canessa M, Krolewski AS. Predisposition to hypertension: risk factor for nephropathy and hypertension in IDDM. Kidney Int. 1992;41:723-730. [Medline] [Order article via Infotrieve]
14. Jensen JS, Mathiesen ER, Norgaard K, Hommel E, Borch-Johnsen K, Funder J, Brahm J, Parving HH, Deckert T. Increased blood pressure and erythrocyte sodium/lithium countertransport activity are not inherited in diabetic nephropathy. Diabetologia. 1990;33:619-624. [Medline] [Order article via Infotrieve]
15. Elving LD, Wetzels JFM, DePont JJHHM, Berden JHM. Is increased sodium-lithium countertransport a useful marker for diabetic nephropathy? Kidney Int. 1992;41:862-871. [Medline] [Order article via Infotrieve]
16. Doria A, Warram JH, Krolewski AS. Genetic predisposition to diabetic nephropathy: evidence for a role of the angiotensin I-converting enzyme gene. Diabetes. 1994;43:690-695. [Abstract]
17. Marre M, Bernadet P, Gallois Y, Savagner F, Guyene TT, Hallab M, Cambien F, Passa P, Alhenc-Gelas F. Relationship between angiotensin I converting enzyme gene polymorphism, plasma levels and diabetic retinal and renal complications. Diabetes. 1994;43:384-388. [Abstract]
18. Jeunemaitre X, Lifton RP, Hunt SC, Williams RR, Lalouel JM. Absence of linkage between the angiotensin converting enzyme and human essential hypertension. Nat Genet. 1992;1:72-75. [Medline] [Order article via Infotrieve]
19. Schmidt S, Schone N, Ritz E, and the Diabetic Nephropathy Study Group. Association of ACE gene polymorphism and diabetic nephropathy? Kidney Int. 1995;47:1176-1181. [Medline] [Order article via Infotrieve]
20. Tarnow L, Cambien F, Rossing P, Nielsen FS, Hansen BV, Lecerf L, Poirier O, Danilov S, Parving HH. Lack of relationship between an insertion/deletion polymorphism in the angiotensin I-converting enzyme gene and diabetic nephropathy and proliferative retinopathy in IDDM patients. Diabetes. 1995;44:489-494. [Abstract]
21. Jeunemaitre X, Soubrier F, Kotelevtsev YV, Lifton RP, Williams CS, Charru A, Hunt SC, Hopkins PN, Williams RR, Lalouel JM, Corvol P. Molecular basis of human hypertension: role of angiotensinogen. Cell. 1992;71:169-180. [Medline] [Order article via Infotrieve]
22.
Caulfield M, Lavender P, Farral M, Path MRC, Munroe P,
Lawson M, Turner P, Clark AJL. Linkage of the
angiotensinogen gene to essential hypertension.
N Engl J Med. 1994;330:1629-1633.
23. Ballerman BJ, Zeidel ML, Gunning ME, Brenner BM. Vasoactive peptides and the kidney. In: Brenner BM, Rector FC, eds. The Kidney. 4th ed. Philadelphia, Pa: WB Saunders; 1991:510-583.
24. Caulfield M, Lavender P, Newell-Price J, Farral M, Kamdar S, Daniel H, Lawson M, De Freitas P, Fogarty P, Clark AJL. Linkage of the angiotensinogen gene locus to essential hypertension in African Caribbeans. J Clin Invest. 1995;96:687-692.
25. Warram JH, Gearin G, Laffel L, Krolewski AS. Effect of duration of IDDM on the prevalence of stages of diabetic nephropathy defined by urinary albumin creatinine ratio. J Am Soc Nephrol. In press.
26. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning. A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989.
27. Parker S, Angelico MC, Laffel L, Krolewski AS. Application of denaturing gradient gel electrophoresis to detect DNA sequence differences encoding apolipoprotein E isoforms. Genomics. 1993;16:245-247. [Medline] [Order article via Infotrieve]
28. Behrens J, Warram JH, Lerman LS, Krolewski AS. User-friendly PC program to obtain DNA melting map. Am J Hum Genet. 1990;47(suppl 1):A173. Abstract.
29.
Fischer SG, Lerman LS. DNA fragments differing
by single base-pair substitution are separated in denaturing
gradient gel: correspondence with melting theory. Proc
Natl Acad Sci U S A. 1983;80:1579-1583.
30. Rothman KJ. Modern Epidemiology. Boston, Mass: Little, Brown & Co; 1986:85-114.
31. Fogarty DG, Harron JC, Hughes AE, Doherty CC, Maxwell AP. The association of an angiotensinogen gene variant with diabetic nephropathy. J Am Soc Nephrol. 1996;6:449. Abstract.
32. Hata A, Namikawa C, Sasaki M, Sato K, Nakamura T, Tamura K, Lalouel JM. Angiotensinogen as a risk factor for essential hypertension in Japan. J Clin Invest. 1994;93:1285-1287.
