Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 1996;27:1134-1139

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Doria, A.
Right arrow Articles by Krolewski, A. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Doria, A.
Right arrow Articles by Krolewski, A. S.

(Hypertension. 1996;27:1134-1139.)
© 1996 American Heart Association, Inc.


Articles

Angiotensinogen Polymorphism M235T, Hypertension, and Nephropathy in Insulin-Dependent Diabetes

Alessandro Doria; Tomio Onuma; Gary Gearin; M. Beatriz S. Freire; James H. Warram; Andrzej S. Krolewski

From the Section on Epidemiology and Genetics, Research Division, Joslin Diabetes Center, and the Department of Medicine, Harvard Medical School, Boston, Mass.

Correspondence to Andrzej S. Krolewski, MD, PhD, Section on Epidemiology and Genetics, Joslin Diabetes Center, One Joslin Place, Boston, MA 02215.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract The allele 235T (a threonine in place of a methionine at position 235) of angiotensinogen has been found to be associated with a predisposition to essential hypertension. We investigated whether this allele also confers increased susceptibility to nephropathy in patients with insulin-dependent diabetes mellitus (IDDM). A group of 380 patients who had had IDDM for 15 to 20 years were genotyped at the angiotensinogen 235 locus. Included were 75 patients with normoalbuminuria (albumin excretion rate <30 µg/min), two series of patients with microalbuminuria (n=30 and n=136), and two series with overt proteinuria (n=41 and n=98). Allele 235T frequency was higher among cases with microalbuminuria (0.41 in the two series combined) or overt proteinuria (0.40) than in the normoalbuminuria group (0.36). However, this difference was not statistically significant with this sample size ({chi}2=1.2, P=NS with 2 df). Under a recessive model, allele 235T homozygotes had a 1.6-fold risk of developing nephropathy relative to carriers of other genotypes, but this value was not significantly different from 1 (95% CI=0.8 to 3.5). The strength of the association did not improve after stratification by degree of glycemic control. With respect to the hypertension in these IDDM patients, no association with allele 235T was found. Allele 235T frequencies in normotensive and hypertensive individuals were 0.363 and 0.353, respectively, among normoalbuminuric IDDM individuals ({chi}2=0.01, P=NS) and 0.411 and 0.414 among microalbuminuric IDDM subjects ({chi}2=0.0, P=NS). We conclude that the angiotensinogen polymorphism M235T might influence susceptibility to nephropathy in insulin-dependent diabetes, but its effect, if any, is rather small and independent of hypertension.


Key Words: genetics • insulin-dependent diabetes • nephropathy • angiotensinogen


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
After 30 years' duration of IDDM, nephropathy has developed in about one of three patients and represents the major determinant of morbidity and mortality for this population.1 2 The strong relationship between poor glycemic control and the risk of nephropathy, as well as the reduction of this risk after amelioration of glycemic control, indicates that hyperglycemia plays a pivotal role in the etiology of this complication.3 4 Nonetheless, data from epidemiological and family studies suggest that the diabetic milieu must interact with susceptibility factors, most likely genetic, to determine renal damage.5 6 7 8 9 Such genetic susceptibility to diabetic nephropathy appears to overlap in part with that to essential hypertension. Several studies have reported that IDDM patients with overt proteinuria and microalbuminuria have a higher prevalence of parental hypertension and Na-Li countertransport hyperactivity in red blood cells (a presumed genetic marker of essential hypertension) than IDDM individuals without nephropathy,10 11 12 13 although these findings have not been confirmed in all populations.14 15

We and others have recently reported that DNA polymorphisms in the angiotensin-converting enzyme gene, a locus involved in blood pressure regulation, are associated with increased susceptibility to nephropathy in IDDM.16 17 This effect, however, appears to be independent of a predisposition to hypertension, consistent with other evidence that the angiotensin-converting enzyme gene is not linked to essential hypertension.18 Moreover, the association with nephropathy has not been confirmed in other populations.19 20 Thus, other genetic factors, presumably related to essential hypertension, are likely to play a role as determinants of susceptibility to nephropathy.

