(Hypertension. 1997;29:388.)
© 1997 American Heart Association, Inc.
State-of-the-Art-Lecture |
Bovine Aortic Endothelial Cells Contain an Angiotensin-(1–7) Receptor
From The Hypertension Center, Bowman Gray School of Medicine of Wake Forest University, Winston-Salem, NC.
Correspondence to E. Ann Tallant, The Hypertension Center, Bowman Gray School of Medicine, Medical Center Blvd, Winston-Salem, NC 27157-1032
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Angiotensin-(1–7) is a novel peptide of the reninangiotensin system that counteracts the pressor and proliferative responses to angiotensin II. We now report that cultured bovine aortic endothelial cells contain a saturable, high-affinity [125I]angiotensin-(1–7) binding site with an affinity of 19.3±10.7 nmol/L and a density of 1351±710 fmol/mg protein. Angiotensin-(1–7) competed at a second lower-affinity site, with an IC50 of 2.9 µmol/L. The high-affinity angiotensin II receptor antagonist sarcosine1-isoleucine8-angiotensin II blocked [125I]angiotensin-(1–7) binding to bovine aortic endothelial cells at both a high-(IC50=1.3 nmol/L) and a low-affinity (IC50=6.2 µmol/L) binding site. In contrast, D-alanine7-angiotensin-(1–7) completely blocked [125I]angiotensin-(1–7) binding, with an IC50 of 19.8 nmol/L, suggesting that D-alanine7-angiotensin-(1–7) may selectively block responses to angiotensin-(1–7) in endothelial cells. Neither the AT1 antagonist losartan nor the AT2 antagonist PD 123319 exhibited significant competition for [125I]angiotensin-(1–7) binding to endothelial cells isolated from bovine aorta, in agreement with the absence of detectable mRNAs encoding typical angiotensin receptor subtypes 1 or 2 (AT1 or AT2). Angiotensin II also competed for [125I]angiotensin-(1–7) binding to bovine aortic endothelial cells; however, the relative affinity was 13-fold lower than angiotensin-(1–7), suggesting a preference for angiotensin-(1–7) over angiotensin II. These results demonstrate that bovine aortic endothelial cells contain a unique non-AT1, non-AT2 angiotensin receptor that preferentially binds angiotensin-(1–7).
Key Words: angiotensin-(1–7) • angiotensin II • angiotensin receptor subtypes • endothelium • vascular
Abbreviations: ACE = angiotensin-converting enzyme • Ang = angiotensin • AT1, AT2 = angiotensin receptor subtype 1, subtype 2 • BAEC = bovine aortic endothelial cell(s) • DMEM = Dulbecco's modified Eagle's medium • FBS = fetal bovine serum • HFBA = heptafluorobutyric acid • RT-PCR = reverse-transcribed PCR • SHR = spontaneously hypertensive rat(s) • VSMC = vascular smooth muscle cell(s)
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Ang-(1–7), the N-terminal heptapeptide fragment of Ang II, was identified in the plasma and tissues of animals and humans, at concentrations similar to Ang II.1–6 In addition, circulating levels of Ang-(1–7) increased after treatment of rats, dogs, or humans with ACE inhibitors1–6 or hypertensive rats with the AT1 antagonist losartan.2 We showed that Ang-(1–7) is generated from either Ang I or Ang II by tissue endopeptidases, including neutral endopeptidase 24.11 (neprilysin), prolyl endopeptidase, or metallopeptidase 24.15 (thimet oligopeptidase).7–11 Thus, Ang-(1–7) is an endogenous component of the renin-angiotensin system, and peptide levels are significantly elevated after treatment with ACE inhibitors or AT1 receptor antagonists.
Ang-(1–7) was originally considered an inactive product of Ang II metabolism, on the basis of its inability to mimic the dipsogenic, vasoconstrictor, or aldosterone-secreting actions of Ang II.12 It is now known that Ang-(1–7) is a biologically active peptide hormone having distinct and often opposite effects from those of Ang II. Ang-(1–7) stimulates the activity of neuropeptidergic neurons that regulate vasopressin production and transmitter release13,14 and releases prostaglandins from astrocytes, smooth muscle cells and vascular endothelial cells.15–19 In contrast to the vasoconstrictive effects of Ang II, Ang-(1–7) acts as a vasodilator agent when injected into a vein,20 causes vasorelaxation of coronary artery rings,21,22 pial arterioles,23 and mesenteric arteries,24 and reduces blood pressure in SHR20 and renovascular hypertensive dogs.25 In addition, we recently showed that VSMC growth is inhibited by Ang-(1–7), in contrast to the growth-stimulatory effects of Ang II.26 Thus, Ang-(1–7) is a biologically active peptide that opposes the pressor and proliferative effects of Ang II.
