This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Mori, Y. Articles by Inada, M. Search for Related Content PubMed PubMed Citation Articles by Mori, Y. Articles by Inada, M.

(Hypertension. 1996;28:810-817.)
© 1996 American Heart Association, Inc.

Articles

Translational Regulation of Angiotensin II Type 1A Receptor

Role of Upstream AUG Triplets

Yasukiyo Mori; Hiroaki Matsubara; Satoshi Murasawa; Kazuhisa Kijima; Katsuya Maruyama; Hiroyasu Tsukaguchi; Naohiko Okubo; Takao Hamakubo; Tadashi Inagami; Toshiji Iwasaka; Mitsuo Inada

the Department of Medicine II, Kansai Medical University, Osaka, Japan, and the Department of Biochemistry, Vanderbilt University School of Medicine, Nashville, Tenn (T.H., T. Inagami).

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
The cDNA sequence of rat angiotensin II type 1A receptor (AT_1AR) shows that AT_1AR transcripts have AUG triplets in the 5'-leader region that may begin a short open reading frame encoding an 11–amino acid peptide. In this study, the mutational inactivation of the start codon of the short open reading frame in AT_1AR–chloramphenicol acetyltransferase (CAT) reporter gene constructs resulted in a 2.6-fold increase in CAT activity, whereas CAT transcript levels were not affected. Furthermore, experiments with rat AT_1AR cDNA–transfected Cos-7 cells revealed that mutagenesis of the upstream AUG increased the AT_1AR protein up to 2.5-fold, although AT_1AR transcript levels showed no changes. The synthetic peptide corresponding to the sequence of the short open reading frame significantly suppressed the amount of AT_1AR product in the in vitro translation system. The inhibiting effect of the short open reading frame appears to operate at least in part at the level of translation initiation, because polysome analysis with transfected Cos-7 cells showed that mutagenesis of the upstream AUG resulted in a shift of AT_1AR mRNA distribution from a smaller to larger fraction of polysomes. Taken together, these results show that the upstream AUG inhibits translational regulation, suggesting that the short open reading frame in the 5'-leader region of AT_1AR transcripts has a certain role in the translation of AT_1AR protein.

Key Words: receptors, angiotensin II • molecular biology • muscle, smooth, vascular • genes • rats

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Angiotensin II (Ang II) has a wide range of actions on the cardiovascular, endocrine, and nervous systems that are initiated by binding to specific receptors located on the plasma membrane.¹ There are several subclasses of Ang II receptors.² The hemodynamic and cardiovascular effects of Ang II are mediated by AT_1AR. The cDNAs encoding AT_1AR are similar in structure to other described G protein–coupled receptors.³

Many investigators, including our group, have studied the transcriptional regulation of the AT_1AR gene.^{4 5 6 7 8 9} We cloned the AT_1AR gene from the rat genomic library and identified its promoter region.⁴ Multiple positive and negative cis-acting sequences regulate transcription of the AT_1AR gene, as well as that of the glucocorticoid-responsive element, in a cell-specific manner.^{4 5 6}

The rat AT_1AR gene consists of three exons and two introns, and the structure indicates that the AT_1AR protein is encoded by exon 3.⁷ The role of the 5'-leader region of AT_1AR mRNA transcribed from exons 1 and 2 is not known. However, in general, the 5'-leader region affects the translational efficiency of mRNA by the sequence context in the vicinity of the AUG codon, the number of upstream AUG codons, and the length and second structure of the mRNA leader.¹⁰ Although AUG triplets in the leader region are found in less than 10% of vertebrate mRNA, they occur at a higher frequency in certain protein families, including the members of the G protein–coupled receptor superfamily, which includes adrenergic, muscarinic, and serotonergic receptors.^{11 12 13} The cDNA sequence of rat AT_1AR predicts that AT_1AR transcripts also have AUG triplets in the 5'-leader region that may begin an sORF (+21 to +56 in exon 1) encoding an 11–amino acid peptide that precedes the AT_1AR cistron.^{4 7} Therefore, we hypothesized that the AUG triplets in the 5'-leader region of AT_1AR transcripts may play a role in the translational regulation of AT_1AR protein. In the present study, we examined the effect of mutational inactivation of the sORF start codon on the translation of AT_1AR protein using in vivo and in vitro expression systems.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Construction of Rat AT_1AR Mutant
AT_1AR mutant was constructed by PCR, incorporating the nucleotide modifications into PCR primers. The first PCR product was generated with a T3 primer and a reverse primer (No. 1) and then was digested by Pst I and HindIII. The second PCR was performed with a T7 primer and a forward primer (No. 2) and then was treated with HindIII and BamHI. p201CAT, which we have described previously as pAT1a 201CAT,⁴ was used as a template in both PCR reactions. The above two fragments from PCR were subcloned back into the Pst I–BamHI site of p201CAT. The resultant plasmid was named p201 mCAT. For expression in Cos-7 cells, pcAT_1AR was constructed as follows. The first PCR product was made with a forward primer (No. 3) and T7 primer with p201CAT as a template and then was digested by BamHI and Sma I. The second PCR product was generated with a T3 primer and a reverse primer (No. 4) using pBsAT_1AR, which contains rat AT_1AR cDNA (a kind gift from Dr Mitsuhide Naruse, Tokyo Women's Medical College) as a template, and then was treated with HincII and Xho I. For generation of pcAT_1AR, those two fragments were subcloned into the BamHI–Xho I site in pcDNA I (Invitrogen), which contains 637 bp of the cytomegalovirus promoter for eukaryotic expression. We used p201 mCAT instead of p201CAT in the first PCR reaction to obtain the mutant version of upstream ATGs (pcAT_1ARm). The sequences of the primers were as follows: (1) 5'-⁺³¹GACAG⁺²⁶AAGCTT⁺²¹CCAGTCCCTCCCCAACTG⁺⁴-3' and (2) 5'-⁺¹⁶ACTGG⁺²¹AAGCTT⁺²⁶CTGTCCCGCTGGAGAGG⁺⁴³-3' (the underlined sequences were modified from the original sequence to make mutations of upstream ATG codons [+21 to +26], resulting in the formation of a HindIII site); (3) 5'-^-8TGACCGGATCC⁺³CAGTTGGG AGGGACTGGA⁺²¹-3', containing a BamHI site (underlined); and (4) 5'-⁺¹³⁷⁷TACATTCTCGAGTGTGCTTTGAACCTGTCAC⁺¹³⁵⁰-3', containing an Xho I site (underlined). All constructs were sequenced by dideoxy DNA sequence analysis (Sequenase Kit, Amersham). The restriction enzymes and Taq DNA polymerase were purchased from Promega.

