(Hypertension. 1996;27:1193-1199.)
© 1996 American Heart Association, Inc.
Articles |
Apparent Mineralocorticoid Excess
Genotype Is Correlated With Biochemical Phenotype
From the Department of Pediatrics, University of Texas Southwestern Medical Center, Dallas.
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract The syndrome of apparent mineralocorticoid excess is a form of hypertension inherited in an autosomal recessive manner. This disorder results from mutations in the HSD11K (HSD11B2) gene, which encodes the kidney isozyme of 11ß-hydroxysteroid dehydrogenase. This enzyme converts active glucocorticoids such as cortisol and corticosterone to their inactive metabolites cortisone and 11-dehydrocorticosterone. An elevated ratio of cortisol to cortisone metabolites in the urine (tetrahydrocortisol plus allotetrahydrocortisol to tetrahydrocortisone [(THF+aTHF)/THE]) is considered pathognomic for this disorder. To determine whether the biochemical phenotype of this disorder is correlated with genotype, we expressed enzymes carrying each of the six known missense mutations in cultured cells. Only one mutant, R337C, had detectable activity in cell lysates, but five of six mutants were partially active in whole cells. Apparent kinetic constants for cortisol and corticosterone were determined in whole cells, and the apparent first-order rate constant, Vmax/Km, was used as a measure of enzymatic activity. The urinary (THF+aTHF)/THE ratio in patients carrying each mutation was strongly correlated with in vitro enzymatic activity of the corresponding mutant (r=.839, P=.001 with cortisol as the substrate). We conclude that the biochemical phenotype of the syndrome of apparent mineralocorticoid excess is largely determined by genotype.
Key Words: steroids • mineralocorticoids • kidney • corticosterone • hypertension, genetic • hypertension, endocrine • molecular biology
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Apparent mineralocorticoid excess (AME) is a form of hypertension inherited in an autosomal recessive manner. It is characterized by signs of mineralocorticoid excess such as hypokalemia and suppressed renin activity although levels of aldosterone and other mineralocorticoids are very low. Biochemical and molecular genetic studies have demonstrated that this disorder results from deficiency of renal 11-HSD, an enzyme that converts active glucocorticoids such as cortisol and corticosterone to their inactive metabolites cortisone and 11-dehydrocorticosterone. Patients with AME excrete reduced amounts of cortisone metabolites such as THE in the urine compared with excretion of cortisol metabolites such as THF and aTHF. An elevated (THF+aTHF)/THE ratio is considered pathognomic for AME.1
There are two known isozymes of 11-HSD. The L or type 1 isozyme is expressed at high levels in the liver, uses NADP+ as an electron acceptor, and is reversible, catalyzing both dehydrogenation and reduction (conversion of cortisone to cortisol).2 3 The corresponding gene is unaffected in patients with AME.4 The K or type 2 isozyme is expressed at high levels in the kidney and placenta, uses NAD+, and catalyzes only dehydrogenation.5 6 The gene encoding this isozyme, HSD11K (or HSD11B2), is located on chromosome 16q22.7 Mutations in this gene have been documented in patients with AME8 9 10 ; most of these mutations have significant effects on enzymatic activity or mRNA splicing.8
Deficiency of 11-HSD causes hypertension because the mineralocorticoid receptor itself has identical affinities for glucocorticoids and mineralocorticoids.11 Under normal circumstances, 11-HSD expressed in renal distal tubules and cortical collecting ducts oxidizes cortisol to cortisone, which is not a ligand for the receptor. Aldosterone is not a substrate of this enzyme and is thus a much stronger mineralocorticoid agonist in vivo than cortisol.12 13 This protective mechanism is lost in patients with AME, so that cortisol, which normally circulates in amounts 100 to 1000 times higher than aldosterone, itself becomes a strong mineralocorticoid agonist. Thus, this disorder is best treated by measures such as a low sodium diet and blockade of the mineralocorticoid receptor with spironolactone.
Most inherited diseases vary in severity in a large part because of allelism at the affected locus. Although our previous study suggested that this might be the case in AME,8 it was difficult to make statistically significant correlations of genotype with phenotype because of the small number of patients and low levels of in vitro enzymatic expression. Therefore, we have now examined all known missense mutations using a cell line that permits higher levels of expression and have found that the degree of enzymatic compromise is indeed correlated with the biochemical severity of the disorder as measured by ratios of precursor to product.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Site-Directed Mutagenesis
Full-length human HSD11K cDNA was cloned in the expression vector pCMV514 (pCMV5-HSD) and mutagenized [R208C, R213C, R337
3nt (R337H/Y338), and L250P/L251S] as
previously described.8 Additional mutations (R186C and
R337C) were created by PCR15 with primers containing each
desired mutation (GGCCACTTTCTGTAGCTGCAT,
nucleotides 654-674 for R186C; and
GCCCGCCGCTGCTATTACCCC, nucleotides 1107-1128
for R337C). After subcloning into pCR II vector (Invitrogen Co), each
mutant insert was introduced into the Sfi I site of
pCMV5-HSD. The complete coding sequence of each construct was checked
to ensure that no undesirable mutations had been introduced by the PCR
process.