One of the several genes that have been implicated in essential hypertension is AGT,21 22 which is involved in blood pressure regulation by coding for the precursor of angiotensin II, the effector peptide of the renin-angiotensin system having vasoconstrictor and sodium-retaining effects.23 Evidence of linkage between the AGT locus (1q4) and essential hypertension has been consistently found in white and African Caribbean populations.21 22 24 Among whites, a polymorphism in exon 2, consisting of two alleles coding for a methionine or a threonine at position 235, has been proposed as the polymorphic site responsible for these findings.21 In the same population in which linkage was originally reported, the threonine allele (235T) was significantly more frequent among hypertensive cases than normotensive control subjects and was associated with high serum levels of AGT.21 In the present study, we have investigated whether the AGT polymorphism M235T also contributes to the genetic susceptibility to nephropathy in IDDM.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Study Population
To eliminate biases in patient selection, we selected the study groups from two well-defined study populations. The first was a nested case-control study of the determinants of late diabetic complications that was conducted between 1986 and 1988 in a cohort of patients with IDDM for 15 to 20 years.13 Good-quality DNA was still available in 1992 for 146 (90%) of the 162 participants; 75 of these were normoalbuminuric (referred to as the normoalbuminuria group), 30 had microalbuminuria (microalbuminuria group 1), and 41 had overt proteinuria (overt proteinuria group 1). The selection and evaluation of patients for this study have been described in detail previously.13 In brief, an inception cohort of 432 IDDM patients was ascertained by the following criteria: newly diagnosed cases of IDDM among white residents of Massachusetts younger than 21 years of age who came to the Joslin Clinic between January 1, 1967, and December 31, 1972. In 1986, 15 to 20 years after onset of IDDM, the prevalence of retinopathy was ascertained in this cohort independently of their attendance at the Joslin Clinic. Cases with advanced proliferative retinopathy (n=59) and a random sample (n=103) of those without severe eye disease were examined for renal disease.13 The evaluation of renal status included measurements of fasting serum creatinine and albumin excretion rate during a 3-hour timed urine collection performed in the morning. Normoalbuminuria was defined as an albumin excretion rate less than 30 µg/min, overt proteinuria as an albumin excretion rate greater than or equal to 250 µg/min (including patients on hemodialysis or with renal transplant), and microalbuminuria as the range between normoalbuminuria and overt proteinuria. An index of glycemic control in the first 12 years of IDDM based on clinic blood sugar measurements was determined as described by Barzilay et al.13 Patients were considered hypertensive if they were on antihypertensive drugs or if the average of two supine measurements (standard sphygmomanometer) of systolic or diastolic pressure was greater than or equal to 140 or 90 mm Hg, respectively.

To enlarge the number of cases with microalbuminuria and overt proteinuria, we selected patients with a confirmed diagnosis of persistent microalbuminuria or overt proteinuria from a study of the natural history of microalbuminuria in IDDM patients that is being conducted at the Joslin Clinic.3 The selection and evaluation of patients for this study have been described in detail previously.3 In brief, all patients enrolled in this study (n=1613) are white residents of Massachusetts and had the onset of IDDM before age 41 years. They came to the Joslin Clinic soon after the diagnosis of IDDM (on average, 3 years) and have remained under the care of the clinic ever since. Renal status was evaluated by multiple random urine samples collected at the time of clinic visits during 1991-1993. These were screened for overt albuminuria with reagent strips read by an optical scanner (Multistix, Ames Division, Miles Laboratory). In samples that were not strongly positive for overt albuminuria (<2+ on Multistix), urinary albumin concentration was measured by immunonephelometry with N Albumin kits (Behring). Urinary creatinine concentrations were measured by colorimetry (modified Jaffé reaction) on an Astra-7 automated system (Beckman Instruments). Normoalbuminuria was defined as an ACR less than 1.9 mg/mmol (17 µg/mg) for men and less than 2.8 mg/mmol (25 µg/mg) for women. Overt proteinuria was defined as an ACR greater than or equal to 28.2 mg/mmol (250 µg/mg) for men or greater than or equal to 40.2 mg/mmol (355 µg/mg) for women or a reagent strip reading 2+ or higher. When converted to albumin excretion rates, these lower and upper cut points for the ACR correspond to 30 and 300 µg/min, respectively{25}. Microalbuminuria was defined as an ACR in the range between normoalbuminuria and overt proteinuria. Classification of a patient's renal status was based on a consensus of two of three determinations.3 Of the 1613 patients screened, 295 had microalbuminuria and 201 had overt proteinuria.3 From among those with well-documented renal disease, 136 microalbuminuric (microalbuminuria group 2) and 98 proteinuric (overt proteinuria group 2) individuals were selected for the present study. Patients were considered hypertensive if they were on antihypertensive drugs or the average of two supine measurements of systolic or diastolic blood pressure was greater than or equal to 140 or 90 mm Hg, respectively. An index of long-term glycemic control was based on the geometric mean of hemoglobin A1 measurements taken during 1990 and 1991 as previously described.3

Nondiabetic Control Subjects
Eighty-three unrelated white subjects with normal fasting glycemia and no clinical manifestation of diabetes, mostly Joslin Clinic employees, served as a representative sample of the general population of Massachusetts. This group was used for assessment of whether an association exists between IDDM and allele 235T.