RNase Protection Analysis
Total RNA was isolated by guanidine isothiocyanate/cesium chloride centrifugation and subjected to RNase protection analysis as described previously.^{14 15} For the ribroprobe template for detection of CAT transcripts, a 450-bp fragment from the +27 nucleotide in exon 1 of the AT_1AR gene to the EcoRI site in the CAT gene of p201CAT was made by PCR, digested by EcoRI, and then subcloned into the EcoRV-EcoRI site of pBsKS(-) (Stratagene). After linearization by EcoRV, an antisense riboprobe (531 nucleotides long) was produced with a T7 promoter. For the riboprobe template for the AT_1AR transcript, the PCR product of a 180-bp fragment (nucleotides +832 to +1011) in exon 3 of the AT_1AR gene was subcloned into the EcoRI–Sma I site of pBsKS(-). After linearization by EcoRI, an antisense riboprobe (251 nucleotides long) was produced with a T7 promoter. A 143-bp fragment of cDNA from rat U3 small nuclear RNA was cloned into pBsKS(-) and used for generation of a control probe.¹⁴

Cell Cultures
A10 and Cos-7 cells (Dainippon Pharmaceutical) were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum (DMEM/FCS). Rat vascular smooth muscle cells were isolated from thoracic aorta of 4-week-old Wistar rats (Charles River Japan, Kyoto) with the trypsinization method reported by Chamley et al.¹⁶ After four passages in DMEM/FCS, cells were used for the immunoblotting study. All culture media contained 100 U/mL penicillin G and 100 mg/L streptomycin (GIBCO-BRL).

Transfection Experiments, CAT Assay, and Immunoblotting
Transfection experiments were performed with the calcium phosphate precipitation method as described previously.^{14 15} A10 or Cos-7 cells were incubated for 16 hours with 15 to 20 µg of the indicated plasmid DNA with 5 µg of pSV2–ß-galactosidase, treated with 15% glycerol for 2 minutes (glycerol shock), and supplemented with growth medium for 48 hours. Cells were harvested for CAT assay by freezing and thawing in 0.25 mol/L Tris-HCl (pH 7.8) or lysed in RIPA buffer (50 mmol/L Tris, 150 mmol/L NaCl, 1% Nonidet P-40, 0.5% deoxycholate, and 0.1% SDS) for immunoblotting. CAT activity was determined by a dual phase diffusion assay.¹⁷ CAT activity and the loading amount of cell lysate on an SDS-polyacrylamide gel for immunoblotting were normalized by ß-galactosidase activity determined by the standard method.¹⁸ The protein assay was performed by the Bradford method (Bio-Rad). For immunoblotting, a 9% SDS-polyacrylamide gel was developed, electrotransferred to an Immobilon-P membrane (Millipore), blocked in 5% skim milk in 0.1% Tween 20–supplemented Tris-buffered saline (pH 7.6) (20 mmol/L Tris base, 137 mmol/L NaCl, 3.8 mmol/L HCl) (TBS-T) for 1 hour, and then incubated with the polyclonal antibody to AT₁R (a kind gift from Dr Mohan K. Raizada, Florida University)¹⁹ at a dilution of 1:2000 for 1 hour at room temperature. Membranes were washed with TBS-T and then incubated for another hour with horseradish peroxidase–linked anti-rabbit immunoglobulin F(ab')2 fragment from donkey (Amersham) at a dilution of 1:1000 in TBS-T. After further washing with TBS-T, membranes were treated with enhanced chemiluminescence reagent (Amersham), and chemiluminescence was detected by exposure to Hyperfilm-ECL (Amersham) for 5 minutes. The intensity of the bands was quantified by laser densitometry (LKB 2222 UltraScan XL, Pharmacia Biotech).