Transient Transfection and Assays of Enzymatic Activity
CHOP cells, a derivative of Chinese hamster ovary (CHO) cells
that has been transformed with polyoma virus (kindly provided by Dr
James Dennis),16 were grown in Ham's F-12 medium (GIBCO)
supplemented with 10% fetal bovine serum. Five micrograms of each
construct was transfected into 80% to 90% confluent CHOP cells in
60-mm dishes by the modified bovine serum system (Stratagene), and
enzymatic activity was assayed in whole cells or cell lysates after 20
hours.
For determination of apparent kinetics in intact mammalian cells, 0.9 to 1.2 nmol/L [3H]corticosterone with 3 to 1000 nmol/L unlabeled corticosterone or 4.4 to 7 nmol/L [3H]cortisol with 15.6 to 2000 nmol/L unlabeled cortisol was added. After 0.5 to 42 hours of incubation, culture medium was removed and extracted with methylene chloride. The conversion from corticosterone or cortisol to 11-dehydrocorticosterone or cortisone, respectively, was detected with a System 200 Imaging Scanner (Bioscan) after extracts had been subjected to silica thin-layer chromatography with a solvent mixture of chloroform/ethanol (92:8). Three independent experiments on different days were performed for the wild-type enzyme and R337C with cortisol as the substrate, and two such experiments for the other mutants. Measurements with corticosterone as a substrate were obtained in an independent transfection.
For assay of activity in cell lysates, the transfected cells were washed twice with phosphate-buffered saline, harvested, and kept frozen at -80°C for later processing. Cells were thawed and homogenized in 800 µL per dish (for wild-type) or 400 µL per dish (for R337C) of homogenizing buffer (50 mmol/L Tris-HCl, 0.25 mol/L sucrose, 2 mmol/L EDTA, 1 mmol/L MgCl2, 1 mmol/L dithiothreitol, pH 7.4) with a Dounce homogenizer. After brief sonication, lysates were centrifuged at 800g for 10 minutes to separate nuclei. Kinetic constants were determined by incubation of 50 µL supernatant for 1 hour at 37°C in 500 µL assay buffer (50 mmol/L Tris-HCl, 2 mmol/L EDTA, 1 mmol/L MgCl2, 1 mmol/L dithiothreitol, 20% glycerol, 0.4 mmol/L NAD+, pH 7.4) with 2.4 or 5.3 nmol/L 3H-labeled steroid and 1 to 100 nmol/L or 10 to 200 nmol/L unlabeled steroid (corticosterone or cortisol, respectively). Two independent experiments were performed for each substrate.
In all cases, incubations were carried out for different periods of time to ensure that the measurements represented initial rates.
Detection of Transcripts by Reverse Transcription–PCR
Total RNA was prepared from transfected CHOP cells with RNAzol B
(Biotecx). One microgram total RNA was treated with DNase I (GIBCO-BRL)
and reverse transcribed with 50 U Superscript II reverse transcriptase
(GIBCO-BRL) in a 10-µL reaction volume containing 2.5 mmol/L
hexamers, 1 mmol/L of each dNTP, 4 U placental RNase
inhibitor, 2.5 mmol/L of a 3'-primer (GCAGCCAGGCTGGATGATG,
complementary to nucleotides 882-900), and the
manufacturer's buffer. Each reaction was allowed to proceed at room
temperature for 10 minutes followed by incubation at 37°C for 1.5
hour. PCR was performed by addition of 0.5 mmol/L of a 5'-primer
(ACCAAGGCCCACACCACCAGC, nucleotides 562-582) to 2 µL of
reverse-transcribed samples in 67 mmol/L Tris-HCl (pH 8.5), 16
mmol/L (NH4)2SO4, 2 mmol/L
MgCl2, 17 µg/mL bovine serum albumin, and
5% glycerol. Samples were subjected to initial denaturation at 96°C
for 1 minute and 40 cycles of 96°C for 10 seconds, and 59°C for 30
seconds.