DNA Analysis
For each individual, the genotype of the polymorphism M235T of the AGT gene was determined by PCR amplification of genomic DNA followed by denaturing gradient gel electrophoresis (DGGE). DNA was extracted from whole blood by the phenol chloroform technique according to standard protocols.26 The 3' portion (354 bp) of exon 2 was amplified by PCR with the primers described by Jeunemaitre at al21 (primer 1: GATGCGCACAAGGTCCTGTC, primer 2: GCGCGCGCCAGCAGAGAGGTTTGCCT). Primer 2 was slightly modified by the addition of a 6-bp "GC-clamp" at the 5' end (in boldface) to facilitate the DGGE analysis. PCR was carried out from 1 µg of DNA in 50 µL containing 10 mmol/L Tris-HCl, pH 8.3, 50 mmol/L KCl, 1.5 mmol/L MgCl2, 0.001% gelatin, 0.2 mmol/L each dNTP, 1 µmol/L primers 1 and 2, and 25 U/mL Taq polymerase (Amplitaq, Perkin-Elmer) for 30 cycles (60 seconds at 95°C, 60 seconds at 55°C, 60 seconds at 72°C) in a Perkin-Elmer Thermal Cycler 480. DGGE was performed according to a previously described protocol27 in a 10% polyacrylamide gel with a linear gradient of denaturants from 35% to 70% (100%=7 mol/L urea in 40% formamide) in 1x Tris-acetate–{lambda}EDTA buffer at a constant temperature of 60°C at 10 V/cm for 4 hours. In agreement with the melting characteristics of the two alleles (Fig 1ADown), the allele coding for a threonine (235T, codon ACG) stops in the gel at a higher concentration of denaturant (48.5%) than the allele coding for a methionine (235M, codon ATG) (48%) (Fig 1BDown). Homozygotes are then detected as a single band (two identical homoduplexes) at 48.5% or 48% of denaturant concentration, whereas heterozygotes are identified as four bands (Fig 1BDown) because of the presence of two heteroduplexes that form during the annealing step of PCR, in addition to the two homoduplexes, and melt at lower denaturant concentrations. Occasionally, the band corresponding to allele 235T migrates slightly lower than usual because of the simultaneous presence of the rare variant Y248C, which is also located in the 3' part of exon 2.21 Genotype distributions determined with this method did not depart significantly from Hardy-Weinberg equilibrium in any of the study groups ({chi}2 values ranging between 0.01 and 2.9, P=NS with 1 df).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 1. A, Melting map of a 360-bp PCR fragment containing the M235T polymorphism. Base pairs are numbered relative to the first base of primer 1. Arrow indicates position of the polymorphism. Thick line indicates melting map of allele 235T (a C at position +704 of AGT cDNA); thin line, melting map of allele 235M (a T at the same position). Melting maps were obtained with the EZMELT program.28 B, Denaturing gradient gel electrophoresis of PCR fragments amplified from six unrelated individuals. Allele 235T, which has the highest melting temperature of the lowest melting domain, stops at the highest concentration of denaturants (48.5%), in agreement with the DNA melting theory.29 Allele 235M (lower melting temperature) stops at 48%. Genotypes at the AGT 235 locus are indicated above each lane. In lanes 3 and 5, two additional bands (H) are visible at higher positions in the gel because of the presence of heteroduplexes melting at lower denaturant concentrations (lower temperatures) than homoduplexes.

Data Analysis
Allele frequencies were computed from genotype frequencies. The distributions of genotypes and alleles were compared between study groups by {chi}2 tests.30 As a descriptive measure of association between genotypes and outcomes, OR values are given along with 95% CI.30


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Characteristics of the Study Populations
Age and duration of diabetes were similar in all study groups (Table 1Down). Individuals with microalbuminuria, besides having poorer metabolic control, were also characterized by a higher prevalence of hypertension (40% in series 1 and 47% in series 2) compared with the normoalbuminuria group (23%) (Table 1Down). Most of the individuals with overt proteinuria were hypertensive (88% and 83% in series 1 and 2, respectively).