In Vitro Translation
An Xho I digest of pcAT_1ARm (1 µg) was transcribed from the T7 promoter with T7 RNA polymerase (Promega) and then was translated subsequently with 4 µL of ³⁵S-methionine (1000 Ci/mmol, Amersham) in a 50-µL mixture using rabbit reticulocyte lysate (TNT T7 Coupled Reticulocyte Lysate System, Promega) without microsomal membrane. The reaction was carried out with or without the purified synthetic peptide (30 µmol/L) encoded by the sORF in exon 1 of the rat AT_1AR gene. Luciferase DNA (0.5 µg), supplied by the manufacturer as a positive control, was also transcribed and translated in the same conditions. Transcription and translation reactions were incubated for 90 minutes at 30°C as recommended by the manufacturer's protocol and then were terminated by cooling on ice. A 5-µL aliquot of the reagent was added to 20 µL SDS sample buffer. After heating at 100°C for 2 minutes for protein denaturation, 10 µL of denatured sample was separated by 9% SDS–polyacrylamide gel electrophoresis. The gels were fixed, impregnated with a fluorophore (EN³HANCE, DuPont-NEN), dried, and autoradiographed. Radiolabeled proteins were quantified by densitometric scanning of the film.

Synthetic Peptide
The peptide encoded by the sORF in exon 1 of the rat AT_1AR gene (+21 to +56) was synthesized by the t-Boc method in a Peptide Synthesizer (model 433A, Applied Biosystems Japan). Peptides were then purified by gel filtration in a Sephadex G-50 column followed by high-performance liquid chromatography on a Synchrom C18 column (4.6x250 mm) with a linear acetonitrile gradient (5% to 60%, vol/vol) containing 0.1% trifluoroacetic acid at a flow rate of 1.5 mL/min. The amino acid sequence of the major single peak was confirmed with a peptide sequencer (model 470A, Applied Biosystems Japan). As a control, the first 11 amino acids of the rat AT_1AR protein encoded by the third exon (the sequence: MALNSSAEDGI)³ were also prepared and purified the same way as described above.

Polysome Analysis
Polysomes were prepared from pcAT_1AR- or pcAT_1ARm-transfected Cos-7 cells by the method of Katze²⁰ with some modifications.²¹ Briefly, Cos-7 cells transfected as described above were collected and suspended in ice-cold buffer containing 10 mmol/L Tris hydrochloride (pH 7.5), 10 mmol/L NaCl, 1.5 mmol/L MgCl₂, and 100 mg/L cycloheximide. Triton X-100 (0.5%) was then immediately added. After 3 minutes on ice, 1% Tween 40 and 0.5% sodium deoxycholate were added, and the cells were disrupted by a Dounce homogenizer. The resulting cell lysate was layered on a linear 10% to 50% sucrose gradient in the buffer (10 mmol/L Tris hydrochloride [pH 7.5], 5 mmol/L magnesium acetate, and 500 mmol/L KCl) and centrifuged in a Beckman SW28 rotor at 27 000 rpm for 4 hours at 4°C. Gradient fractions were collected and absorbance at 260 nm was determined. Fractions were pooled as described by Katze et al,²⁰ yielding samples A through F, containing the largest to smallest polysomes (samples A through D), ribosomal subunits (sample E), and the material sedimenting more slowly than the ribosomal subunits (sample F). For each sample, total RNA was extracted with phenol-chloroform by a modification of the technique reported by Chomczynski and Sacchi.²²

Statistical Analysis
Data are presented as mean±SD. Differences between mean values were assessed by one-way ANOVA followed by Scheffe's comparison.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Sequence Analysis of 5'-Noncoding Region of Rat AT_1AR Gene
Previously, we identified and analyzed the 5'-flanking and 5'-noncoding regions of the rat AT_1A R gene.^{4 5 6} Takeuchi et al⁷ showed that the rat AT_1AR gene consists of three exons and two introns and that the third exon includes the major open reading frame for AT_1AR protein. Fig 1 shows the sequence of the AT_1AR gene, which corresponds to a part of the 5'-noncoding region from the TATA box for the transcription start including exon 1. Interestingly, the sequence of exon 1 contains two ATG codons in tandem (from +21 to +23 and from +24 to +27) that may start an sORF, terminating at the TGA codon (+54 to +56). Underlined letters in Fig 1 show the deduced amino acid when the sORF is translated as a minicistron.

View larger version (18K): [in this window] [in a new window]   Figure 1. Nucleotide of a part of the 5'-flanking region and exon 1 of rat AT1AR gene. Numbers on the sequences are relative to the transcription start site. Two upstream ATGs are located at +21 to +23 and +24 to +26, respectively. Underlined sequence indicates the deduced amino acid from the sORF that terminates at +56. TATA box for the transcription start site is shown in italics. Stop codon is denoted by an asterisk.

Effect of Mutation of ATG Codons in Exon 1 on AT_1AR Expression
Previously, deletion analysis of the 5'-flanking region with the use of CAT reporter gene constructs revealed that -201 to +146 from the transcription start site could confer the cell-specific promoter activity on rat vascular smooth muscle (A10) cell lines.^{4 5} To examine whether the ATG codons in exon 1, which may begin an sORF, affect AT_1AR expression, we prepared the mutated constructs derived from our previous CAT constructs as shown in Fig 2A. After transient transfection into A10 cells, we examined CAT transcript level and CAT activity. RNase protection analysis showed that mutagenesis of the ATGs had no significant effects on CAT transcript level. The protected bands between the transfected cells were identical in size, suggesting that mutagenesis did not affect RNA processing (Fig 2B, Table 1). In contrast to mRNA levels, CAT activity from p201 mCAT showed an approximately 2.6-fold increase compared with that from p201CAT (Table 1).