Immunoblot Analysis
Nuclear and 800g supernatant fractions from
transfected CHOP cells were subjected to immunoblot
analysis. Nuclei were washed twice with
homogenizing buffer before being dissolved in sample
buffer containing 1% sodium dodecyl sulfate. Aliquots of
lysates (protein amounts are indicated in figure legends) were
subjected to electrophoresis in a sodium dodecyl sulfate–10%
polyacrylamide gel. An anti-peptide serum highly specific
for human HSD11K residues 370-383 (HCLPRALQPGQPGT) was kindly provided
by Drs Jonathan R. Seckl and Roger Brown. Immunoblots were
performed at a 1/8000 dilution of HSD11K anti-peptide
serum as primary antibody with the Amersham ECL system and methods
recommended by the manufacturer (including use of donkey
anti-rabbit serum at 1/4000 dilution as the secondary
antibody).
Statistical Analysis
Kinetic constants were derived from two (whole cells) or three
(lysates) measurements of enzymatic activity at each of five to eight
different substrate concentrations. The StatView 4.0 program was used
for statistical analysis including regression coefficients.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Enzymatic Activity in Whole Cells
In the present study, we made use of CHOP cells, a derivative of CHO cells transformed with polyoma virus. When these cells are transfected with vectors such as pCMV5 that contain cytomegalovirus promoters, expression levels are several times higher than can be achieved in CHO cells (Reference 1616 and unpublished observations, 1995). We assayed enzymatic activity of the wild-type enzyme and of six previously reported mutants8 9 10 (Table 1
). We used reverse transcription–PCR to ensure
that approximately equal levels of mRNA were expressed in the various
transfectants. Four missense mutations (R186C, R208C, R213C, R337C)
retained measurable activity with cortisol used as a substrate. Both a
double missense mutation (L250P/L251S) and a
three-nucleotide deletion in codons 337-338 that
maintained the normal reading frame (R3373nt) abolished activity.
Corticosterone, although not the most
physiologically important glucocorticoid in
humans, is a better substrate for the enzyme, and R3373nt retained
measurable activity for this substrate.
|
By incubating cells with various concentrations of precursor steroids,
we could derive apparent kinetic constants; one set of determinations
is presented in Figs 1 and 2 and
Table 1
. With cortisol as a substrate, no mutation affected apparent
Km by more than approximately twofold;
when corticosterone was the substrate, two mutants, R208C and R213C,
had sixfold higher apparent Km values
than the wild-type enzyme. Comparing the enzymes by their apparent
first-order rate constants
(Vmax/Km),
mutant R337C retained 82% of normal activity for corticosterone and
53% of normal activity for cortisol. R186C retained 9% and 17% of
normal activity for these substrates, respectively. The other mutants
all had less than 4% of normal activity.
|
) and
R337C (
) were studied in separate experiments, and each has
its own wild-type control (
and 
, respectively). b,
Mutants with low activity
(Vmax/Km
<3% of wild-type). 
, R213C;
|
Enzymatic Activity in Cell Lysates
We attempted to determine kinetic constants in cell lysates to
minimize problems inherent with kinetic measurements in whole cells
such as uncertain transport of substrates and products. To maximize
the stability of normal and mutant enzymes, we conducted assays in
buffer containing 20% glycerol and for an incubation time of less than
1 hour. Under these conditions, kinetic constants could be obtained for
the wild-type enzyme and for R337C (one set of data is
presented in Table 2 and Fig 3);
other mutants were essentially inactive. The apparent
Km values obtained for the wild-type
enzyme were much lower than observed in whole cells but were similar to
those previously reported in cell lysates under comparable
conditions.17 R337C had considerably lower affinity for
both substrates (higher apparent Km
values) than the wild-type enzyme but had very similar apparent
Vmax values, so apparent first-order rate
constants were 37% (corticosterone) and 8% (cortisol) of those of the
wild-type enzyme.
|
|
Protein Immunoreactivity in Cellular Fractions
To determine whether any of the mutations affected subcellular
localization or stability of the enzyme, we measured immunoreactive
protein in nuclei and 800g supernatant fractions using an
anti-peptide serum generated against the carboxyl terminus of
HSD11K (Fig 4). The wild-type enzyme was found in
both the nuclear and supernatant fractions (in the latter fraction,
presumably in the endoplasmic reticulum), but it was preferentially
concentrated in nuclei. Less immunoreactivity was noted in lysates from
cells transfected with mutant enzymes in both the nuclear and
supernatant fractions. The decreases in immunoreactivity and enzymatic
activity were correlated; significant amounts of immunoreactivity could
be detected only in cells transfected with the most active mutants,
R337C and R186C.
|
Correlation of Genotype With Biochemical
Phenotype
We used the ratio of cortisol to cortisone metabolites in the
urine, (THF+aTHF)/THE, as a measure of the biochemical severity of AME
(Table 3). These values were all reported
previously.8 9 10 This ratio is normally 1.07±0.30 in
children aged 4 to 8 years.18 In making these comparisons,
we included an additional patient who carried other mutations (a
deletion and a frameshift) that were presumed to destroy enzymatic
activity.8 In patients with AME, the (THF+aTHF)/THE ratio
in each patient was correlated with the degree of impairment of
activity observed with the mutation or mutations carried by that
patient (Fig 5). The correlation was slightly better
when activity was assayed with cortisol as the substrate
(r=.839, P=.001) than with corticosterone as the
substrate (r=.669, P=.01).