View this table:
[in this window]
[in a new window]
 
Table 1. Clinical Characteristics of the Study Groups

AGT 235 Alleles and Diabetic Nephropathy
The frequency of AGT allele 235T in the normoalbuminuria group (0.36) was comparable to that among nondiabetic control subjects (0.373) (Table 2Down). These values were consistent with the frequency reported for normotensive individuals (0.36) in the original article describing the polymorphism.14 The two series of microalbuminuria cases did not differ significantly with respect to allele 235T frequency ({chi}2=0.005, P=NS with 1 df). Hence, for further analysis, all individuals with microalbuminuria were considered as one group. Similarly, the difference between the two series of casess with overt proteinuria was not significant ({chi}2=0.9, P=NS with 1 df), so they were combined in one group. Allele 235T, which has been found to be associated with essential hypertension in the general population,21 was slightly more frequent among the chromosomes of cases with microalbuminuria (0.412) and overt proteinuria (0.396) than among those with normoalbuminuria (0.36) (Table 2Down). However, this difference was not statistically significant with this sample size ({chi}2=1.2, P=NS with 2 df). The strength of the association was not affected by the degree of long-term glycemic control, which was similar among individuals with an index of hyperglycemia or glycosylated hemoglobin above and below the median (data not shown). The results also were not statistically significant after microalbuminuric and proteinuric individuals were grouped together as nephropathy cases (235T frequency=0.405 compared with 0.360 in the normoalbuminuria group, {chi}2=1.02, P=NS).


View this table:
[in this window]
[in a new window]
 
Table 2. Frequency of AGT Allele 235T in the Study Groups

The slight excess of 235T allele among nephropathy cases was related to an increased proportion of 235T/235T homozygotes in the microalbuminuria and overt proteinuria groups compared with normoalbuminuric individuals (Table 3Down). The risk of nephropathy (microalbuminuria and proteinuria combined) for allele 235T homozygotes was 1.6 times that of other genotypes, but this value was not significantly different from 1 with this sample size (95% CI=0.8 to 3.5).


View this table:
[in this window]
[in a new window]
 
Table 3. Genotype Distribution in Individuals With Normoalbuminuria and the Two Series of Renal Cases (No. 1/No. 2)

AGT 235 Alleles and Hypertension in IDDM
The frequencies of allele 235T among the chromosomes of normotensive and hypertensive IDDM individuals were separately compared within the normoalbuminuria group and the two combined series of microalbuminuria cases (Table 4Down). Patients with overt proteinuria, who were mostly hypertensive, were not considered in this analysis. No association between AGT allele 235T and hypertension could be observed in this sample of IDDM individuals (Table 4Down). Homozygotes for allele 235T had a risk of hypertension similar to that of other genotypes (OR=1.0 [95% CI=0.2 to 5.1] in the normoalbuminuria group and OR=0.7 [95% CI=0.3 to 1.6] in the microalbuminuria group). The results did not change after stratification by duration of diabetes (above and below the median) or use of a more stringent definition of hypertension (ie, systolic or diastolic pressure higher than 160 or 95 mm Hg, respectively) (data not shown).


View this table:
[in this window]
[in a new window]
 
Table 4. Frequency of the AGT Allele 235T in Relation to Hypertensive Status


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The findings from previous epidemiological and family studies strongly indicate that genetic factors related to a predisposition to hypertension are important in determining susceptibility to nephropathy in IDDM.5 6 7 8 9 10 11 12 13 Our data suggest that the AGT polymorphism M235T may have an effect in this context, although its magnitude is small. Allele 235T was more frequent in IDDM patients with nephropathy than in IDDM individuals with normoalbuminuria, but the difference was small and not statistically significant with this sample size. Under a recessive model (risk 235T/235T>risk 235M/235T=risk 235M/235M), allele 235T homozygotes had a 1.6-fold risk of developing nephropathy relative to carriers of other genotypes. No association was found in our study with regard to hypertension among IDDM subjects.

Our data on the association of the risk of nephropathy with homozygosity for allele 235T are consistent with a preliminary report from Northern Ireland.31 The relative risk in that study (OR=2.7, 95% CI=1.15 to 6.7) is not significantly different from that of our study (Breslow-Day test), and the summary relative risk based on the two studies is 2.0 (95% CI=1.2 to 3.6).