View larger version (43K): [in this window] [in a new window]   Figure 2. A, Mutagenesis of upstream ATGs in CAT construct. The PvuII–Sac I fragment from a cloned rat AT1AR gene containing 201 bp of the 5'-flanking sequence and 141 bp of exon 1 with 121 bp of intron 1 were subcloned into pBsKS(-) to produce 201CAT. Mutations in the 5'-leader of AT1AR are shown in italics. The 456 bp of the PvuII–Sma I fragment with the nucleotide mutation was made by PCR with 201CAT as a template and then was subcloned back into the PvuII–Sma I site of 201CAT. For the riboprobe template in RNase protection analysis, the 450-bp fragment from +27 to the EcoRI site located in the CAT gene was made by PCR and EcoRI digestion and then subcloned into the EcoRV-EcoRI site of pBsKS(-). After linearization by EcoRV, an antisense riboprobe (531 nucleotides long) was produced with T7 RNA polymerase. B, Results of RNase protection analysis demonstrating that the upstream ATG mutation had no significant effect on steady-state levels of CAT mRNA in transfected A10 cells. Two days after transfection, 20 µg total RNA was extracted and hybridized with riboprobes for CAT and for U3 transcripts as an internal control for RNA quantity. After treatment with ribonuclease, the protected fragments were analyzed on a denaturing polyacrylamide/urea gel. This representative analysis was repeated four times with different preparations. Arrows indicate protected bands specific for CAT and U3 transcripts.

View this table: [in this window] [in a new window]   Table 1. Effect of Mutagenesis of Upstream ATGs on CAT Expression System

To further show the effect of mutagenesis of ATG codons, we took another approach. Both the wild-type and ATG-mutated–type of exon 1 were ligated at 5' upstream of exon 2 and subcloned into the mammalian expression vector that was controlled by the cytomegalovirus promoter (pcDNA I) (Fig 3A). These constructs, named pcAT_1AR and pcAT_1ARm, respectively, were transfected transiently into Cos-7 cells, which have no endogenous expression of AT_1AR (Fig 3B). Again, we examined steady-state transcript levels and protein levels. The results of RNase protection analysis showed that mutagenesis of ATG codons did not significantly affect AT_1AR transcripts (Fig 3B, Table 2).

View larger version (176K): [in this window] [in a new window]   Figure 3. A, Construction of AT1AR expression plasmid. A fragment of exon 1 (+3 to +146) including 112 bp of intron 1 of the AT1AR gene was prepared by PCR with p201CAT or p201 mCAT as template and then digested by BamHI and Sma I. The second fragment including exons 2 and 3 was also amplified with pBsAT1AR and then digested by HincII and Xho I. These two fragments were subcloned into the BamHI–Xho I site of pcDNA I as shown. For the riboprobe template in the RNase protection analysis, the PCR product of the 171-bp fragment in exon 3 was subcloned into the EcoRI–Sma I site of pBsKS(-). After linearization by EcoRI, an antisense riboprobe (24 nucleotides long) was produced with T7 RNA polymerase. The hatched portion in exon 3 indicates the sORF for AT1AR protein. CMV indicates cytomegalovirus. B, Results of RNase protection analysis demonstrating that upstream ATG mutation had no significant effect on AT1AR mRNA levels expressed in Cos-7 cells. Fifteen micrograms of total RNA from transfected Cos-7 cells was hybridized with riboprobes for AT1AR and for U3 transcripts as an internal control for RNA quantity. After treatment with ribonuclease, protected fragments were analyzed on a denaturing polyacrylamide/urea gel. This representative analysis was repeated with four different preparations. Arrows indicate protected bands specific for AT1AR and U3 transcripts. VSMC indicates vascular smooth muscle cell. C, Results of immunoblotting of transfected Cos-7 cells demonstrating that upstream ATG mutation increased the amount of AT1AR expression. The cell lysate from transfected cells was fractionated on a 9% SDS-polyacrylamide gel. Protein on the gel was transferred to an Immobilon-P membrane. AT1AR was subsequently detected by immunoblotting with polyclonal anti-rat AT1AR. Arrow indicates specific band for AT1AR.

View this table: [in this window] [in a new window]   Table 2. Effect of Mutagenesis of Upstream ATGs on In Vivo AT1AR Expression System

Using the specific antibody against the AT_1AR peptide, we performed immunoblotting to examine the changes in protein levels of AT_1AR as shown in Fig 3C. The cellular extract from vascular smooth muscle cells revealed three visible bands. The major band, located in the middle, corresponds to a molecular weight of approximately 70 kD. This size of band is compatible with the finding of native AT_1AR by Zelezna et al,¹⁹ who originally developed the antibody used in the present study. Since two other bands were also seen in the Cos-7 cells in which the vector (pcDNA I) alone was transfected, they were considered as nonspecific bands. The transfection of pcAT_1AR into Cos-7 cells resulted in a detectable 70-kD band of AT_1AR, whereas the pcDNA I–transfected cells did not express it. Furthermore, the amount of the 70-kD band in the cellular extract from pcAT_1ARm-transfected Cos-7 cells increased up to 2.5-fold compared with that in pcAT_1AR-transfected cells (Fig 3C, Table 2).