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Effects of Mutations on Enzymatic Activity
It was of interest to see whether any relationships between structure and function could be identified by examining the effects of each mutation on enzymatic activity. The K isozyme of 11-HSD, like the L isozyme, is a short-chain alcohol dehydrogenase. A crystal structure has been elucidated for a related enzyme, 3
,20ß-hydroxysteroid dehydrogenase19 ; on the
basis of these data and mutagenesis of other short-chain
dehydrogenases,20 regions have been defined that bind the
nucleotide cofactor or are active in catalysis. Thus far,
no mutations in HSD11K have been identified in the
nucleotide binding domain. A deletion of the catalytic
domain was previously reported but it was presumed to yield an inactive
enzyme and was not analyzed further.8
Two of the mutations in the present study, R208C and R213C, lie
within a region homologous to a probable steroid binding domain in
3,20ß-hydroxysteroid dehydrogenase,19 and it was
therefore previously speculated that these mutations might affect
affinity of the enzyme for steroids.8 Consistent
with this hypothesis, enzymes with these mutations indeed have high
apparent Km values for corticosterone
when expressed in whole cells. However, apparent
Vmax is also affected, and moreover, these
mutations do not have a strong effect on the apparent
Km for cortisol. Thus, these mutations do
not affect steroid substrate binding in a straightforward way.
It is notable that both the normal enzyme and several of the mutants
are preferentially localized in the nucleus. This makes teleological
sense if the enzyme is to protect the mineralocorticoid receptor from
excessive concentrations of cortisol, given that this receptor acts in
the nucleus. We imagine that the presence of the enzyme in multiple
cellular compartments allows it to act as a multitiered defense system,
with most cortisol being oxidized in the endoplasmic reticulum and any
cortisol that does get through to the nucleus being destroyed by the
nuclear enzyme. It is not known what structural signal directs this
enzyme to the nucleus. Nuclear localization signals often consist of a
cluster of basic residues (arginine or lysine) in close proximity to a
helix-breaking residue such as proline or glycine.21
Such a region in HSD11K is residues 333-337 (RPRRR), and it
was therefore reasonable to speculate that the two mutations R337C and
R3373nt (R337H/Y338) might affect nuclear localization. Such an
effect was not observed, and the mechanisms by which these mutations
affect activity is not known.
All of the mutations in the present study are associated with decreased intensity on Western blots. The anti-peptide serum used to probe these blots recognizes an epitope that should not be affected by any of the mutations, and any changes in conformation induced by the mutations should be irrelevant in any case, considering that the proteins have been denatured in Western blots. Thus, the difficulty in detecting several of these mutants on Western blots might mean that the mutations alter the stability or cellular localization of the enzyme. Altered stability could occur in intact cells and be at least partly responsible for the decreased enzymatic activity observed for these mutants. Alternatively, it could be an artifact of cellular homogenization. The latter possibility is supported by the decreased enzymatic activity of all of the mutants (relative to the wild-type) in cell lysates compared with their activity in whole cells.
Comparisons With Previous Reports
We previously reported that several of these mutations affected
enzymatic activity in whole cells.8 Expression at higher
levels, permitting more quantitative analysis, has yielded
similar results in terms of the degree to which each mutation impairs
activity. Two of the mutations in the present study were first
reported by other researchers. One, R186C, was found in a kindred in
which we were previously unable to identify a mutation.10
We have reanalyzed this kindred using new aliquots of DNA
and have confirmed the presence of this mutation (unpublished
observations, 1995). We suspect that the previous sample we
analyzed was contaminated at some point during the PCR process
despite our routine use of measures to prevent such a problem. All
positive identifications of mutations in our previous study were
replicated on fresh aliquots of DNA before publication, so we therefore
have no reason to suspect any other inaccuracies in our previous
report. In any event, we now confirm that R186C does have significant
effects on enzymatic activity. Thus, mutations have been detected in
all AME patients analyzed thus far, and currently there is no
evidence for genetic heterogeneity of this syndrome.