The interest in the AGT M235T polymorphism as a candidate locus for diabetic nephropathy arose from the observation of a significant association between allele 235T and essential hypertension among nondiabetic individuals, both whites and Japanese.21 32 This association, however, has been questioned recently by two reports from Great Britain.22 24 While confirming the linkage between the AGT locus and essential hypertension, these studies have failed to find any relation between the AGT M235T polymorphism and increased blood pressure in whites and African Caribbeans.22 24 Also, in the present study, allele 235T was not associated with hypertension, although that finding must be interpreted with caution considering the relatively young age and small number of our IDDM subjects, the mild degree of hypertension in our cases, and the fact that hypertension related to IDDM may be different from essential hypertension.

If we assume that AGT allele 235T and a predisposition to essential hypertension are associated as reported by Jeunemaitre et al,21 the finding of a nonsignificant association between AGT M235T and diabetic nephropathy in the present study may be explained by one of the following issues. The first is sample size. The reported association between allele 235T and essential hypertension was fairly weak.21 In the original study by Jeunemaitre et al, the AGT M235T polymorphism was estimated to contribute only 3% to 6% of the cases of essential hypertension before age 60 years.21 Susceptibility to diabetic nephropathy is genetically heterogeneous,9 and a predisposition to essential hypertension presumably contributes to only a subset of that susceptibility.11 Therefore, the contribution of the AGT M235T locus to diabetic nephropathy would be even smaller than that to hypertension. This small effect may not be detected at the conventional significance level in a study of this size.

The second issue is the matter of competing risk. The concurrence of diabetic nephropathy, which is a strong risk factor for coronary artery disease,33 and AGT allele 235T, which predisposes to hypertension,21 may result in early cardiovascular events and death. Therefore, our study group of nephropathy cases may have been depleted of cases carrying AGT allele 235T. In support of this hypothesis, the frequency of allele 235T was lower in the second than in the first series of overt proteinuria cases. The second series was a cross-sectional sample and more susceptible to this selection mechanism than the first series, which was based on an inception cohort.

The third issue is whether the power of our study was diminished by misclassification of nephropathy status when based on determinations of microalbuminuria. However, most of the normoalbuminuric control subjects and the first series of cases have been confirmed as such at follow-up visits, and the second series of cases was selected on the basis of repeated ACR determinations.3 Therefore, the effect of misclassification should have been minor.

If we assume, instead, that the AGT allele 235T is not associated with hypertension, as was reported by Caulfield et al22 24 and was the case in our IDDM population, the slight excess of this allele among nephropathy cases may be due to an effect of this allele on susceptibility to diabetic nephropathy, independent of systemic blood pressure. This effect may be mediated by a local action of the polymorphism on renal microcirculation, which is under the control of the renin-angiotensin system.23 Abnormalities of kidney hemodynamics, such as increased intraglomerular pressure and glomerular filtration rate, have been described as important determinants of renal damage in diabetes.34 Alternatively, the slight differences in allele frequencies between nephropathy cases and normoalbuminuric control subjects may be due to chance. Rather than at position 235, the locus conferring susceptibility to hypertension and diabetic nephropathy might be placed in the 5' or 3' untranscribed regions of the AGT gene, at which elements regulating gene transcription are located.35 In the two studies by Caulfield et al,22 24 an association with essential hypertension was absent at position 235 but could be detected at a microsatellite locus flanking the AGT gene on the 3' side.

In conclusion, our data indicate that the effect of the AGT polymorphism M235T on the susceptibility to nephropathy in IDDM, if any, is rather small and independent of a predisposition to hypertension. It should be noted, however, that even a small effect, if significant, may be relevant in the context of a complex disorder such as diabetic nephropathy. It will be important to obtain more precise risk estimates in larger populations. It must also be considered that our results do not apply to the whole AGT gene. Although the association between hypertension and the M235T polymorphism is controversial, linkage between the AGT locus and increased blood pressure has been reported consistently.21 22 Thus, further studies are needed to assess whether other polymorphisms at this locus are more specific markers of a predisposition to hypertension and nephropathy in IDDM than AGT M235T.


*    Selected Abbreviations and Acronyms
 
ACR = albumin-to-creatinine ratio
AGT = angiotensinogen
CI = confidence interval
IDDM = insulin-dependent diabetes mellitus
OR = odds ratio
PCR = polymerase chain reaction


*    Acknowledgments
 
This work was supported by a grant (RO1-DK41526) from the National Institutes of Health. Dr Tomio Onuma was supported by a grant from the Ministry of Education of Japan and Dr M. Beatriz Freire by a grant from the National Council for Scientific and Technological Development of Brazil.