Effect of Synthetic Peptide Encoded by sORF
We next examined the direct effect of the peptide that has the deduced amino acid sequence from the sORF in exon 1 using the in vitro transcription and translation system. The cRNA transcribed from the pcAT_1ARm construct was translated in a rabbit reticulocyte extract system. The major product labeled by ³⁵S-methionine migrated around the molecular weight size of approximately 40 000 (Fig 4). This size is compatible with the predicted size from the AT_1AR cDNA sequence.^{19 23} The difference in the size from the native receptor (70 kD) is mainly due to the lack of glycosylation in the cell-free translation system. The addition of high-performance liquid chromatography–purified synthetic peptide, which has the 11 deduced amino acids encoded by the sORF in exon 1 of the AT_1AR gene (+21 to +56 in Fig 1), to the translation reaction decreased the amount of translation product in a dose-dependent manner. The sORF peptide maximally reduced the translation product to 24.6±5.6% of control at a concentration of 30 mol/L (P<.01, n=4) (Fig 4A and 4B, left). However, the control peptide synthesized according to the sequence from the first 11 amino acids of the AT_1AR protein did not show any significant change (Fig 4A and 4B, right). In addition, the synthetic peptide encoded by the sORF did not affect the product from luciferase cDNA (Fig 4C).

View larger version (105K): [in this window] [in a new window]   Figure 4. In vitro translation product of AT1AR was inhibited by addition of the synthetic peptide encoded by the sORF in exon 1 of AT1AR gene as shown in Fig 1. 35S-Methionine–labeled AT1AR was translated from pcAT1ARm with the cell-free system described in "Methods." A and B, Synthetic and control peptides (0 to 30 µmol/L) were added to the translation reaction. Arrow indicates the specific band for AT1AR. Bands of the film were measured by densitometry. Results are expressed as percent changes from expression with no additives. Values are presented as mean±SD of four independent experiments. *P<.01 vs no additives. C, As a control experiment, luciferase expression with or without synthetic peptide (30 µmol/L) was also determined. Arrow indicates the specific band for luciferase.

Polysome Analysis
To examine the inhibition of AT_1AR protein synthesis by the sORF, we carried out polysome analysis of transfected Cos-7 cells. The absorbance profile of the sucrose gradient showed that pcAT_1AR- and pcAT_1ARm-transfected Cos-7 cells had similar proportions of polysomal and ribosomal subunits (Fig 5A). The gradient fractions were then pooled into six samples (A through F). Total RNA from each sample was subjected to RNase protection assays for determination of the polysome association of AT_1AR mRNA followed by densitometric scanning. Fig 5B and 5C show the representative distribution pattern of AT_1AR mRNA. In the pcAT_1AR-transfected Cos-7 cells, the distribution of AT_1AR mRNA increased gradually from the larger to the smaller fractions of polysomes and ribosomes, peaking at samples E and F (50±9% of the total area, n=4). However, in the pcAT_1ARm-transfected Cos-7 cells, an increased amount of AT_1AR mRNA was found in samples A through D (80±9% of the total area, n=4), resulting in a shift of the distribution profile of AT_1AR mRNA from the smaller to the larger polysome fractions. The area of samples E and F decreased to 20±5% of the total area.

View larger version (53K): [in this window] [in a new window]   Figure 5. Distribution of AT1AR mRNA in polysomes of pcAT1AR- and pcAT1ARm-transfected Cos-7 cells. After transient transfection as described in Fig 3, cells were lysed and cytoplasmic extracts were centrifuged through 10% to 50% sucrose gradient buffer at 27 000 rpm for 4 hours at 4°C. A, Optical density profile at 260 nm of sedimentation from transfected cell extracts. Six fractions (A through F) were made across each gradient fraction. B, 20 µg total RNA prepared from each fraction was subjected to RNase protection assay with the same method as described in Fig 3 legend. Arrow indicates the specific band for AT1AR transcript. As positive control, mRNA derived from rat vascular smooth muscle cells (VSMC) was used. Cos-7 cells that transfected pcDNA I alone did not show the band corresponding to AT1AR. Autographic signal was measured by laser densitometric scanning. C, Total area of pcAT1AR-transfected Cos-7 cells was 8.4 and distributed as follows: sample A, 0.6 (7%); sample B, 0.7 (8%); sample C, 1.4 (17%); sample D, 1.5 (18%); sample E, 1.8 (21%); and sample F, 2.4 (29%). Total area of pcAT1ARm-transfected Cos-7 cells was 9.2 and distributed as follows: sample A, 1.4 (15%); sample B, 1.7 (18%); sample C, 1.8 (20%); sample D, 2.6 (28%); sample E, 0.9 (10%); and sample F, 0.7 (8%). Similar results were obtained in four independent experiments.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
The present study indicates that the upstream AUG triplets in the 5'-leader region of rat AT_1AR transcripts inhibit the translation of AT_1AR. First, we used a CAT expression system extended from our previous study.⁴ Regarding the scanning model of the 40S ribosomal subunit, Kozak^{24 25 26} proposed a favorable nucleotide sequence (GCCACCAUGG) to initiate the translation of the majority of vertebrate transcripts. The rat AT_1AR cDNA sequence has two AUG codons located in tandem in the first exon. The second AUG appears to have a more favorable sequence for translation initiation than the first one. However, the studies regarding the sORFs showed that the adequate Kozak sequence was not always necessary for sORFs to be translated and to affect the translation of the subsequent coding protein.^{13 27} In the present study, to clarify the role of the sORF in the first exon, we designed the mutations of both AUGs not to allow any translation from the sORF. Mutagenesis of two upstream AUGs in exon 1 of the AT_1AR CAT gene reporter construct had no significant effect on the mRNA level of CAT. However, mutagenesis significantly increased the CAT activity to 2.6-fold. These findings suggest that the upstream AUG triplets inhibit AT_1AR expression at its translational levels. Further proof of this observation was obtained from the in vivo AT_1AR expression study. In the immunoblotting with the rat AT_1AR antibody, the cellular extract from AT_1AR cDNA–transfected Cos-7 cells revealed the same size of band (70 kD) as that from vascular smooth muscle cells. The addition of a mutation in the upstream AUGs resulted in a 2.5-fold increase in AT_1AR protein, whereas the steady-state levels of AT_1AR transcript in the RNase protection assay did not change. Thus, the AT_1AR expression system with Cos-7 cells confirmed that mutagenesis of upstream AUG did not modify the translatability of the AT_1AR transcripts. Moreover, since the mutagenesis of AUG had kinetics almost similar to those with the two different protein expression systems, it seems unlikely that the upstream AUG affects the step of protein degradation. In addition, because the constructs used for the expression in Cos-7 cells included the full length of AT_1AR cDNA, the upstream AUG appeared to affect the AT_1AR protein level in vivo without involving RNA processing.