R337C was first reported in a rapid publication in which
analysis of only one exon of the gene was
presented.9 Thus, the possibility of other
mutations in the gene has not been eliminated. An expression study of
this mutation using the identical system to that employed in the
present article was recently presented in a second rapid
publication.22 In whole cells, this mutation was reported
to increase apparent Km for cortisol more
than 10-fold, and it was also reported to abolish enzymatic activity in
cell lysates. These results are obviously somewhat different from those
in the present study. However, examination of the data in this
previous publication suggests some possible explanations for the
discrepancies. First, although R337C seemed to have a higher apparent
Km for cortisol when analyzed in
whole cells, it also had a much higher apparent
Vmax, so the apparent first-order
rate constant,
Vmax/Km,
of the mutant for cortisol was approximately 50% that of the
wild-type enzyme. This value is in excellent agreement with that
obtained in the present study. Second, the expression in cell
lysates in the previous study suggested that the wild-type enzyme
had an extremely high apparent Km value
for cortisol; when we examined these data (Fig 2 in Reference 2222 ) in a
double reciprocal plot, they yielded an apparent
Km for cortisol of 20 µmol/L, which is
several orders of magnitude higher than that found in the present
study. This suggests that there were significant problems with the
stability of even the normal enzyme in these experiments. The procedure
in the present study differs from that used previously in its
inclusion of glycerol in the lysis buffer; this agent has been shown to
stabilize partially active mutants both for cytochrome P450 enzymes
such as steroid 21-hydroxylase23 and for another
short-chain dehydrogenase, 3ß-hydroxysteroid
dehydrogenase.24
We feel that it is difficult to reliably measure apparent Km values in whole cells, as illustrated by the differences observed in the present study between the apparent Km values of the wild-type enzyme in whole cells and in cell lysates. However, measurements of relative enzymatic activities in whole cells as measured by apparent first-order rate constants may be of some value in drawing phenotype-genotype correlations, as discussed below. It should be kept in mind that such comparisons involve apparent kinetic constants; true kinetic constants can be determined only on purified enzymes. Altered stability of mutant enzymes may affect their apparent kinetic constants, although this should not decrease the validity of comparisons between the various mutants as long as their expression levels are similar.
Genotype Is Correlated With Phenotype
Most inherited disorders exhibit allelic variation. The
best-studied disorder of steroid metabolism is
congenital adrenal hyperplasia due to 21-hydroxylase deficiency, in
which allelism accounts for approximately 80% of observed individual
variations in both biochemical and clinical parameters of
severity.25
Although the number of patients with AME is small, sufficient data now exist to demonstrate a statistically significant correlation between the degree of enzymatic impairment and biochemical severity as measured by the ratio of precursor to product, (THF+aTHF)/THE. This correlation is most obvious for the partially active mutants. We assume in this analysis that R337C is the only significant mutation in the patients who carry it, even though only one exon of the gene was sequenced. If so, a 50% impairment of enzymatic activity is apparently sufficient to compromise cortisol metabolism in the kidney, suggesting that this organ has very little excess capacity to metabolize cortisol. This seems to raise a paradox, because AME is a recessive disorder, and heterozygous carriers, who would be expected to have 50% of normal activity, are asymptomatic. The same apparent paradox exists for 21-hydroxylase deficiency, which is also a recessive disorder; a clinically mild or nonclassic form of 21-hydroxylase deficiency is seen in individuals who are homozygous for mutations that are approximately 50% active when expressed in cultured cells.23 26 27 Altered stability or kinetic properties of the R337C mutant may be important, including alterations in enzyme inhibition by end product (ie, cortisone or corticosterone) or by other circulating steroids.
The widest range of (THF+aTHF)/THE ratios is seen in patients who carry mutations that apparently destroy enzymatic activity. This is not very surprising; small variations in the very low levels of cortisone metabolites (ie, THE) excreted by these patients will obviously lead to quite large differences in ratios in which this value is the denominator. It is possible that the normally low renal expression of the L isozyme of 11-HSD28 is sufficient to metabolize small amounts of cortisol when the K isozyme is absent. Thus, the relatively wide variations in the ratios of precursor to product seen in patients carrying inactive K isozymes may reflect differences in expression or activity of the L isozyme in the kidney. Alternatively, a small amount of dehydrogenation may be catalyzed by the L isozyme in the liver, even though the reaction in this organ is predominantly in the reductive direction.