Received December 4, 1995; first decision January 8, 1996; accepted February 1, 1996.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Krolewski AS, Warram JH. Epidemiology of late complications of diabetes. In: Kahn CR, Weir G, eds. Joslin's Diabetes Mellitus. 13th ed. Philadelphia, Pa: Lea & Febiger; 1994:605-619.

2. Andersen AR, Christiansen JS, Andersen JK, Kreiner S, Deckert T. Diabetic nephropathy in type I (insulin-dependent) diabetes: an epidemiologic study. Diabetologia. 1983;25:496-501. [Medline] [Order article via Infotrieve]

3. Krolewski AS, Laffel LMB, Krolewski M, Quinn M, Warram JH. Glycated hemoglobin and risk of microalbuminuria in patients with insulin-dependent diabetes mellitus. N Engl J Med. 1995;332:1252-1255.

4. DCCT Research Group. The effect of intensive treatment of diabetes on the development and progression of long term complications in insulin-dependent diabetes mellitus. N Engl J Med. 1995;329:977-986. [Abstract/Free Full Text]

5. Krolewski AS, Warram JH, Christlieb AR, Busick EJ, Kahn CR. The changing natural history of nephropathy in type I diabetes. Am J Med. 1985;78:785-794. [Medline] [Order article via Infotrieve]

6. Seaquist ER, Goetz FC, Rich S, Barbosa J. Familial clustering of diabetic kidney disease: evidence for genetic susceptibility to diabetic nephropathy. N Engl J Med. 1989;320:1161-1165. [Abstract]

7. Borch-Johnsen K, Nørgaard K, Hommel E, Mathiesen ER, Jensen JS, Deckert T, Parving HH. Is diabetic nephropathy an inherited complication? Kidney Int. 1992;41:719-722. [Medline] [Order article via Infotrieve]

8. Quinn M, Angelico MC, Warram JH, Krolewski AS. Familial factors determine the development of diabetic nephropathy in patients with IDDM. Diabetologia. In press.

9. Doria A, Warram JH, Krolewski AS. Genetic susceptibility to nephropathy in IDDM: from epidemiology to molecular genetics. Diabetes Metab Rev. 1995;11:287-314. [Medline] [Order article via Infotrieve]

10. Viberti GC, Keen H, Wiseman MJ. Raised arterial pressure in parents of proteinuric insulin dependent diabetics. Br Med J. 1987;295:515-517.

11. Krolewski AS, Canessa M, Warram JH, Laffel LMB, Christlieb AR, Knowler WC, Rand LI. Predisposition to hypertension and susceptibility to renal disease in insulin-dependent diabetes mellitus. N Engl J Med. 1988;318:140-145. [Abstract]

12. Mangili R, Bending JJ, Scott G, Li K, Gupta A, Viberti GC. Increased sodium-lithium countertransport activity in red blood cells of patients with insulin-dependent diabetes and nephropathy. N Engl J Med. 1988;318:146-150. [Abstract]

13. Barzilay J, Warram JH, Bak M, Laffel LMB, Canessa M, Krolewski AS. Predisposition to hypertension: risk factor for nephropathy and hypertension in IDDM. Kidney Int. 1992;41:723-730. [Medline] [Order article via Infotrieve]

14. Jensen JS, Mathiesen ER, Norgaard K, Hommel E, Borch-Johnsen K, Funder J, Brahm J, Parving HH, Deckert T. Increased blood pressure and erythrocyte sodium/lithium countertransport activity are not inherited in diabetic nephropathy. Diabetologia. 1990;33:619-624. [Medline] [Order article via Infotrieve]

15. Elving LD, Wetzels JFM, DePont JJHHM, Berden JHM. Is increased sodium-lithium countertransport a useful marker for diabetic nephropathy? Kidney Int. 1992;41:862-871. [Medline] [Order article via Infotrieve]

16. Doria A, Warram JH, Krolewski AS. Genetic predisposition to diabetic nephropathy: evidence for a role of the angiotensin I-converting enzyme gene. Diabetes. 1994;43:690-695. [Abstract]