Interestingly, many other members of the G protein–coupled receptor superfamily also harbor a 5'-leader AUG triplet.^{11 12 13} Parola and Kobilka¹³ demonstrated that an AUG triplet in the 5'-leader of ß₂-adrenergic receptor (ß₂R) began an sORF that encodes the 19–amino acid peptide BUP and that BUP inhibited the translation efficiency of ß₂R. Despite the poor sequence context of the sORF of ß₂R for the translation initiation, the sORF AUG triplet of ß₂R was shown to serve as a start codon with use of an epitope-tagged fusion receptor protein. Furthermore, the addition of the synthetic peptide of BUP in the in vitro translation reaction inhibited the ß₂R translation. These findings support the theory that a high local concentration of newly synthesized BUP inhibits ß₂R synthesis. BUP may interfere with translation by disturbing the ribosome-mRNA interaction during the scanning of ribosomes, resulting in inhibition of the translation of the downstream cistron. As with ß₂R, we found that the synthetic peptide encoded by the sequence of AT_1AR sORF in exon 1 inhibited the in vitro translation of AT_1AR significantly with the rabbit reticulocyte lysate system, although a relatively high concentration of the peptide (30 µmol/L) was needed. As a control peptide, we synthesized the peptide that has the sequence of the first 11 amino acids of the AT_1AR protein. A control peptide at the same concentration as the sORF peptide did not reduce the yield of AT_1AR in vitro. In addition, the amount of product from luciferase cDNA was not affected by the same concentration of the peptide. These findings indicate that the inhibitory effect of the sORF peptide is specific for the AT_1AR gene and is not an artifact, suggesting that a phenomenon similar to that in ß₂R works in the translational regulation of AT_1AR. Moreover, it is interesting that all of the mammalian and avian type 1A and 1B receptor (AT₁R) cDNAs possess upstream sORFs, although the deduced amino acid sequence of each open reading frame has poor homology.²⁸ Recently, Curnow et al²⁹ demonstrated that the presence of exon 2 in the human AT₁R transcript inhibited translation by more than 90%, probably because exon 2 contains the minicistron as an sORF in the 5'-leader region. Therefore, the translational regulation by an upstream sORF seems to be a common feature of mammalian AT₁R expression.

Despite the studies regarding the sORF in other genes,^{13 24 30 31 32 33 34 35} the mechanisms underlying the regulation of protein translation by each sORF remain uncertain. Analysis of mRNA distribution in polysomes can often reveal the level at which translational control is operating.^{36 37} In the present study, the polysome analysis with AT_1AR cDNA–transfected Cos-7 cells revealed that the mutation of upstream ATG resulted in the shift of AT_1AR mRNA from the smaller to the larger polysome fraction or the displacement from the ribosomal fraction. If all other aspects of protein synthesis are normal but initiation is reduced, the result is fewer ribosomes per mRNA. Therefore, the initiation of less AT_1AR mRNA may be at least partly responsible for the inhibitory effect of the sORF, although the limitation in the precision of the polysome analysis cannot allow us to exclude the possibility that other mechanisms are also involved, such as the rate of protein elongation.

Besides inhibition by the sORF, according to the scanning hypothesis of the ribosome, the translation is modulated by several other aspects of mRNA structure, including the m7G cap, the position of the AUG codon, a secondary structure both upstream and downstream from the AUG codon, and leader length.^{10 30} Computer analysis of the secondary RNA structure predicts a relatively stable structure in the region of AT_1AR mRNA encoded by exon 1 (data not shown). That structure may enhance the initiation from a weak start codon of the sORF in AT_1AR by retarding ribosome scanning, thus giving the ribosome more time to recognize a poor context of the start site.³¹ Alternatively, the stable secondary structure per se may modify the translational efficiency of the AT_1AR protein. In vitro translation experiments are in progress in our laboratory to investigate the translation initiation of the sORF in the first exon as well as the role of the other 5'-leader regions of AT_1AR, including the second exon.

In conclusion, this study demonstrated that the upstream AUG triplets in the 5'-leader region of AT_1AR mRNA have an inhibiting effect on triplets AT_1AR translation and that this effect may be at least partly responsible for the regulation of AT_1AR expression. In addition to the studies on transcription levels, further investigations of the translational regulation of AT_1AR will provide important information about the entire mechanism of AT_1AR expression in vivo.