Because of the small numbers of patients, and the possible confounding effects of prior antihypertensive therapy, it is difficult to correlate biochemical severity with measures of clinical severity. With the elucidation of the molecular genetic basis of this disorder, ascertainment of additional cases may permit these questions to be answered.
|
Selected Abbreviations and Acronyms |
|---|
|
|
Acknowledgments |
|---|
This work was supported by grant DK42169 from the National Institutes of Health, Bethesda, Md. We respectfully dedicate this article to the memory of our late colleague, Carl Monder. We thank James Dennis for CHOP cells, and Jonathan Seckl and Roger Brown for the antiserum to HSD11K.
|
Footnotes |
|---|
Reprint requests to Dr Perrin C. White, UT Southwestern Medical Center, 5323 Harry Hines Blvd, Dallas, TX 75235-9063. E-mail pwhit2@mednet.swmed.edu.
Received February 8, 1996; first decision March 1, 1996; accepted March 11, 1996.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Ulick S, Levine LS, Gunczler P, Zanconato G, Ramirez LC, Rauh W, Rosler A, Bradlow HL, New MI. A syndrome of apparent mineralocorticoid excess associated with defects in the peripheral metabolism of cortisol. J Clin Endocrinol Metab. 1979;49:757-764.
2.
Agarwal AK, Monder C, Eckstein B, White PC.
Cloning and expression of rat cDNA encoding
corticosteroid 11 beta-dehydrogenase.
J Biol Chem. 1989;264:18939-18943.
3.
Agarwal AK, Tusie-Luna MT, Monder C, White PC.
Expression of 11 beta-hydroxysteroid dehydrogenase using
recombinant vaccinia virus. Mol Endocrinol. 1990;4:1827-1832.
4. Nikkila H, Tannin GM, New MI, Taylor NF, Kalaitzoglou G, Monder C, White PC. Defects in the HSD11 gene encoding 11 beta-hydroxysteroid dehydrogenase are not found in patients with apparent mineralocorticoid excess or 11-oxoreductase deficiency. J Clin Endocrinol Metab. 1993;77:687-691. [Abstract]
5. Albiston AL, Obeyesekere VR, Smith RE, Krozowski ZS. Cloning and tissue distribution of the human 11-HSD type 2 enzyme. Mol Cell Endocrinol. 1994;105:R11-R17. [Medline] [Order article via Infotrieve]
6.
Agarwal AK, Mune T, Monder C, White PC.
NAD+-dependent isoform of 11 beta hydroxysteroid dehydrogenase: cloning
and characterization of cDNA from sheep kidney. J
Biol Chem. 1994;269:25959-25962.
7. Agarwal AK, Rogerson FM, Mune T, White PC. Gene structure and chromosomal localization of the human HSD11K gene encoding the kidney (type 2) isozyme of 11ß-hydroxysteroid dehydrogenase. Genomics. 1995;29:195-199. [Medline] [Order article via Infotrieve]
8. Mune T, Rogerson FM, Nikkila H, Agarwal AK, White PC. Human hypertension caused by mutations in the kidney isozyme of 11 beta-hydroxysteroid dehydrogenase. Nat Genet. 1995;10:394-399. [Medline] [Order article via Infotrieve]
9. Wilson RC, Krozowski ZS, Li K, Obeyesekere VR, Razzaghy-Azar M, Harbison MD, Wei JQ, Shackleton CH, Funder JW, New MI. A mutation in the HSD11B2 gene in a family with apparent mineralocorticoid excess. J Clin Endocrinol Metab. 1995;80:2263-2266. [Abstract]
10. Wilson RC, Harbison MD, Krozowski ZS, Funder JW, Shackleton CH, Hanauske-Abel HM, Wei JQ, Hertecant J, Moran A, Neiberger RE, Balfe JW, Fattah A, Daneman D, Licholai T, New MI. Several homozygous mutations in the gene for 11ß-hydroxysteroid dehydrogenase type 2 in patients with apparent mineralocorticoid excess. J Clin Endocrinol Metab. 1995;80:3145-3150. [Abstract]
11.
Arriza JL, Weinberger C, Cerelli G, Glaser TM, Handelin
BL, Housman DE, Evans RM. Cloning of human mineralocorticoid
receptor complementary DNA: structural and functional kinship with the
glucocorticoid receptor. Science. 1987;237:268-275.
12.
Funder JW, Pearce PT, Smith R, Smith AI.
Mineralocorticoid action: target tissue specificity is enzyme, not
receptor, mediated. Science. 1988;242:583-585.
13. Edwards CR, Stewart PM, Burt D, Brett L, McIntyre MA, Sutanto WS, de Kloet ER, Monder C. Localisation of 11 beta-hydroxysteroid dehydrogenase: tissue specific protector of the mineralocorticoid receptor. Lancet. 1988;2:986-989. [Medline] [Order article via Infotrieve]
14.