17. Marre M, Bernadet P, Gallois Y, Savagner F, Guyene TT, Hallab M, Cambien F, Passa P, Alhenc-Gelas F. Relationship between angiotensin I converting enzyme gene polymorphism, plasma levels and diabetic retinal and renal complications. Diabetes. 1994;43:384-388. [Abstract]

18. Jeunemaitre X, Lifton RP, Hunt SC, Williams RR, Lalouel JM. Absence of linkage between the angiotensin converting enzyme and human essential hypertension. Nat Genet. 1992;1:72-75. [Medline] [Order article via Infotrieve]

19. Schmidt S, Schone N, Ritz E, and the Diabetic Nephropathy Study Group. Association of ACE gene polymorphism and diabetic nephropathy? Kidney Int. 1995;47:1176-1181. [Medline] [Order article via Infotrieve]

20. Tarnow L, Cambien F, Rossing P, Nielsen FS, Hansen BV, Lecerf L, Poirier O, Danilov S, Parving HH. Lack of relationship between an insertion/deletion polymorphism in the angiotensin I-converting enzyme gene and diabetic nephropathy and proliferative retinopathy in IDDM patients. Diabetes. 1995;44:489-494. [Abstract]

21. Jeunemaitre X, Soubrier F, Kotelevtsev YV, Lifton RP, Williams CS, Charru A, Hunt SC, Hopkins PN, Williams RR, Lalouel JM, Corvol P. Molecular basis of human hypertension: role of angiotensinogen. Cell. 1992;71:169-180. [Medline] [Order article via Infotrieve]

22. Caulfield M, Lavender P, Farral M, Path MRC, Munroe P, Lawson M, Turner P, Clark AJL. Linkage of the angiotensinogen gene to essential hypertension. N Engl J Med. 1994;330:1629-1633. [Abstract/Free Full Text]

23. Ballerman BJ, Zeidel ML, Gunning ME, Brenner BM. Vasoactive peptides and the kidney. In: Brenner BM, Rector FC, eds. The Kidney. 4th ed. Philadelphia, Pa: WB Saunders; 1991:510-583.

24. Caulfield M, Lavender P, Newell-Price J, Farral M, Kamdar S, Daniel H, Lawson M, De Freitas P, Fogarty P, Clark AJL. Linkage of the angiotensinogen gene locus to essential hypertension in African Caribbeans. J Clin Invest. 1995;96:687-692.

25. Warram JH, Gearin G, Laffel L, Krolewski AS. Effect of duration of IDDM on the prevalence of stages of diabetic nephropathy defined by urinary albumin creatinine ratio. J Am Soc Nephrol. In press.

26. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning. A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989.

27. Parker S, Angelico MC, Laffel L, Krolewski AS. Application of denaturing gradient gel electrophoresis to detect DNA sequence differences encoding apolipoprotein E isoforms. Genomics. 1993;16:245-247. [Medline] [Order article via Infotrieve]

28. Behrens J, Warram JH, Lerman LS, Krolewski AS. User-friendly PC program to obtain DNA melting map. Am J Hum Genet. 1990;47(suppl 1):A173. Abstract.

29. Fischer SG, Lerman LS. DNA fragments differing by single base-pair substitution are separated in denaturing gradient gel: correspondence with melting theory. Proc Natl Acad Sci U S A. 1983;80:1579-1583. [Abstract/Free Full Text]

30. Rothman KJ. Modern Epidemiology. Boston, Mass: Little, Brown & Co; 1986:85-114.

31. Fogarty DG, Harron JC, Hughes AE, Doherty CC, Maxwell AP. The association of an angiotensinogen gene variant with diabetic nephropathy. J Am Soc Nephrol. 1996;6:449. Abstract.

32. Hata A, Namikawa C, Sasaki M, Sato K, Nakamura T, Tamura K, Lalouel JM. Angiotensinogen as a risk factor for essential hypertension in Japan. J Clin Invest. 1994;93:1285-1287.

33. Krolewski AS, Kosinski EJ, Warram JH, Leland OS, Busick EJ, Asmal AC, Rand LI, Christlieb AR, Bradely RF, Kahn CR. Magnitude and determinants of coronary artery disease in juvenile-onset insulin-dependent diabetes mellitus. Am J Cardiol. 1987;59:750-755. [Medline] [Order article via Infotrieve]

34. Mogensen CE, Christensen CK. Predicting diabetic nephropathy in insulin dependent patients. N Engl J Med. 1984;311:89-93. [Abstract]

35. Nibu Y, Takahashi S, Tanimoto K, Murakami K, Fukamizu A. Identification of a cell-type dependent enhancer core element located in the 3'-downstream region of the human angiotensinogen gene. J Biol Chem. 1994;269:28598-28605.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
DiabetesHome page
K. G. Ewens, R. A. George, K. Sharma, F. N. Ziyadeh, and R. S. Spielman
Assessment of 115 Candidate Genes for Diabetic Nephropathy by Transmission/Disequilibrium Test
Diabetes, November 1, 2005; 54(11): 3305 - 3318.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
K. Susztak, K. Sharma, M. Schiffer, P. McCue, E. Ciccone, and E. P. Bottinger
Genomic Strategies for Diabetic Nephropathy
J. Am. Soc. Nephrol., August 1, 2003; 14(90003): S271 - 278.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
M. J. Zychma, E. Zukowska-Szczechowska, B. I. Lacka, and W. Grzeszczak
Angiotensinogen M235T and chymase gene CMA/B polymorphisms are not associated with nephropathy in type II diabetes
Nephrol. Dial. Transplant., December 1, 2000; 15(12): 1965 - 1970.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
F. J. van Ittersum, A. M. E. de Man, S. Thijssen, P. de Knijff, E. Slagboom, Y. Smulders, L. Tarnow, A. J. M. Donker, H. J. G. Bilo, and C. D. A. Stehouwer
Genetic polymorphisms of the renin-angiotensin system and complications of insulin-dependent diabetes mellitus
Nephrol. Dial. Transplant., July 1, 2000; 15(7): 1000 - 1007.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
R. Malin, V. Wirta, T. P. Hiltunen, and T. Lehtimaki
Rapid Detection of Angiotensinogen M/T235 Polymorphism by Fluorescence Probe Melting Curves
Clin. Chem., June 1, 2000; 46(6): 880 - 881.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Yanai, K. Hirota, K. Taniguchi-Yanai, Y. Shigematsu, Y. Shimamoto, T. Saito, S. Chowdhury, M. Takiguchi, M. Arakawa, Y. Nibu, et al.
Regulated Expression of Human Angiotensinogen Gene by Hepatocyte Nuclear Factor 4 and Chicken Ovalbumin Upstream Promoter-Transcription Factor
J. Biol. Chem., December 3, 1999; 274(49): 34605 - 34612.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
M. J. ZYCHMA, J. GUMPRECHT, E. ZUKOWSKA-SZCZECHOWSKA, and W. GRZESZCZAK
Polymorphisms in the Genes Encoding for Human Kinin Receptors and the Risk of End-Stage Renal Failure: Results of Transmission/DisequilibriumTest
J. Am. Soc. Nephrol., October 1, 1999; 10(10): 2120 - 2124.
[Abstract] [Full Text]


Home page
Nephrol Dial TransplantHome page
J. Deinum, L. Tarnow, J. M. van Gool, R. A. de Bruin, F. H. M. Derkx, M. A. D. H. Schalekamp, and H.-H. Parving
Plasma renin and prorenin and renin gene variation in patients with insulin-dependent diabetes mellitus and nephropathy
Nephrol. Dial. Transplant., August 1, 1999; 14(8): 1904 - 1911.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. B. S. Freire, L. Ji, T. Onuma, T. Orban, J. H. Warram, and A. S. Krolewski
Gender-Specific Association of M235T Polymorphism in Angiotensinogen Gene and Diabetic Nephropathy in NIDDM
Hypertension, April 1, 1998; 31(4): 896 - 899.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. J. Rogus, D. Moczulski, M. B. S. Freire, Y. Yang, J. H. Warram, and A. S. Krolewski
Diabetic Nephropathy Is Associated With AGT Polymorphism T235 : Results of a Family-Based Study
Hypertension, February 1, 1998; 31(2): 627 - 631.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Yanai, T. Saito, K. Hirota, H. Kobayashi, K. Murakami, and A. Fukamizu
Molecular Variation of the Human Angiotensinogen Core Promoter Element Located between the TATA Box and Transcription Initiation Site Affects Its Transcriptional Activity
J. Biol. Chem., November 28, 1997; 272(48): 30558 - 30562.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
P. Corvol and X. Jeunemaitre
Molecular Genetics of Human Hypertension: Role of Angiotensinogen
Endocr. Rev., October 1, 1997; 18(5): 662 - 677.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Doria, A.
Right arrow Articles by Krolewski, A. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Doria, A.
Right arrow Articles by Krolewski, A. S.