	Selected Abbreviations and Acronyms

 

AT1AR = angiotensin II type 1A receptor CAT = chloramphenicol acetyltransferase pBsKS(-) = pBluescript KS II(-) PCR = polymerase chain reaction SDS = sodium dodecyl sulfate sORF = short open reading frame

	Acknowledgments

 
We wish to thank Dr Eduardo J. Folco for critical reading of the manuscript.

	Footnotes

 
Reprint requests to Yasukiyo Mori, MD, Department of Medicine II, Kansai Medical University, 10-15 Fumizono-cho, Moriguchi, Osaka 570, Japan.

Received September 19, 1995; first decision November 10, 1995; accepted June 26, 1996.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Peach MJ. Renin-angiotensin system: biochemistry and mechanisms of action. Physiol Rev. 1977;57:313-370.[Free Full Text]

2. Gasparo M, Husain A, Alexander W, Catt KJ, Chiu AT, Drew M, Goodfriend T, Harding JW, Inagami T, Timmermans P. Proposed update of angiotensin receptor nomenclature. Hypertension. 1995;25:924-927.[Free Full Text]

3. Inagami T, Kitami Y. Angiotensin II receptor: molecular cloning, functions, and regulation. Hypertens Res. 1994;17:87-97.

4. Murasawa S, Matsubara H, Urakami M, Inada M. Regulatory elements that mediate expression of the gene for the angiotensin II receptor for the rat. J Biol Chem. 1993;268:26996-27003.[Abstract/Free Full Text]

5. Murasawa S, Matsubara H, Kanasaki M, Kijima K, Maruyama K, Nio Y, Okubo N, Tsukaguchi H, Mori Y, Inada M. Characterization of glucocorticoid response element of rat angiotensin II type 1A receptor gene. Biochem Biophys Res Commun. 1995;209:832-840.

6. Murasawa S, Matsubara H, Mori Y, Kijima K, Maruyama K, Inada M. Identification of a negative cis-regulatory element and transacting protein that inhibit transcription of angiotensin II type 1a receptor gene. J Biol Chem. 1995;270:24282-24286.[Abstract/Free Full Text]

7. Takeuchi K, Alexander RW, Nakamura Y, Tsujino T, Murphy TJ. Molecular structure and transcriptional function of the rat vascular AT1a angiotensin receptor gene. Circ Res. 1993;73:612-621.[Abstract/Free Full Text]

8. Takayanagi R, Ohnaka K, Sakai Y, Nakao R, Yanase T, Haji M, Inagami T, Furuta H, Guo DF, Nakamuta M, Nawata H. Molecular cloning and characterization of the promoter for human type-1 angiotensin II receptor gene. Biochem Biophys Res Commun. 1992;183:233-259.

9. Su B, Martin MM, Beason B, Miller PJ, Elton TS. The genomic organization and functional analysis of the promoter for the human angiotensin II type 1 receptor. Biochem Biophys Res Commun. 1994;204:1039-1046.[Medline] [Order article via Infotrieve]

10. Kozak M. Structural features in eukaryotic mRNAs that modulate the initiation of translation. J Biol Chem. 1991;266:19867-19870.[Free Full Text]

11. Kozak M. An analysis of vertebrate mRNA sequences: initiations of translational control. J Cell Biol. 1991;115:887-903.[Abstract/Free Full Text]

12. Kozak M. An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res. 1987;15:8125-8148.[Abstract/Free Full Text]

13. Parola AL, Kobilka BK. The peptide product of a 5' leader cistron in the ß2 adrenergic receptor mRNA inhibits receptor synthesis. J Biol Chem. 1994;269:4497-4505.[Abstract/Free Full Text]

14. Mori Y, Matsubara H, Folco E, Siegel A, Koren G. The transcription of a mammalian voltage-gated potassium channel is regulated by cAMP in a cell-specific manner. J Biol Chem. 1993;268:26482-26493.[Abstract/Free Full Text]

15. Mori Y, Folco E, Koren G. GH3 cell-specific expression of Kv1.5 gene: regulation by a silencer containing a dinucleotide repetitive element. J Biol Chem. 1995;270:27788-27796.[Abstract/Free Full Text]

16. Chamley JH, Campbell GR, McConnell JD. Comparison of vascular smooth muscle cells from adult human, monkey and rabbit in primary culture and in subculture. Cell Tissue Res. 1977;177:503-522.[Medline] [Order article via Infotrieve]

17. Neumann JR, Morency CA, Russian KO. A novel rapid assay for chloramphenicol acetyltransferase gene expression. BioTechniques. 1987;5:444-448.

18. Sambrook J, Fritsch EF, Maniatis T. Expression of cloned genes in cultured mammalian cells. In: Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989:16.66.

19. Zelezna B, Richards EM, Tang W, Lu D, Sumners C, Raizada K. Characterization of a polyclonal anti-peptide antibody to the angiotensin II type-1 (AT₁) receptor. Biochem Biophys Res Commun. 1992;183:781-788.[Medline] [Order article via Infotrieve]

20. Katze MG, DeCorato D, Krug R. Cellular mRNA translation is blocked at both initiation and elongation after infection by influenza virus or adenovirus. J Virol. 1986;60:1027-1039.[Abstract/Free Full Text]

21. Garfinkel MS, Katze MG. Translational control by influenza virus. J Biol Chem. 1993;268:22223-22226.[Abstract/Free Full Text]

22. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156-159.[Medline] [Order article via Infotrieve]

23. Barker S, Marchant W, Ho MM, Puddeffot JR, Hinson JP, Clark AJL, Vinson GP. A monoclonal antibody to a conserved sequence in the extracellular domain recognizes the angiotensin II type-1 (AT₁) receptor in mammalian target tissues. J Mol Endocrinol. 1993;11:241-245.[Abstract/Free Full Text]

24. Kozak M. Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell. 1986;44:283-292.[Medline] [Order article via Infotrieve]

25. Kozak M. At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J Mol Biol. 1987;196:947-950.[Medline] [Order article via Infotrieve]

26. Kozak M. Context effects and inefficient initiation at non-AUG codons in eucaryotic cell-free translation systems. Mol Cell Biol. 1989;9:5073-5080.[Abstract/Free Full Text]

27. Arrick BA, Lee AL, Grendell RL, Derynck R. Inhibition of translation of transforming growth factor-3 mRNA by its 5' untranslated region. Mol Cell Biol. 1991;11:4302-4313.

28. Sandberg K. Structural analysis and regulation of angiotensin II receptors. TEM. 1994;5:28-35.

29. Curnow KM, Pascoe L, Davies E, White PC, Corvol P, Clauser E. Alternatively spliced human type-1 angiotensin II receptor (AT₁) mRNAs are translated at different efficiencies and encode two receptor isoforms. Mol Endocrinol. 1995;9:1250-1262.[Abstract/Free Full Text]

30. Kozak M. Effects of intercistronic length on the efficiency of reinitiation by eucaryotic ribosomes. Mol Cell Biol. 1987;7:3438-3445.[Abstract/Free Full Text]

31. Kozak M. Downstream secondary structure facilitates recognition of initiator codons. Proc Natl Acad Sci U S A. 1990;87:8301-8305.[Abstract/Free Full Text]

32. Hunt T. False starts in translational control of gene expression. Nature. 1985;316:580-581.[Medline] [Order article via Infotrieve]

33. Weeks KM, Ampe C, Schultz SC, Steitz TA, Crothers DM. Fragments of the HIV-1 Tat protein specifically bind TAR RNA. Science. 1990;249:1281-1285.[Abstract/Free Full Text]

34. Calnan BJ, Biancalana S, Hudson D, Biancalana S, Frankel AD. Analysis of arginine-rich peptides from the HIV Tat protein reveals unusual features of RNA-protein recognition. Genes Dev. 1991;5:201-210.[Abstract/Free Full Text]

35. Calnan BJ, Tidor B, Biancalana S, Hudson D, Frankel AD. Arginine-mediated RNA recognition: the arginine fork. Science. 1990;252:1167-1171.

36. Leibowitz R, Penman S. Regulation of protein synthesis in HeLa cells. J Virol. 1971;8:661-668.[Abstract/Free Full Text]

37. Babich A, Feldman LT, Nevins JR, Darnell JE, Weinberger C. Effect of adenovirus on metabolism of specific host mRNAs: transport control and specific translational discrimination. Mol Cell Biol. 1983;3:1212-1221.[Abstract/Free Full Text]

This article has been cited by other articles:

				T. S. Elton and M. M. Martin Angiotensin II Type 1 Receptor Gene Regulation: Transcriptional and Posttranscriptional Mechanisms Hypertension, May 1, 2007; 49(5): 953 - 961. [Full Text] [PDF]

				C. Rabadan-Diehl, S. Volpi, M. Nikodemova, and G. Aguilera Translational Regulation of the Vasopressin V1b Receptor Involves an Internal Ribosome Entry Site Mol. Endocrinol., October 1, 2003; 17(10): 1959 - 1971. [Abstract] [Full Text] [PDF]

				B. Gereben, A. Kollar, J. W. Harney, and P. R. Larsen The mRNA Structure Has Potent Regulatory Effects on Type 2 Iodothyronine Deiodinase Expression Mol. Endocrinol., July 1, 2002; 16(7): 1667 - 1679. [Abstract] [Full Text] [PDF]

				G. Xu, C. Rabadan-Diehl, M. Nikodemova, P. Wynn, J. Spiess, and G. Aguilera Inhibition of Corticotropin Releasing Hormone Type-1 Receptor Translation by an Upstream AUG Triplet in the 5' Untranslated Region Mol. Pharmacol., March 1, 2001; 59(3): 485 - 492. [Abstract] [Full Text]

				L. A. Goldstein and W.-T. Chen Identification of an Alternatively Spliced Seprase mRNA That Encodes a Novel Intracellular Isoform J. Biol. Chem., January 28, 2000; 275(4): 2554 - 2559. [Abstract] [Full Text] [PDF]

				Y. Tsutsumi, H. Matsubara, N. Ohkubo, Y. Mori, Y. Nozawa, S. Murasawa, K. Kijima, K. Maruyama, H. Masaki, Y. Moriguchi, et al. Angiotensin II Type 2 Receptor Is Upregulated in Human Heart With Interstitial Fibrosis, and Cardiac Fibroblasts Are the Major Cell Type for Its Expression Circ. Res., November 16, 1998; 83(10): 1035 - 1046. [Abstract] [Full Text] [PDF]

This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Mori, Y. Articles by Inada, M. Search for Related Content PubMed PubMed Citation Articles by Mori, Y. Articles by Inada, M.