Andersson S, Bishop RW, Russell DW. Expression
cloning and regulation of steroid 5 alpha-reductase, an enzyme
essential for male sexual differentiation. J
Biol Chem. 1989;264:16249-16255.
15. Higuchi R. Recombinant PCR. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR Protocols. San Diego, Calif: Academic Press; 1990:177-183.
16.
Heffernan M, Dennis JW. Polyoma and hamster
papovavirus large T antigen-mediated replication of expression
shuttle vectors in Chinese hamster ovary cells. Nucleic
Acids Res. 1991;19:85-92.
17. Albiston AL, Obeyesekere VR, Smith RE, Krozowski ZS. Cloning and tissue distribution of the human 11 beta-hydroxysteroid dehydrogenase type 2 enzyme. Mol Cell Endocrinol. 1994;105:R11-R17.
18. Monder C, White PC. 11 beta-hydroxysteroid dehydrogenase. Vitam Horm. 1993;47:187-271. [Medline] [Order article via Infotrieve]
19.
Ghosh D, Weeks CM, Grochulski P, Duax WL, Erman M,
Rimsay RL, Orr JC. Three-dimensional structure of holo 3
alpha,20 beta-hydroxysteroid dehydrogenase: a member of a
short-chain dehydrogenase family. Proc Natl Acad Sci
U S A. 1991;88:10064-10068.
20. Obeid J, White PC. Tyr-179 and Lys-183 are essential for enzymatic activity of 11 beta-hydroxysteroid dehydrogenase. Biochem Biophys Res Commun. 1992;188:222-227. [Medline] [Order article via Infotrieve]
21. Newmeyer DD. The nuclear pore complex and nucleocytoplasmic transport. Curr Opin Cell Biol. 1993;5:395-407. [Medline] [Order article via Infotrieve]
22. Obeyesekere VR, Ferrari P, Andrews RK, Wilson RC, New MI, Funder JW, Krozowski ZS. The R337C mutation generates a high Km 11ß-hydroxysteroid dehydrogenase type II enzyme in a family with apparent mineralocorticoid excess. J Clin Endocrinol Metab. 1995;80:3381-3383. [Abstract]
23.
Tusie-Luna MT, Traktman P, White PC.
Determination of functional effects of mutations in the steroid
21-hydroxylase gene (CYP21) using recombinant vaccinia virus.
J Biol Chem. 1990;265:20916-20922.
24.
Simard J, Rheaume E, Sanchez R, Laflamme N, de Launoit
Y, Luu-The V, van Seters AP, Gordon RD, Bettendorf M, Heinrich U,
Moshang T, New MI, Labrie F. Molecular basis of congenital
adrenal hyperplasia due to 3 beta-hydroxysteroid dehydrogenase
deficiency. Mol Endocrinol. 1993;7:716-728.
25. Speiser PW, Dupont J, Zhu D, Serrat J, Buegeleisen M, Tusie-Luna MT, Lesser M, New MI, White PC. Disease expression and molecular genotype in congenital adrenal hyperplasia due to 21-hydroxylase deficiency. J Clin Invest. 1992;90:584-595.
26.
Helmberg A, Tusie-Luna MT, Tabarelli M, Kofler R, White
PC. R339H and P453S: CYP21 mutations associated with nonclassic
steroid 21-hydroxylase deficiency that are not apparent gene
conversions. Mol Endocrinol. 1992;6:1318-1322.
27.
Tusie-Luna MT, Speiser PW, Dumic M, New MI, White
PC. A mutation (Pro-30 to Leu) in CYP21 represents a
potential nonclassic steroid 21-hydroxylase deficiency
allele. Mol Endocrinol. 1991;5:685-692.
28.
Tannin GM, Agarwal AK, Monder C, New MI, White
PC. The human gene for 11 beta-hydroxysteroid dehydrogenase:
structure, tissue distribution, and chromosomal localization.
J Biol Chem. 1991;266:16653-16658.