33. Krolewski AS, Kosinski EJ, Warram JH, Leland OS, Busick EJ, Asmal AC, Rand LI, Christlieb AR, Bradely RF, Kahn CR. Magnitude and determinants of coronary artery disease in juvenile-onset insulin-dependent diabetes mellitus. Am J Cardiol. 1987;59:750-755. [Medline] [Order article via Infotrieve]
34. Mogensen CE, Christensen CK. Predicting diabetic nephropathy in insulin dependent patients. N Engl J Med. 1984;311:89-93. [Abstract]
35.
Nibu Y, Takahashi S, Tanimoto K, Murakami K, Fukamizu
A. Identification of a cell-type dependent enhancer core
element located in the 3'-downstream region of the human
angiotensinogen gene. J Biol
Chem. 1994;269:28598-28605.
This article has been cited by other articles:
![]() |
K. G. Ewens, R. A. George, K. Sharma, F. N. Ziyadeh, and R. S. Spielman Assessment of 115 Candidate Genes for Diabetic Nephropathy by Transmission/Disequilibrium Test Diabetes, November 1, 2005; 54(11): 3305 - 3318. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Susztak, K. Sharma, M. Schiffer, P. McCue, E. Ciccone, and E. P. Bottinger Genomic Strategies for Diabetic Nephropathy J. Am. Soc. Nephrol., August 1, 2003; 14(90003): S271 - 278. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Zychma, E. Zukowska-Szczechowska, B. I. Lacka, and W. Grzeszczak Angiotensinogen M235T and chymase gene CMA/B polymorphisms are not associated with nephropathy in type II diabetes Nephrol. Dial. Transplant., December 1, 2000; 15(12): 1965 - 1970. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. J. van Ittersum, A. M. E. de Man, S. Thijssen, P. de Knijff, E. Slagboom, Y. Smulders, L. Tarnow, A. J. M. Donker, H. J. G. Bilo, and C. D. A. Stehouwer Genetic polymorphisms of the renin-angiotensin system and complications of insulin-dependent diabetes mellitus Nephrol. Dial. Transplant., July 1, 2000; 15(7): 1000 - 1007. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Malin, V. Wirta, T. P. Hiltunen, and T. Lehtimaki Rapid Detection of Angiotensinogen M/T235 Polymorphism by Fluorescence Probe Melting Curves Clin. Chem., June 1, 2000; 46(6): 880 - 881. [Full Text] [PDF] |
||||
![]() |
K. Yanai, K. Hirota, K. Taniguchi-Yanai, Y. Shigematsu, Y. Shimamoto, T. Saito, S. Chowdhury, M. Takiguchi, M. Arakawa, Y. Nibu, et al. Regulated Expression of Human Angiotensinogen Gene by Hepatocyte Nuclear Factor 4 and Chicken Ovalbumin Upstream Promoter-Transcription Factor J. Biol. Chem., December 3, 1999; 274(49): 34605 - 34612. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. ZYCHMA, J. GUMPRECHT, E. ZUKOWSKA-SZCZECHOWSKA, and W. GRZESZCZAK Polymorphisms in the Genes Encoding for Human Kinin Receptors and the Risk of End-Stage Renal Failure: Results of Transmission/DisequilibriumTest J. Am. Soc. Nephrol., October 1, 1999; 10(10): 2120 - 2124. [Abstract] [Full Text] |
||||
![]() |
J. Deinum, L. Tarnow, J. M. van Gool, R. A. de Bruin, F. H. M. Derkx, M. A. D. H. Schalekamp, and H.-H. Parving Plasma renin and prorenin and renin gene variation in patients with insulin-dependent diabetes mellitus and nephropathy Nephrol. Dial. Transplant., August 1, 1999; 14(8): 1904 - 1911. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. S. Freire, L. Ji, T. Onuma, T. Orban, J. H. Warram, and A. S. Krolewski Gender-Specific Association of M235T Polymorphism in Angiotensinogen Gene and Diabetic Nephropathy in NIDDM Hypertension, April 1, 1998; 31(4): 896 - 899. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Rogus, D. Moczulski, M. B. S. Freire, Y. Yang, J. H. Warram, and A. S. Krolewski Diabetic Nephropathy Is Associated With AGT Polymorphism T235 : Results of a Family-Based Study Hypertension, February 1, 1998; 31(2): 627 - 631. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yanai, T. Saito, K. Hirota, H. Kobayashi, K. Murakami, and A. Fukamizu Molecular Variation of the Human Angiotensinogen Core Promoter Element Located between the TATA Box and Transcription Initiation Site Affects Its Transcriptional Activity J. Biol. Chem., November 28, 1997; 272(48): 30558 - 30562. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Corvol and X. Jeunemaitre Molecular Genetics of Human Hypertension: Role of Angiotensinogen Endocr. Rev., October 1, 1997; 18(5): 662 - 677. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Hypertension Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1996 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |