(Hypertension. 1996;27:1224-1233.)
© 1996 American Heart Association, Inc.
Articles |
Multiple Enhancer Elements Mediate Induction of c-fos in Vascular Smooth Muscle Cells
From the Department of Medicine, Division of Cardiology (Y.-Q.C., D.M.G., B.R.), and Department of Pharmacology (A.J.N.), Vanderbilt University, Nashville, Tenn.
Correspondence to Allen J. Naftilan, MD, PhD, Department of Medicine, Division of Cardiology, Room 315 MRB II, Vanderbilt University, Nashville, TN 37232-2170. E-mail naftila@macpost.vanderbilt.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract Previous work from this and other laboratories has demonstrated that the vasoconstrictor peptide angiotensin II results in hypertrophy of rat aortic smooth muscle cells that is associated with an increase in transcription of the early growth response gene c-fos. To explore the molecular mechanism responsible for c-fos induction in rat aortic smooth muscle cells, we used a series of reporter constructs linked to the chloramphenicol acetyl transferase gene in transient transfection experiments in rat aortic smooth muscle cells. Constructs containing both the serum response element and cAMP response element exhibited a 20-fold increase in chloramphenicol acetyl transferase activity in response to either serum or angiotensin II, whereas no increase was seen in vehicle-treated cells. Mutations in either the serum response element or cAMP response element alone, which have been demonstrated to inactivate these elements in other cell types, had no effect on chloramphenicol acetyl transferase inducibility. In contrast, if both elements were mutated, inducibility was almost abolished. Electrophoretic mobility shift assays with oligonucleotides corresponding to either serum response element or cAMP response element demonstrated that these oligonucleotides are capable of forming specific complexes with proteins from rat aortic smooth muscle cell nuclear extracts. One of the proteins binding to the serum response element is the previously described serum response factor, since it was supershifted by a monospecific antibody. These studies demonstrate that c-fos induction in smooth muscle occurs by a dual mechanism that can activate transcription via the serum response element or cAMP response element. These elements appear to act equally and independently, involving a distinct set of transacting factors.
Key Words: angiotensin II • c-fos • muscle, smooth, vascular • genetics
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The abnormal proliferation of vascular smooth muscle cells is an important component in a wide variety of cardiovascular conditions. In hypertension, one of the major pathological consequences of an elevation in blood pressure is an increase in the mass of the smooth muscle layer surrounding the vascular wall. This has been attributed to either vascular smooth muscle hypertrophy, hyperplasia, or remodeling, depending on the vascular bed studied and the methods used to study it.1 2 3 4 The vascular smooth muscle cell is also an important component of the early atherosclerotic plaque,5 and abnormal proliferation of medial smooth muscle cells appears to be a major cause of the restenosis seen after balloon arterial injury.6 7 8 Despite accumulating data on the anatomy of the vascular smooth muscle cell changes that occur, the factor or factors that initiate and perpetuate these changes are largely unknown. One factor that may play a critical role is the vasoactive peptide Ang II. Both in vivo and in vitro data suggest that Ang II can stimulate the growth of vascular smooth muscle cells.3 4 9 10 11 In rats, treatment with angiotensin-converting inhibitors or specific Ang II receptor antagonists prevents the increase in smooth muscle cell mass seen with the development of hypertension3 11 or after carotid artery balloon injury.12 13 14 15 Treatment of experimental animals with converting enzyme inhibitors has also been demonstrated to prevent the progression and cause regression of atherosclerosis.16 17 18 In vitro, addition of Ang II to cultured RASM cells results in an increase in cell size and protein synthesis, with no or little increase in DNA synthesis,9 10 a finding that mimics the smooth muscle hypertrophy seen in the thoracic aorta of hypertensive animals.3 11 Further evidence for a role of Ang II in vascular smooth muscle cell growth in vivo was recently provided by Morishita et al,19 who reported that gene transfer of angiotensin-converting enzyme into a rat carotid artery resulted in an increase in DNA synthesis and vascular DNA content. This effect was blocked by the specific Ang II antagonist DuP 753, providing further support for a role of Ang II in vascular smooth muscle cell growth.
One of the earliest responses seen when resting, quiescent cells are treated with a growth-promoting agent is the induction of a set of genes termed the immediate early genes.20 Among the best characterized of these are the proto-oncogenes c-fos, c-jun, and c-myc.21 22 In recent years, we and others have reported that the addition of Ang II to quiescent vascular smooth muscle cells in culture results in the rapid induction of the early growth response genes c-fos, c-jun, and c-myc.23 24 25 26 We have further demonstrated that this induction does not depend on new protein synthesis, and use of a nuclear run-off transcription assay demonstrated that Ang II results in the rapid transcriptional induction of these genes.23 Since numerous reports have demonstrated that blockade of c-fos induction by either antisense DNA or c-fos antibodies blocks the increase in cell growth in a number of cell types,27 28 29 30 we began to investigate the significance of and molecular mechanisms for c-fos induction in vascular smooth muscle cells. The c-fos promoter contains multiple enhancer elements located upstream of the transcriptional start site, but there are two major inducible elements, the SRE and CRE.31 32 33 34 35 The SRE is located approximately 300 bp upstream of the transcriptional start site and has been demonstrated to be sufficient and necessary for the induction of c-fos by serum, peptide growth factors, and phorbol esters in a number of cell types.33 34 35 The transcription factor SRF binds to the SRE as a ternary complex with an accessory factor, p62TCF.36 37 38 39 40 41 SRF is required for c-fos induction in fibroblasts, as injection of anti-SRF antibodies blocks c-fos induction.42 43 The CRE is located approximately 65 bp upstream of the transcriptional start site and is the major element responsible for c-fos induction by cAMP or calcium, although other, weaker CRE-like sequences also have some activity.31 32
In this study, we demonstrate that c-fos induction in vascular smooth muscle cells by either Ang II or serum occurs by an interaction with either the SRE or CRE and further demonstrate that SRF is involved in the interaction with the SRE. These elements appear to act equally but independently to induce c-fos in smooth muscle cells. These findings should help provide a better understanding of the molecular mechanisms involved in early gene activation and growth of vascular smooth muscle cells.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
RASM Cell Culture and Transient Transfection Assay
RASM cells were isolated as described previously23 24 25 and maintained in culture in Dulbecco's modified Eagle's medium (DMEM) with 10% fetal calf serum, 100 U/mL penicillin, 100 µg/mL streptomycin, and 25 mmol/L HEPES. For these experiments, cells in subculture 6 through 16 were used. The cells were identified as smooth muscle cells by both appearance and positive fibrillar staining with a smooth muscle–specific
-actin
antibody (Boehringer Mannheim). For transient transfection
experiments, cells were seeded in 100-mm dishes at a density of
5x105 cells. The following morning, they were transfected
with the (diethylamino)ethyl-dextran method,25 with 5
µg of the c-fos–CAT construct and 4 µg of the plasmid
pMVS–ß-galactosidase, which contains the Lac Z gene under
control of the Moloney sarcoma virus long-terminal repeat. In
preliminary experiments and all subsequent studies, this vector never
demonstrated any response to either Ang II or serum (data not shown).
After an overnight incubation, the medium was replaced with serum
starvation medium (DMEM containing
5x10-7 mol/L insulin, 5 µg/mL
transferrin, and 0.2 mmol/L ascorbic acid) for 48 hours. This medium
has been demonstrated to maintain smooth muscle cells in a quiescent,
noncatabolic state for at least 72 hours.44 The cells were
then treated with either Ang II dissolved in 20 mmol/L acetic acid at a
concentration of 2 mg/mL (final concentration,
10-5 mol/L), fetal calf serum (final
concentration, 10%), or vehicle (20 mmol/L acetic acid). Six hours
later, the cells were harvested, and protein was extracted as
described.23 25 Protein concentration was measured by the
method of Bradford,45 and CAT activity was measured in
equal amounts of protein by the two-layer diffusion
method.46 A 30-µL sample of the extract was used for
determination of ß-galactosidase activity by a
colorimetric assay.47 CAT activity was
corrected for ß-galactosidase activity and is presented
as corrected counts per minute. For calculation of relative fold
induction, the CAT activity seen with PCB 56, which contains just the
c-fos minimal promoter and no enhancer elements, was
subtracted from the CAT levels of the other plasmids. Fold induction
was then calculated from this baseline value.
Plasmids
The following plasmids were kind gifts of Dr Michael Gilman,
Cold Spring Harbor Laboratory (Cold Spring Harbor, NY): p301-356wt,
containing c-fos sequences -356 to +109 fused to the
CAT gene; p301-356pm12, identical to p301-356 except containing a
mutation in the SRE CArG box; p301-151, containing c-fos
sequences from -151 to +109 fused to the CAT gene;
p301-151/wtSRE, a derivative of p301-151 containing a wild-type SRE
oligonucleotide cloned immediately upstream of the
-151 site; p301-151/pm12SRE, containing an SRE
oligonucleotide with a mutant CArG box cloned
immediately upstream of the -151 site; p301-71, containing
c-fos sequences from -71 to +109 fused to the CAT
gene; p301-71pm3, identical to p301-71 except containing a mutation in
the CRE; and p301-56, containing c-fos sequences from
-56 to +109 fused to the CAT gene. For ease of future mutations,
the portions of all of these vectors containing the c-fos
elements were removed as Sal I–Xba I fragments
and cloned into the Sal I and Xba I sites in the
multiple cloning region of the pCAT-Basic plasmid (Promega) and are
designated as PCB vectors. They are thus identical to the original PM
vectors, except for the plasmid backbone. Further mutations in either
the ets site, the SRE CArG box, or CRE were made with the
Altered Sites in vitro mutagenesis kit (Promega). All subclonings and
mutations were checked by restriction enzyme mapping and direct
sequencing. The sequences of the SRE and CRE and the mutations in the
CArG box, ets site, and CRE are shown in Fig 3
.
|
Preparation of Nuclear Extracts
Nuclear extracts were prepared from RASM cells that were made
quiescent for 48 hours as described above. The cells were then treated
with Ang II (final concentration, 10-5
mol/L) or vehicle (20 mmol/L acetic acid) for 30 minutes and harvested
by scraping in ice-cold phosphate-buffered saline. The cell
pellet was suspended in buffer A containing 10 mmol/L HEPES (pH 7.9),
10 mmol/L KCl, 0.1 mmol/L EDTA, 1 mmol/L dithiothreitol, 0.1% NP-40,
and 0.5 mmol/L phenylmethylsulfonyl fluoride (PMSF) and was
incubated at 4°C for 15 minutes. The nuclear pellet was collected by
centrifugation at 12 000 rpm for 20 seconds;
resuspended in buffer B containing 20 mmol/L HEPES (pH 7.9), 10 mmol/L
EDTA, 0.42 mol/L NaCl, 1 mmol/L dithiothreitol, and 1 mmol/L PMSF; and
incubated for 15 minutes at 4°C. The nuclear debris was removed by
centrifugation at 12 000 rpm for 10 minutes. The
supernatant was aliquoted, quick-frozen in a dry ice–ethanol
bath, and stored at -70°C. Protein concentration was determined
by the method of Bradford45 and averaged 2 mg/mL. HeLa and
NIH3T3 cells were maintained in DMEM with 10% fetal bovine serum and
10% calf serum, respectively. NIH3T3 cells were serum deprived in
0.4% calf serum for 48 hours, treated with Ang II or vehicle for 30
minutes, and harvested, and extracts were made as described above. HeLa
cells were not serum deprived, and extracts were made as described
above. Protein concentrations of the extracts averaged 2 mg/mL.
Oligonucleotides
The following oligonucleotides were used.
SRE wild-type, sense:
GATCCTACACAGGATGTCCATATTAGGACATCTGCGTCAGCAGGA; SRE wild-type,
antisense: GATCTCCTGCTGACGCAGATGTCCTAATATGGACATCCTGTGTAG; SRE mutant
CArG, sense: GATCCTACACAGGAGGTGGATATTACCACATCTGCGTCAGCAGGA; SRE
mutant CArG, antisense:
GATCTCCTGCTGACGCAGATGTGGTAATATCCACATCCTGTGTAG; SRE mutant ets,
sense: GATCCTACAACTCATGTCCATATTAGGACATCTGCGTCAGCAGGA; SRE
mutant ets, antisense: GATCTCCTGCTGACGCAGATGTCCTAATATGGACATGAGTTGTAG;
CRE wild-type, sense: GATCCAGTTCCGCCCAGTGACGTAGGAAGAAGACCATC;
CRE wild-type, antisense: GATCGATGGACTTCCTACGTCACTGGGCGGAACTG;
mutant CRE, sense: GATCCAGTTCCGCCCACTCAGCTAGGAAGTCCATC; and mutant CRE,
antisense: GATCGATGGACTTCCTAGCTGAGTGGGCGGAACTG. All were purchased from
Keystone Laboratories. Annealing was performed with 10 µg of each
complementary oligonucleotide in 100 µL final volume
in a buffer containing 50 mmol/L Tris-HCl (pH 7.5), 50 mmol/L NaCl, and
1 mmol/L EDTA. The mixture was boiled for 5 minutes and allowed to cool
slowly to room temperature over 45 to 60 minutes. For gel shift assays,
200 ng double-stranded oligonucleotide was labeled
with [
-32P]ATP (6000 Ci/[mmol/L], NEN), and T4
polynucleotide kinase. Unincorporated
nucleotides were removed by Sephadex G50
chromatography. The concentration of labeled
oligonucleotide averaged 1 µg/mL at a specific
activity of approximately 5x107 to 10x107
cpm/µg.
Gel Mobility Shift Assays
Gel mobility shift assays were conducted on 4%
acrylamide gels with a buffer containing 50 mmol/L Tris (pH
8.5), 0.38 mol/L glycine, 2 mmol/L EDTA, and 0.5 mmol/L
ß-mercaptoethanol. Reactions were carried out in a 20-µL volume
containing 10 mmol/L HEPES (pH 7.5), 60 mmol/L KCl, 5 mmol/L
MgCl2, 1 mmol/L EDTA, 1 mmol/L dithiothreitol, 6%
glycerol, 1 µg poly(dI-dC)–poly(dI-dC), and 3 to 6 µg nuclear
extract. The mixture was incubated at room temperature for 10 minutes
and then 10 000 cpm of 32P-labeled double-stranded
oligonucleotides (0.1 to 0.6 ng) was added. After an
additional incubation for 10 minutes at room temperature, the samples
were electrophoresed at 200 V at 4°C for 2 to 3 hours. The gel was
dried and exposed to Kodak X-AR film. For cold competition experiments,
0.2 to 0.6 µg cold double-stranded
oligonucleotide was added to the initial incubation
mixture. For shift-shift experiments, 0.1, 0.5, or 1.0 µL of
anti-SRF antibody48 (a gift of Dr Ron Prywes, Columbia
University, New York, NY) or 2 µg anti–cyclic acid response
element binding protein (CREB-1) C-21 antibody (Santa Cruz
Biotechnology) was added to the reaction mixture. As a positive control
for the experiments with the CREB-1 antibody, a recombinant polypeptide
corresponding to amino acids 254 through 327 of CREB-1 was purchased
from Santa Cruz Biotechnology.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Mapping the c-fos Responsive Elements in RASM Cells
The enhancer elements responsible for the induction of c-fos in RASM cells were localized with transient transfection assays. A schematic of the c-fos 5'-flanking region and the described enhancer elements are shown in Fig 1
. A large series of plasmids was used for
identification of the c-fos responsive elements in RASM
cells (shown in Fig 2). The parent plasmid, PCB 356,
contains base pairs -356 to +109 of the mouse c-fos
gene inserted upstream of the CAT gene. As seen, it contains all of the
major described c-fos regulatory sequences, but only the ets
site and CArG box, which comprise the SRE, and the CRE at position
-65 are shown. Mutations in the ets site, CArG box, or CRE are
indicated by an X. The wild-type SRE and CRE and the mutant
sequences are shown in Fig 3
. All of these mutations
have been reported in the literature to inactivate the
respective enhancer element.31 32 33 34 35
|
|
The results of the transient transfection assays are shown in Fig 4. All experiments were repeated a minimum of six times,
and results are shown as mean±SE. Results were compared with
Student's t test for unpaired samples. The addition of
either Ang II or serum to RASM cells transfected with PCB 356 resulted
in a 20- to 30-fold increase in CAT activity when corrected to the
levels achieved with PCB 56, which contains no enhancer elements.
Deletion of the sequences between -356 and -151 resulted in
a small, not significant decrease in CAT inducibility. Addition of a
wild-type SRE oligo upstream of the -151 site resulted in a
return of full inducibility, but addition of mutant CArG SRE did not.
Removal of sequences between -151 and -71 resulted in a
small, not significant decrease in CAT inducibility, and inducibility
of -71 was significantly less than that seen with PCB 356. In
most cell types, mutations in the CArG box abolish c-fos
inducibility, but as seen, mutations in either the CArG box (PCB
356mutCArG), the ets binding site (PCB 356mutets), or both (PCB
356mutCArG/ets) had no effect. If the PCB 356mutCArG plasmid was used
in NIH3T3 cells, however, inducibility by serum was abolished (data not
shown). Since Ang II can increase intracellular calcium, the CRE
enhancer element at -65 may well be involved, so it was mutated
as shown in Fig 3. As seen in Fig 4, there was a small, not significant
decrease in inducibility with the PCB 356mutCRE plasmid. The levels of
inducibility with PCB 356mutCRE were similar to those seen with PCB
356mutCArG and PCB 356mutCArG/ets.
|
These experiments revealed that multiple enhancer elements may be able
to mediate c-fos induction in RASM cells. To test this
possibility, we constructed plasmids that contained mutations in the
CArG box and CRE (PCB 356mutCArG/CRE) or in the CArG box, ets site, and
CRE (PCB 356mutCArG/ets/CRE). As seen in Fig 4, either of these
mutations decreased inducibility almost to the level of PCB 56, which
contains only the c-fos minimal promoter and no enhancer
elements. A similar lack of inducibility is seen in the PCB 71mutCRE
plasmid, which contains only the CRE located at -65. These
results indicate that c-fos can be induced in RASM cells by
two enhancer elements, either the SRE or the CRE. Also, there is no
evidence that any other enhancer element, such as the serum inducible
element (SIE), activator protein-1 (AP-1) sites, or other
CRE elements, plays a significant role in c-fos inducibility
in RASM cells by either Ang II or serum.
Gel Mobility Shift Assays With the SRE and CRE
We examined the identity of the protein or proteins that interact
with both the SRE and CRE sites in the c-fos gene using gel
mobility shift assays. Nuclear extracts were prepared from RASM cells
that were made quiescent for 48 hours as described above. The
oligonucleotides used in the gel shifts and the
mutations are shown in Fig 3. Gel mobility shift assays were conducted,
and the results with the SRE oligonucleotides are shown
in Fig 5. The top panel is with vehicle-treated
extract and the bottom with Ang II–treated extract. In both panels,
lane 1 is free probe, lanes 2 through 5 are 32P-labeled
wild-type SRE, lanes 6 through 9 are 32P-labeled SRE
with a mutated CArG box (mutCArG SRE), and lanes 10 through 13 are
32P-labeled SRE with a mutated ets site (mutets SRE). As
seen in lane 2 (top and bottom), both control and Ang II nuclear
extracts bind at least two proteins (upper two arrows). Both bands are
specific since excess cold wild-type
oligonucleotide effectively prevented complex formation
(lane 3). The CArG box is critical for this binding, as cold oligo with
a mutated CArG box does not compete for binding (lane 4), and the
32P–mutCArG SRE does not demonstrate specific binding to
these two proteins (lane 6). The ets site does not appear to be
involved in the binding of these two proteins, as cold oligo with a
mutant ets site effectively competed for binding of the proteins (lane
5), and the 32P–mutets SRE demonstrated the same pattern
of binding as the wild-type oligo (compare lanes 2 through 5 with
10 through 13). It is also clear that no induction of these proteins
was detected by the gel shift assay, as there is no difference between
the binding pattern seen with vehicle- and Ang II–treated nuclear
extracts (compare top and bottom panels). To test whether one of the
binding proteins is SRF, we conducted a supershift assay with an
affinity purified polyclonal antibody to SRF specific for
SRF.48 As seen in Fig 6, with increasing
amounts of antibody (lanes 1 through 4), both upper bands are
supershifted, indicating that SRF is a component of this complex. No
effect on the band pattern was seen with normal rabbit serum.
|
|
To compare the proteins that bind to the SRE in RASM cells with other
cell types that have been shown to induce c-fos via an
interaction with the SRE,33 34 35 we performed gel shifts
with RASM, HeLa, and NIH3T3 cell nuclear extracts. As seen in Fig 7, the pattern of protein binding to the SRE is
different in RASM, NIH3T3, and HeLa cells. In lanes 2 through 4, the
typical binding pattern of RASM cell extracts to the wild-type SRE
or mutant ets SRE oligonucleotides is seen.
Again, no binding is seen to the mutCArG SRE
oligonucleotide. A similar pattern of binding to either
the wild-type or mutets SRE but not the mutCArG SRE is seen in
NIH3T3 (lanes 4 through 9) and HeLa (lanes 10 through 12) cell
extracts. As with RASM cells, no difference is seen in NIH3T3 extracts
compared with extracts from control or Ang II–treated cells. Since
HeLa cells do not have Ang II receptors, only control cells were used.
If the positions of the retarded bands are compared, however, it
appears that RASM and NIH3T3 cells perhaps share a common protein
(compare lanes 2 and 4), but the slower migrating band is different.
Also, the upper band in NIH3T3 cells appears to bind to the ets site
because it is not seen when the mutant ets
oligonucleotide is used (lanes 7 and 10). The pattern
of retarded bands in HeLa cells is entirely different from that in the
other two cell types. It is also possible that the difference in the
binding pattern could be due to species differences between the RASM
and HeLa and 3T3 cells.
|
We also examined the interaction of nuclear proteins with the CRE. As
seen in Fig 8, in either vehicle-treated (lanes 2
through 7) or Ang II–treated (lanes 8 through 13) extracts, a number
of proteins bind specifically to 32P-labeled wild-type
CRE (lanes 2 and 8). The specificity of these proteins is demonstrated
by the fact that they are competed by cold wild-type oligo (lanes 3
and 9), by the lack of competition by mutant CRE oligo (lanes 4 and
10), and by the lack of binding to 32P-labeled mutant CRE
oligo (lanes 5 through 7 and 11 through 13). In an attempt to identify
these proteins, we used an antibody to CREB-43 raised against the
259-321 peptide within the leucine zipper region (CREB-1 [C-21] from
Santa Cruz Biotechnology) in a supershift assay. CREB-43 is the best
characterized of the CREB/ATF transcription factors and reacts with a
43-kD protein on Western blots.49 50 As seen in Fig 9, no supershifting is seen with the antibody in
extracts from either RASM cells (lanes 2 and 3), NIH3T3 cells (lanes 4
and 5), or HeLa cells (lanes 6 and 7). As a positive control, 0.5 µg
of a recombinant polypeptide corresponding to amino acids 254 through
327 was used. A supershift complex is clearly seen (lanes 8 and 9). As
also seen in Fig 9, the pattern of protein binding in these three cell
types appears different. Although RASM and NIH3T3 cells may share a
common protein (the top band in lanes 2 through 4), the rest of the
pattern appears distinct or at least of differing intensities. The
pattern seen in HeLa cells is different from that in either RASM or
NIH3T3 cells. Again, no binding to the mutant
oligonucleotide is observed, and no difference is seen
between control and Ang II–treated extracts in RASM or 3T3 cells
(compare lanes 2 and 3 with 4 and 5, and 6 and 7 with 8 and 9). As was
the case for the SRE binding proteins, however, species differences
cannot be excluded.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Numerous lines of evidence support the importance of local Ang II production in the proliferation of vascular smooth muscle cells in hypertension, atherosclerosis, and restenosis after balloon injury.11 51 With the demonstration of rapid c-fos induction in cultured smooth muscle cells by Ang II23 25 and the importance of c-fos induction in growth in a variety of cell types,27 28 29 30 it is important to study the significance of and molecular mechanisms for c-fos induction in RASM cells. In the current report, we performed a series of transient transfection assays to identify the cis- and trans-acting factors responsible for the induction of this gene in RASM cells. Both Ang II and serum can induce c-fos expression in RASM cells by interacting with at least two enhancer elements, the SRE and CRE. Mutations in either of these enhancers alone, which have been demonstrated to inactivate either element in a variety of cell types,31 32 33 34 35 had no significant effect on c-fos induction by either stimulus. However, simultaneous mutations in both enhancer elements reduce c-fos induction to near basal levels. CAT levels after induction with either Ang II or serum with plasmids containing mutations in the SRE or CRE alone (PCB 356mutCArG, PCB 356mutCArG/ets, or PCB 356mutCRE) are only slightly less than the levels with PCB 356 containing both an intact SRE and CRE, suggesting that these two elements act independently and equally, with no evidence of cooperativity. Therefore, it appears that the mechanism for c-fos induction in vascular smooth muscle cells is redundant, occurring via two independent pathways.
Since both elements can act independently, we determined the importance of each element. The importance of the SRE is confirmed by the fact that the level of inducibility with PCB 151 is less than that with PCB 356, but full inducibility is returned with the addition of a wild-type SRE oligonucleotide but not a mutant CArG SRE oligonucleotide to PCB 151. No evidence for a role of the ets site in the SRE is seen. Mutations in this ets site alone or in combination with the CArG box had no effect beyond the effects seen with CArG box mutations alone. The CRE located at -65 also plays a role in c-fos induction in smooth muscle. This fact is supported by experiments showing that the level of CAT inducibility of PCB 71, which is 30% to 40% less than that seen with PCB 356, is completely blocked by a mutation in the CRE (PCB 71mutCRE). These data indicate the potential importance of and support a role for the CRE equal to that of the SRE in c-fos induction by either serum or Ang II in smooth muscle cells.
There are other CRE enhancer elements located in the first 300 bp of the 5'-flanking region of the c-fos gene that can also participate in c-fos induction by increases in cAMP or intracellular calcium in some cells, although the CRE located at -65 appears to play the dominant role.31 32 Since only minimal c-fos induction is seen with the plasmids containing a mutated SRE and CRE (PCB 356mutCArG/CRE and PCB 356 mutCArG/ets/CRE), the contribution of these other CRE elements appears to be minor. This is also true for the SIE, which is located just upstream of the SRE. This element has been demonstrated to bind to an inducible factor, serum inducible factor, in response to a variety of growth stimuli, including epidermal growth factor, platelet-derived growth factor, and interleukin-6.52 53 54 55 56 57 Bhat et al58 have demonstrated that a protein that bound to SIE was induced in cardiac fibroblasts in response to Ang II. Marrero et al59 have also recently shown that stimulation of Ang II receptors in RASM cells results in the phosphorylation of JAK1, JAK2, and TYK2, all members of the JAK family of intracellular kinases, as well as STAT 1, 2, and 3. They also found that an Ang II receptor antibody coimmunoprecipitated JAK2, suggesting that these two proteins are associated in RASM cells. These authors suggested that the JAK/STAT pathway may be involved in gene induction, perhaps c-fos, in RASM cells but did not demonstrate any inducible DNA binding.
The data concerning the role of the SRE and CRE in c-fos induction in RASM cells are in contrast to data reported in many other cell types, including 3T3 fibroblast cells, PC12 cells, and ventricular myocytes.33 34 35 60 61 In these cells, both the SRE and CRE have been reported to be important for c-fos induction but not by the same stimulus. In many cell types, induction by peptide growth factors and serum is completely inhibited by mutations in the SRE CArG box in these cells. Interestingly, this is true also of ventricular myocytes, in which c-fos induction by either Ang II or stretch is blocked by mutations in the SRE CArG box.60 61 There is some previous evidence in the literature for cell-specific regulation in c-fos induction by the SRE because in HeLa cells, mutations in the ets and AP-1 sites flanking the CArG box in the SRE also block c-fos induction.62 The CRE also plays a role in c-fos induction in response to agents that increase cAMP or intracellular calcium in fibroblasts,31 32 37 but these stimuli cannot also signal through the SRE. To our knowledge, this is the first report in any cell type in which c-fos induction can occur via an interaction with two separate enhancer elements, the SRE and CRE, by the same growth stimulus.
To begin to identify the proteins that interact with the SRE and CRE,
we used gel mobility shift assays. As seen in Fig 5, at least two
proteins bind specifically to the SRE in RASM cells, and this binding
is via an interaction with the central CArG box, since mutations in
this site that block c-fos induction also block binding of
the proteins to the SRE. Also, excess cold
oligonucleotide with a mutated CArG site failed to
block binding to the wild-type SRE. No evidence of binding to the
SRE ets site is seen, as the pattern of protein binding to
an oligonucleotide with a mutated ets site
is identical to the binding pattern of wild-type
oligonucleotide, and cold
oligonucleotide with a mutated ets site
failed to inhibit binding to wild-type SRE. As has also been
reported in numerous other cell types, no new proteins are induced
after stimulation with a growth-promoting agent,37 39
in this case Ang II. In other cells types, such as 3T3 fibroblasts and
HeLa cells, it has been demonstrated that two proteins bind to the SRE
as a ternary complex involving SRF and an accessory protein originally
called ternary complex factor.37 39 40 41 The supershift
experiments shown in Fig 6 strongly suggest that SRF, or a closely
related protein, is binding to the SRE in RASM cells. The identity of
the second protein is less clear. At least one ternary complex factor
has been cloned from HeLa cells.36 It was originally
called serum associated protein-1, but it was subsequently demonstrated
to be highly homologous to elk-1, a previously identified member of the
ets family of transcription factors.38 This
protein binds to SRF to enhance c-fos induction, but it is
expressed only in the testes and lung and perhaps at low levels in
liver and brain.63 No evidence of its expression in smooth
muscle cells has been found, and the difference in the pattern of
protein binding between RASM, 3T3, and HeLa cells suggests that the
accessory protein in smooth muscle may be unique; however, species
differences cannot be excluded. A number of other proteins that can
interact with SRF or directly with the SRE have already been cloned and
include direct binding factor64 ; a novel zinc finger
protein, SRE-ZBP (zinc binding protein)65 ; Phox-1, a novel
homeodomain protein66 ; and Net,67 an ets
family member that inhibits c-fos activation. The role of
these proteins in c-fos regulation is unclear, but it has
been proposed that these different proteins may help explain tissue
specificity in c-fos induction.65 66 It is
possible that a unique accessory factor in smooth muscle cells could
explain cell-specific transcriptional activation of
c-fos in this cell type.
The identity of the proteins that bind to the CRE is also not clear
from the present data. As seen in Fig 8, a number of proteins bind
specifically to the CRE. No induction of proteins is seen with Ang II,
and an antibody to CREB-43, the most common CREB
protein,68 69 failed to recognize any RASM cell protein in
the shift-shift assay. This does not mean that another of the many
previously described CREB proteins49 50 is expressed in
RASM cells. The pattern of protein binding to the CRE in RASM, 3T3, and
HeLa cells is different, again suggesting that a set of proteins unique
to either the rat or smooth muscle cells could be mediating
c-fos induction in smooth muscle cells via this enhancer.
In summary, the data presented here demonstrate that c-fos induction in vascular smooth muscle cells occurs by a mechanism different from that described previously in other cell types. In smooth muscle, c-fos induction is redundant, since at least two enhancer elements can induce c-fos by the same stimulus. These elements act equally but independently. Also, the gel shift data suggest that although SRF is involved in c-fos induction in RASM cells, the accessory protein that interacts with SRF and the proteins interacting with the CRE may be unique. The importance of c-fos in numerous cell types has been clearly demonstrated. With antisense methods or direct injection of antibodies, c-fos induction has been shown to be important in cell growth.27 28 29 30 With the importance of vascular smooth muscle proliferation in diseases such as hypertension and atherosclerosis and the arterial response to injury, understanding of the mechanism for the induction of c-fos and other early response genes is important. Further research will be aimed at identifying the proteins that interact with the SRE and CRE in smooth muscle and understanding their mechanism of activation by growth-promoting agents such as Ang II.
|
Selected Abbreviations and Acronyms |
|---|
|
|
Acknowledgments |
|---|
This work was supported by Public Health Service grant HL-47152 from the National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, Md.
Received September 1, 1995; first decision October 10, 1995; accepted February 1, 1996.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Baumbach GL, Heistad DD. Remodeling of cerebral arteries in chronic hypertension. Hypertension. 1989;13:968-972.
2.
Mulvany MJ, Baandrup U, Gunderson HJC. Evidence
for hyperplasia in mesenteric resistance vessels of spontaneously
hypertensive rats using a three-dimensional dissector.
Circ Res. 1985;57:794-800.
3.
Owens GK, Schwartz SM. Alterations in vascular
smooth muscle mass in the spontaneously hypertensive rat.
Circ Res. 1982;51:280-289.
4.
Owens GK, Schwartz SM, McCanna M. Evaluation of
medial hypertrophy in resistance vessels of spontaneously
hypertensive rats. Hypertension. 1988;11:198-207.
5.
Thyberg J, Hedin U, Sjålund L, Palmberg L, Bottger
BA. Regulation of differentiated properties and proliferation of
arterial smooth muscle cells.
Arteriosclerosis. 1990;10:966-990.
6. Austin GE, Ratliff NB, Hollmann J, Tabei S, Phillips DF. Intimal proliferation of smooth muscle cells as an explanation for recurrent artery stenosis after percutaneous transluminal angioplasty. J Am Coll Cardiol. 1985;6:369-375. [Abstract]
7.
Clowes AW, Schwartz SM. Significance of
quiescent smooth muscle migration in the injured rat carotid
artery. Circ Res. 1985;56:139-145.
8.
Hanke H, Stroschneider T, Oberhoff M, Betz E, Karsch
KR. Time course of smooth muscle cell proliferation in the
intima and media of arteries following experimental
angioplasty. Circ Res. 1990;67:651-659.
9.
Berk BC, Vekshtein V, Gordon HM, Terutaka T.
Angiotensin II-stimulated protein synthesis in cultured rat
aortic smooth muscle cells. Hypertension. 1989;13:305-314.
10.
Geisterfer AA, Peach MJ, Owens GK.
Angiotensin II induces hypertrophy, not
hyperplasia, of cultured rat aortic smooth muscle cells.
Circ Res. 1988;62:749-756.
11. Naftilan AJ. Role of the tissue renin-angiotensin system in vascular remodeling and smooth muscle cell growth. Curr Opin Nephrol Hypertens. 1994;3:218-227. [Medline] [Order article via Infotrieve]
12. Capron L, Heudes D, Chajara A, Bruneval P. Effect of ramapril, an inhibitor of angiotensin converting enzyme, on the response of the rat thoracic aorta to injury with a balloon catheter. J Cardiovasc Pharmacol. 1991;18:207-211. [Medline] [Order article via Infotrieve]
13. Kauffman RF, Bean JS, Zimmerman KM, Brown RF, Steinberg MI. Losartan, a nonpeptide angiotensin II (Ang II) receptor antagonist, inhibits neointimal formation following balloon injury to rat carotid artery. Life Sci. 1991;49:223-228.
14.
Powell JS, Clozel JP, Maller RKM, Kuhn H, Hefti F,
Hosang M, Baumgartner HR. Inhibitors of
angiotensin-converting enzyme prevent myointimal
proliferation after vascular injury. Science. 1989;245:186-188.
15.
Janiak P, Libert O, Vilaine JP. Role of the
renin-angiotensin system in neointimal
proliferation after injury in rabbits.
Hypertension. 1994;24:671-678.
16.
Chobanian AV, Haudenschild CC, Nickerson C, Drago
R. Antiatherogenic effect of captopril in the Watanabe heritable
hyperlipidemic rabbit.
Hypertension. 1990;15:327-331.
17. Fennessy PA, Campbell JH, Campbell GR. An angiotensin converting enzyme inhibitor, perindopril, prevents progression of preformed atherosclerotic lesions in the cholesterol-fed rabbit. Clin Sci. 1994;87:685-691. [Medline] [Order article via Infotrieve]
18. Kowala MC, Recce R, Beyer S, Aberg G. Regression of early atherosclerosis in hyperlipidemic hamsters induced by fosinopril and captopril. J Cardiovasc Pharmacol. 1995;25:179-186. [Medline] [Order article via Infotrieve]
19. Morishita R, Gibbons GH, Ellison KE, Lee W, Zhang L, Yu H, Kaneda Y, Ogihara T, Dzau VJ. Evidence for direct local effect of angiotensin in vascular hypertrophy: in vivo gene transfer of angiotensin converting enzyme. J Clin Invest. 1994;94:978-984.
20.
Lau LF, Nathans D. Expression of a set of growth
related immediate early genes in BALB/3T3c cells: coordinated
regulation with c-fos and c-myc.
Proc Natl Acad Sci U S A. 1987;84:1182-1186.
21. Sheng M, Greenberg ME. The regulation of and function of c-fos and other immediate early genes. Neuron. 1990;4:477-485. [Medline] [Order article via Infotrieve]
22. Rivera VM, Greenberg ME. Growth factor-induced gene regulation: the ups and down of c-fos regulation. New Biol. 1991;2:751-758.
23.
Naftilan AJ, Pratt RE, Eldridge CS, Lin HL, Dzau
VJ. Angiotensin II induces c-fos
expression in smooth muscle via transcriptional control.
Hypertension. 1989;13:706-711.
24. Naftilan AJ, Pratt RE, Dzau VJ. Induction of platelet derived growth factor A-chain and c-myc gene expressions by angiotensin II in cultured rat vascular smooth muscle cells. J Clin Invest. 1989;83:1419-1424.
25.
Naftilan AJ, Gilliland GK, Eldridge CS, Kraft
AS. Induction of the protooncogene c-jun by
angiotensin II. Mol Cell Biol. 1990;10:5536-5540.
26.
Taubman MB, Berk BC, Izumo S, Tsuda T, Alexander RW,
Nadal-Ginard B. Angiotensin II induces
c-fos mRNA in aortic smooth muscle cells.
J Biol Chem. 1989;264:526-530.
27.
Holt JT, Gopal TV, Moulton AD, Nienhuis AW.
Inducible production of c-fos antisense RNA inhibits
3T3 cell proliferation. Proc Natl Acad Sci U S A. 1986;83:4794-4798.
28.
Kovary K, Bravo R. The jun
and fos protein families are both required for cell cycle
progress in fibroblasts. Mol Cell Biol. 1991;11:4466-4472.
29.
Nishikura K, Murray JM. Antisense RNA of
proto-oncogene c-fos blocks renewed growth of quiescent
3T3 cells. Mol Cell Biol. 1987;7:639-649.
30.
Riabowol KT, Vosatka RJ, Ziff EB, Lamb NJ, Feramisco
JR. Microinjection of fos-specific antibodies
blocks DNA synthesis in fibroblast cells. Mol Cell Biol. 1988;8:1670-1676.
31.
Berkowitz LA, Riabowol KT, Gilman MZ. Multiple
sequence elements of a single functional class are required for cyclic
AMP responsiveness of the mouse c-fos
promoter. Mol Cell Biol. 1989;9:4272-4281.
32.
Fisch TM, Prywes R, Simon MC, Roeder RG.
Multiple sequence elements in the c-fos promoter mediate
induction by cAMP. Genes Dev. 1989;3:198-211.
33.
Rivera VM, Sheng M, Greenberg ME. The inner core
of the serum response element mediates both the rapid induction and
subsequent repression of c-fos transcription following serum
stimulation. Genes Dev. 1990;4:255-268.
34. Treisman R. Transient accumulation of c-fos following serum stimulation requires a conserved 5' element and c-fos 3' sequences. Cell. 1985;42:889-902. [Medline] [Order article via Infotrieve]
35. Treisman R. The SRE: a growth factor responsive transcriptional regulator. Cancer Biology. 1990;1:47-58.
36. Dalton S, Treisman R. Characterization of SAP-1, a protein recruited by serum response factor to the c-fos serum response element. Cell. 1992;68:597-612. [Medline] [Order article via Infotrieve]
37. Herrera RE, Shaw PE, Nordheim A. Occupation of the c-fos serum response element in vivo by a multiprotein complex is unaltered by growth factor induction. Nature. 1989;340:68-70. [Medline] [Order article via Infotrieve]
38. Hipskind RA, Rao VN, Mueller CGF, Reddy ESP, Nordheim A. ETts-related protein Elk-1 is homologous to the c-fos regulatory factor p62TCF. Nature. 1991;354:531-534. [Medline] [Order article via Infotrieve]
39. Norman C, Runswick M, Pollock R, Treisman R. Isolation and properties of cDNA clones encoding SRF, a transcription factor that binds to the c-fos serum response element. Cell. 1988;55:989-1003. [Medline] [Order article via Infotrieve]
40. Schröter H, Mueller CGF, Meese K, Nordheim A. Synergism in ternary complex formation between the dimeric glycoprotein p67SRF, polypeptide p62TCF and the c-fos serum response element. EMBO J. 1990;9:1123-1130. [Medline] [Order article via Infotrieve]
41. Shaw PE, Schroter H, Nordheim A. The ability of a ternary complex to form over the serum response element correlates with serum inducibility of the human c-fos promoter. Cell. 1989;56:563-572. [Medline] [Order article via Infotrieve]
42. Gauthier-Rouviere C, Basset M, Blanchard JM, Cavadore JC, Fernandez A, Lamb NJ. Casein kinase II induces c-fos expression via the serum response element and p67SRF phosphorylation in living fibroblasts. EMBO J. 1991;10:2921-2930. [Medline] [Order article via Infotrieve]
43. Gauthier-Rouviere C, Cavadore JC, Blanchard JM, Lamb NJ, Fernandez A. p67SRF is a constitutive protein implicated in the modulation of genes required throughout the G1 period. Cell Regul. 1991;2:575-578. [Medline] [Order article via Infotrieve]
44. Libby P, O'Brien RV. Culture of quiescent arterial smooth muscle cells in a defined serum-free medium. J Cell Physiol. 1983;115:217-223. [Medline] [Order article via Infotrieve]
45. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal Biochem. 1976;72:248-254. [Medline] [Order article via Infotrieve]
46. Neumann JR, Morency CA, Russian KO. A novel rapid assay for chloramphenicol acetyltransferase gene expression. Biotechniques. 1987;5:444-447.
47. Maniatis T, Fritsch EF, Sambrook J. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Press; 1982.
48.
Manak JR, Bisschop N, Kris RM, Prywes R. Casein
kinase II enhances the DNA binding activity of serum response
factor. Genes Dev. 1990;4:955-967.
49.
Hai T, Liu F, Coukos WJ, Green MR. Transcription
factor ATF cDNA clones: an extensive family of leucine zipper proteins
able to selectively form DNA-binding heterodimers. Genes
Dev. 1989;3:2083-2090.
50.
Hurst HC, Masson N, Jones NC, Lee KAW. The
cellular transcription factor CREB corresponds to activating factor 47
(ATF-47) and forms complexes with a group of polypeptides related to
ATF-43. Mol Cell Biol. 1990;10:6192-6203.
51.
Dzau VJ. Significance of the vascular
renin-angiotensin pathway.
Hypertension. 1986;8:553-559.
52. Wagner BL, Hayes TE, Hoban CJ, Cochran BH. The SIF binding element confers sis/PDGF inducibility onto the c-fos promoter. EMBO J. 1990;9:4477-4484. [Medline] [Order article via Infotrieve]
53. Arias J, Alberts AS, Brindle P, Claret FX, Smeal T, Karin M, Feramisco J, Montminy M. Activation of cAMP and mitogen responsive genes relies on a common nuclear factor. Nature. 1994;370:226-229. [Medline] [Order article via Infotrieve]
54. Fu X-Y, Zhang J-J. Transcription factor p91 interacts with the epidermal growth factor receptor and mediates activation of the c-fos promoter. Cell. 1993;74:1135-1145. [Medline] [Order article via Infotrieve]
55. Sadowski HB, Gilman MZ. Cell-free activation of a DNA-binding protein by epidermal growth factor. Nature. 1993;362:79-83. [Medline] [Order article via Infotrieve]
56.
Sadowski HB, Shuai K, Darnell JE Jr, Gilman MZ.
A common nuclear signal transduction pathway activated by
growth factor and cytokine receptors.
Science. 1993;261:1739-1744.
57.
Ruff-Jamison S, Chen K, Cohen S. Induction by
EGF and interferon of tyrosine phosphorylated DNA
binding proteins in mouse liver nuclei. Science. 1993;261:1733-1736.
58. Bhat GJ, Thekkumkara WG, Thomas WG, Conrad KM, Baker KM. Angiotensin II stimulates a cis-inducing factor-like DNA binding activity. J Biol Chem. 1994;269:31442-31449.
59. Marrero MB, Schieffer B, Paxton WG, Heerdt L, Berk BC, Delafontaine P, Bernstein KE. Direct stimulation of JAK/STAT pathway by the angiotensin II AT1 receptor. Nature. 1995;375:247-250. [Medline] [Order article via Infotrieve]
60.
Sadoshima J, Izumo S. Signal transduction
pathways of angiotensin II-induced c-fos gene
expression in cardiac myocytes in vitro: roles of
phospholipid-derived second messengers.
Circ Res. 1993;73:424-438.
61.
Sadoshima J, Jahn L, Takahashi T, Kulik TJ, Izumo
S. Molecular characterization of the stretch-induced
adaptation of cultured cardiac cells. An in vitro model of
load-induced cardiac hypertrophy. J
Biol Chem. 1992;267:10551-10560.
62.
Gutman A, Wasylyk C, Wasylyk B.
Cell-specific regulation of oncogene-responsive sequences of
the c-fos promoter. Mol Cell Biol. 1991;11:5381-5387.
63.
Rao VN, Huebner K, Isobe M, AR-Rushdi A,
Croce CM, Reddy ESP. ELK, a tissue-specific ets-related
gene on chromosome X and 14 near translation breakpoints.
Science. 1989;244:66-70.
64. Ryan WA Jr, Franza BR Jr, Gilman MZ. Two distinct cellular phosphoproteins bind to the c-fos serum response element. EMBO J. 1989;6:1785-1792.
65.
Attar RM, Gilman MZ. Expression cloning of a
novel zinc finger protein that binds to the c-fos serum
response element. Mol Cell Biol. 1992;12:2432-2443.
66.
Grueneberg DA, Natesan S, Alexandre C, Gilman
MZ. Human and Drosophilia homeodomain
proteins that enhance the DNA-binding activity of serum response
factor. Science. 1992;257:1089-1095.
67.
Giovane A, Pintzas A, Maira SM, Sobieszczuk P, Wasylyk
B. Net, a new ets transcription factor that is activated
by Ras. Genes Dev. 1994;8:1502-1513.
68.
Sassone-Corsi P, Visvader J, Ferland L, Mellon PL,
Verma IM. Induction of proto-oncogene fos
transcription through the adenylate cyclase pathway:
characterization of a cAMP-responsive element. Genes Dev. 1988;2:1529-1538.
69. Yamamoto KK, Gonzalez GA, Briggs WH, Montminy MR. Phosphorylation-induced binding and transcriptional efficacy of nuclear factor CREB. Nature. 1988;334:494-498.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
 |
|
 |
|
  S. Sakurai, S. Alam, G. Pagan-Mercado, F. Hickman, J.-Y. Tsai, P. Zelenka, and S. Sato Retinal Capillary Pericyte Proliferation and c-Fos mRNA Induction by Prostaglandin D2 through the cAMP Response Element Invest. Ophthalmol. Vis. Sci., August 1, 2002; 43(8): 2774 - 2781. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. M. Touyz and E. L. Schiffrin Signal Transduction Mechanisms Mediating the Physiological and Pathophysiological Actions of Angiotensin II in Vascular Smooth Muscle Cells Pharmacol. Rev., December 1, 2000; 52(4): 639 - 672. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. J. Brown, K.-S. Kim, Y.-Q. Chen, L. S. Blevins, J. H. Nadeau, S. G. Meranze, and D. E. Vaughan Synergistic Effect of Adrenal Steroids and Angiotensin II on Plasminogen Activator Inhibitor-1 Production J. Clin. Endocrinol. Metab., January 1, 2000; 85(1): 336 - 344. [Abstract] [Full Text]
|
|
|
|
 |
|
 Y.-Q. Chen, M. Su, R. R. Walia, Q. Hao, J. W. Covington, and D. E. Vaughan Sp1 Sites Mediate Activation of the Plasminogen Activator Inhibitor-1 Promoter by Glucose in Vascular Smooth Muscle Cells J. Biol. Chem., April 3, 1998; 273(14): 8225 - 8231. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||