This article has been cited by other articles:
 |
|
 |
|
  A. G. Atanasov, I. D. Ignatova, L. G. Nashev, B. Dick, P. Ferrari, F. J. Frey, and A. Odermatt Impaired Protein Stability of 11beta-Hydroxysteroid Dehydrogenase Type 2: A Novel Mechanism of Apparent Mineralocorticoid Excess J. Am. Soc. Nephrol., April 1, 2007; 18(4): 1262 - 1270. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Draper and P. M Stewart 11{beta}-Hydroxysteroid dehydrogenase and the pre-receptor regulation of corticosteroid hormone action J. Endocrinol., August 1, 2005; 186(2): 251 - 271. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Mune, H. Murase, N. Yamakita, T. Fukuda, M. Murayama, A. Miura, T. Suwa, J. Hanafusa, H. Daido, H. Morita, et al. Eutopic Overexpression of Vasopressin V1a Receptor in Adrenocorticotropin-Independent Macronodular Adrenal Hyperplasia J. Clin. Endocrinol. Metab., December 1, 2002; 87(12): 5706 - 5713. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Kataoka, A. Kudo, H. Hirano, H. Kawakami, T. Kawano, E. Higashihara, H. Tanaka, F. Delarue, J.-D. Sraer, T. Mune, et al. 11{beta}-Hydroxysteroid Dehydrogenase Type 2 Is Expressed in the Human Kidney Glomerulus J. Clin. Endocrinol. Metab., February 1, 2002; 87(2): 877 - 882. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Odermatt, B. Dick, P. Arnold, T. Zaehner, V. Plueschke, M. N. Deregibus, H. Repetto, B. M. Frey, F. J. Frey, and P. Ferrari A Mutation in the Cofactor-Binding Domain of 11{beta}-Hydroxysteroid Dehydrogenase Type 2 Associated with Mineralocorticoid Hypertension J. Clin. Endocrinol. Metab., March 1, 2001; 86(3): 1247 - 1252. [Abstract] [Full Text]
|
|
|
|
 |
|
 N. Farman and M.-E. Rafestin-Oblin Multiple aspects of mineralocorticoid selectivity Am J Physiol Renal Physiol, February 1, 2001; 280(2): F181 - F192. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Stokes, J. Noble, L. Brett, C. Phillips, J. R. Seckl, C. O’Brien, and R. Andrew Distribution of Glucocorticoid and Mineralocorticoid Receptors and 11{beta}-Hydroxysteroid Dehydrogenases in Human and Rat Ocular Tissues Invest. Ophthalmol. Vis. Sci., June 1, 2000; 41(7): 1629 - 1638. [Abstract] [Full Text]
|
|
|
|
 |
|
 A. Odermatt, P. Arnold, A. Stauffer, B. M. Frey, and F. J. Frey The N-terminal Anchor Sequences of 11beta -Hydroxysteroid Dehydrogenases Determine Their Orientation in the Endoplasmic Reticulum Membrane J. Biol. Chem., October 1, 1999; 274(40): 28762 - 28770. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. S. Nunez, F. M. Rogerson, T. Mune, Y. Igarashi, Y. Nakagawa, G. Phillipov, A. Moudgil, L. B. Travis, M. Palermo, C. Shackleton, et al. Mutants of 11{beta}-Hydroxysteroid Dehydrogenase (11-HSD2) With Partial Activity : Improved Correlations Between Genotype and Biochemical Phenotype in Apparent Mineralocorticoid Excess Hypertension, October 1, 1999; 34(4): 638 - 642. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Morineau, J.-M. Marc, A. Boudi, H. Galons, M. Gourmelen, P. Corvol, L. Pascoe, and J. Fiet Genetic, Biochemical, and Clinical Studies of Patients With A328V or R213C Mutations in 11{beta}HSD2 Causing Apparent Mineralocorticoid Excess Hypertension, September 1, 1999; 34(3): 435 - 441. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Palermo, M. Cossu, and C. H.L. Shackleton Cure of Apparent Mineralocorticoid Excess by Kidney Transplantation N. Engl. J. Med., December 10, 1998; 339(24): 1787 - 1788. [Full Text]
|
|
|
|
 |
|
 S. H.M. van Uum, A. R.M.M. Hermus, P. Smits, T. Thien, and J. W.M. Lenders The role of 11{beta}-hydroxysteroid dehydrogenase in the pathogenesis of hypertension Cardiovasc Res, April 1, 1998; 38(1): 16 - 24. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. E. Smith, L. A. Salamonsen, P. A. Komesaroff, K. X. Z. Li, K. M. Myles, M. Lawrence, and Z. Krozowski 11{beta}-Hydroxysteroid Dehydrogenase Type II in the Human Endometrium: Localization and Activity during the Menstrual Cycle J. Clin. Endocrinol. Metab., December 1, 1997; 82(12): 4252 - 4257. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. C. White, T. Mune, and A. K. Agarwal 11{beta}-Hydroxysteroid Dehydrogenase and the Syndrome of Apparent Mineralocorticoid Excess Endocr. Rev., February 1, 1997; 18(1): 135 - 156. [Abstract] [Full Text]
|
|
|
|
|
|
P. C. White Inherited Forms of Mineralocorticoid Hypertension Hypertension, December 1, 1996; 28(6): 927 - 936. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||