Although the characteristics of an angiotensin peptide receptor that binds Ang-(1–7) were not previously described, we showed that the depressor and antiproliferative responses to Ang-(1–7) are inhibited by the nonselective sarcosine analogs of Ang II, but not by AT1- or AT2-selective antagonists. In pithed rats, the vasodepressor actions of Ang-(1–7) were unaffected by the AT1 antagonist losartan or the AT2 antagonist PD123319 but were inhibited by Sar1-Thr8-Ang II.27 Sar1-Thr8-Ang II or Sar1-Ile8-Ang II blocked VSMC growth inhibition by Ang-(1–7), but AT1-or AT2-selective receptor antagonists were ineffective.26 Furthermore, the vasodilation of canine or porcine coronary arteries by Ang-(1–7) was blocked by removal of the endothelium or by Sar1-Thr8-Ang II.21,22 However, neither an AT1 nor an AT2 antagonist blocked the vasodilation by Ang-(1–7) in porcine or canine rings. These results strongly suggest that Ang-(1–7) activates a unique non-AT1, non-AT2 angiotensin receptor. The current study was undertaken to characterize the endothelial receptor activated by Ang-(1–7).
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Cell-Culture Procedures
BAEC were isolated from bovine thoracic aorta obtained from a local slaughterhouse and transported to the laboratory in ice-cold PBS (50 mmol/L NaHPO4, 0.15 mol/L NaCl, pH 7.2) supplemented with antibiotics (100 µg/mL penicillin, 100 U/mL streptomycin, and 50 µg/mL Fungizone).28 Adipose and connective tissues were removed from the aorta to free the intercostal vessels, which were tied with 3-0 silk thread. For release of the endothelial cells, warm dispase (50 U/mL, Collaborative Research) in DMEM/F12 (50:50) containing antibiotics was incubated in the lumen of the aorta for 20 minutes. The aorta was washed with the same media supplemented with 10% FBS and heparin (100 µg/mL). The detached cells were isolated from the pooled incubation media and wash by centrifugation at 1000g. The cell pellet was resuspended in DMEM/F12 containing serum, heparin, and antibiotics and plated at a concentration of approximately 1x104 cells/cm2. The cultures were incubated in a humidified 37°C incubator gassed with 5% CO2 and 95% room air. The culture media was replaced on day 1 and every 2 to 3 days afterward. Subcultures were developed using trypsin-EDTA (0.01% trypsin, 0.02% EDTA) at a ratio of 1:5 to 10. Cells were used between passage 1 and 4.
BAEC were characterized by their morphology as polygonal cells forming a tight-fitting monolayer with a "cobblestone" appearance as well as by positive immunofluorescent staining with an antibody against factor VIII (von Willebrand factor). Contamination by fibroblasts or VSMC was determined by positive immunoreactivity using antibodies against fibronectin and VSMC-specific 
-actin, respectively. For indirect immunofluorescent microscopy, cells growing on coverslips were fixed with 100% methanol for 5 minutes at -20°C. Fatty acid-free BSA was added to prevent nonspecific binding. Antibodies against human factor VIII (Sigma Chemical Co; 1:100), smooth muscle-specific -actin (Sigma; 1:100), or fibronectin (Sigma; 1:100) were incubated with the cells for 2 hours at room temperature. The coverslips were incubated for an additional 30 minutes in FITC-conjugated second antibody (either rabbit or mouse; Organon Teknika Corporation; 1:200). The immunofluorescent products were visualized by using a fluorescent microscope.
Preparation of BAEC Membranes
BAEC were washed with cold PBS and physically detached by using a rubber policeman. Cells were collected by centrifugation at 1500g for 5 minutes. The cell pellet was immediately used for the preparation of membranes or frozen at -80°C for subsequent membrane preparation. There was no significant difference in binding to membranes isolated from freshly isolated cells compared with frozen cells.
The cell pellet was homogenized in cold PBS containing 5 mmol/L EDTA, using 10 strokes of a glass/Teflon tissue homogenizer. Membranes were isolated by centrifugation at 30 000g for 20 minutes at 4°C and resuspended in HEPES-buffered saline (10 mmol/L HEPES, 0.1 mol/L NaCl, 5 mmol/L MgCl2, pH 7.4) containing 0.2% BSA and a cocktail of peptidase inhibitors (1 mmol/L EGTA, 1 mmol/L PMSF, 0.1 mg/mL soybean trypsin inhibitor, 2 µmol/L leupeptin, the prolyl endopeptidase inhibitor Z-proprolinal [10 µmol/L], the neprilysin inhibitor SCH 39370 [10 µmol/L], the aminopeptidase inhibitors bestatin and amastatin [both at a concentration of 10 µmol/L]). Protein was measured using the procedure of Lowry.29 Membranes were immediately used for binding.
Iodination and HPLC Purification of Ang-(1–7)
Ang-(1–7) was iodinated using chloramine T and separated from diiodinated peptide by HPLC, using procedures established in our laboratory.8,11,30 Radiolabeled Ang-(1–7) was extracted with methanol/TFA and chromatographed on a Waters Nova-Pak C18 column (2.1x150 mm) using an HFBA solvent system, consisting of 0.10% HFBA (mobile phase A) and 80% acetylnitrile/ 0.10% HFBA (mobile phase B). This system resolves unlabeled Ang-(1–7), mono-[125I]Ang-(1–7), and di-[125I]Ang-(1–7).
Measurement of [125I]Ang-(1–7) Binding
Binding assays were conducted using isolated membranes in HEPES-buffered saline (10 mmol/L HEPES, 0.10 mol/L NaCl, 5 mmol/L MgCl2, pH 7.4) containing 0.2% BSA and the cocktail of peptidase inhibitors, as described above. Nonspecific binding was measured in the presence of 10 µmol/L unlabeled Ang-(1–7). Saturation isotherms were constructed by incubation with increasing concentrations of the radioligand (from 0.1 to 22 nmol/L) to determine binding affinities (Kd) and maximal binding capacity (Bmax). For pharmacological characterization, competition curves were constructed by incubation with 0.75 nmol/L [125I]Ang-(1–7) and increasing concentrations (from 10-10 to 10-5 mol/L) of competing unlabeled Ang-(1–7), Ang II, or competing ligand [the AT1 antagonist losartan, the AT2 antagonist PD123319, the sarcosine analog of Ang II Sar1-Ile8-Ang II, or D-Ala7-Ang-(1–7)]. After a 45-minute incubation at room temperature, assays were terminated by vacuum filtration over glass fiber filters (GF/B) presoaked in 0.5% BSA. The filters were washed with 4x2 mL PBS. Radioactive content on dried filters was quantified in a gamma counter.
Binding isotherms were analyzed by Scatchard plots, using the EBDA/Ligand computer program (Elsevier-BIOSOFT). The results are expressed as mean±SEM. Competition binding data were fit to models with both one and two binding sites by non-linear regression analysis using the computer program PRISM. Goodness of fit was quantified by the sum of squares. The simpler equation was deemed the best fit unless the probability value was less than .05. To determine whether the amount of binding at each concentration of competing peptide or antagonist was significantly different from total binding, values were compared by one-way ANOVA, and significant differences were determined by Dunnett's post test, using the statistics program INSTAT (GraphPad Software).
RT-PCR of AT1 and AT2 Receptor mRNA
Total RNA was extracted from BAEC and bovine adrenal gland using TRIZOL according to the manufacturer's directions (GIBCO-BRL). RNA was incubated with RQ1 RNase-free DNase to degrade contaminating DNA, and purified by phenolchloroform extraction and ethanol precipitation. AMV reverse transcriptase and random primers were used to prepare cDNA from 1 µg of the treated RNA. One tenth of this reaction product was used for PCR. To detect AT1 mRNA, primers specific for the gene encoding the bovine AT1 receptor were prepared (sense: 5'CACCTATGTAAGATCGCTTC3'; antisense: 5'AGCCTTC TTGAGGGTCTTCCA3').31 Since the DNA sequence of the bovine AT2 receptor is not available, primers were designed on the basis of regions of complete sequence homology between the human and rat AT2 genes (sense: 5'TCTTATAGATATGACTG GCTC3'; antisense: 5'AAGTGCCAGGTCAATGACTGC3').32,33 For amplification of AT1 and AT2 receptor sequences, an initial denaturation step at 92°C for 7 minutes was followed by 35 cycles of 92°C for 1 minute (denaturation), 58°C for 1 minute (annealing), and 72°C for 1.5 minutes (extension). A final incubation at 72°C for 5 minutes ensured complete extension of the PCR products. Reaction products were separated by polyacrylamide gel electrophoresis, and the dried gels were analyzed by autoradiography.
Materials
125I-Sodium iodide (carrier free, 100 mCi/mL) was obtained from the Amersham Corporation. DMEM/F12 and FBS were obtained from MediaTech. Penicillin, streptomycin, and trypsin/ EDTA were purchased from GIBCO. Ang II, Ang-(1–7), and Sar1-Ile8-Ang II were obtained from Bachem Inc. D-Ala7-Ang-(1–7) was synthesized by the Protein Analysis Core of the Comprehensive Cancer Center at Wake Forest University. Losartan (losartan potassium; DuP 753) was a gift from Dr Ronald Smith of DuPont, Wilmington, Del, and PD 123319 was a gift from Dr Carol Germain of Parke Davis, Ann Arbor, Mich.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Isolated BAEC exhibited typical endothelial cell morphology, forming a confluent monolayer of polygonal cells "cobblestoned" in appearance. Cultured BAEC were greater than 95% pure, as determined by positive immunoreactivity with antibodies against von Willebrand factor (Factor VIII). A small number of contaminating cells (<5%) stained positively with an antibody against smooth muscle-specific
-actin. There were no positively stained cells using an antibody against fibronectin, indicating the absence of any contaminating fibroblasts. Optimal binding of [125I]Ang-(1–7) was observed in HEPES-buffered saline solution containing 0.2% BSA to reduce nonspecific binding and a cocktail of protease inhibitors to prevent breakdown of the radiolabel to smaller fragments. In preliminary studies, we measured the binding of [125I]Ang-(1–7) to membranes isolated from BAEC as a function of incubation time and protein concentration. Maximal binding was obtained after a 45-minute incubation with 20 µg of endothelial cell membranes, conditions subsequently used for all studies.
BAEC membranes were incubated with increasing concentrations of [125I]Ang-(1–7), from 0.1 to 22 nmol/L, to determine the optimal concentrations of the peptide for binding. Nonspecific binding was measured in the presence of 10 µmol/L unlabeled Ang-(1–7) and averaged from 10% to 20% of the total amount of binding. A typical saturation isotherm is shown in Fig 1. Scatchard analysis of saturation isotherms of endothelial cells isolated from three different animals indicated that [125I]Ang-(1–7) binds to BAEC with an affinity of 19.3±10.7 nmol/L and a density of 1351±710 fmol/mg protein. The Hill coefficient averaged 0.97±0.01, suggesting that BAEC contain a single binding component of high affinity.
|
To determine whether BAEC also contain a lower-affinity binding site, competition curves were generated using 0.75 nmol/L [125I]Ang-(1–7) and increasing concentrations of Ang-(1–7) from 10-10 to 10-5 mol/L. Ang-(1–7) caused a dose-dependent inhibition of binding, as shown in Fig 2. Ang-(1–7) competed for 54% of the total amount of binding with an IC50 of 10.2 nmol/L, corresponding to the high-affinity site identified by Scatchard analysis. Competition for the remaining 46% of the binding sites by Ang-(1–7) was of lower affinity, with an IC50 of 2.9 µmol/L.
|
The competition for [125I]Ang-(1–7) binding to BAEC was measured by increasing concentrations of the AT1 antagonist losartan, the AT2 antagonist PD 123319, and the nonselective sarcosine analog antagonist Sar1-Ile8-Ang II, to examine the receptor subtype binding Ang-(1–7). The competition by D-Ala7-Ang-(1–7), which blocked the antidiuretic effect of Ang-(1–7) in water-loaded rats,34 was also assessed. The specific binding of 125I-Ang-(1–7) was blocked by Sar1-Ile8-Ang II, as shown in Fig 3. The best-fit competition curve suggests that Sar1-Ile8-Ang II competes for Ang-(1–7) binding at both a high-affinity (IC50=1.3 nmol/L) and low-affinity site (IC50=5.2 µmol/L). In addition, the specific [125I]Ang-(1–7) binding was inhibited by D-Ala7-Ang-(1–7), with an IC50 of 19.8 nmol/L, suggesting that D-Ala7-Ang-(1–7) may block responses to Ang-(1–7) in endothelial cells. In contrast, the AT1 selective antagonist losartan did not significantly compete for [125I]Ang-(1–7) binding at the concentrations tested (10-10 to 10-5 mol/L). Although a small percentage of the binding of [125I]Ang-(1–7) to BAEC was competed for by PD 123319, the inhibition was not statistically different from total binding.
|
Total RNA was isolated from BAEC and analyzed by PCR using primers based on the cloned AT1 and AT2 receptors to assess the presence of the mRNA encoding a typical AT1 or AT2 receptor in BAEC. As a control, total RNA was isolated from bovine adrenal tissue which contains both AT1 and AT2 receptors.35,36 PCR analysis of DNA isolated from BAEC using the primers for either the AT1 or AT2 receptors yielded products of the expected sizes (data not shown), demonstrating that the primers amplified DNA sequences specific for the AT1 or AT2 receptors. As shown in Fig 4, both AT1 and AT2 mRNAs were detected in bovine adrenal tissue by RT-PCR. However, neither the AT1 nor the AT2 mRNA was detected in BAEC.
|
The competition for [125I]Ang-(1–7) binding was measured by increasing concentrations of Ang II, to determine the selectivity of this binding site for angiotensin peptides. The best-fit curve of the competition data shows that Ang II competed at a single site with an IC50 of 131 nmol/L (derived from the competition for [125I]Ang-(1–7) by 10-10 to 10-5 mol/L Ang II in cell membranes isolated from three different animals; data not shown). This indicates that Ang II competes for [125I]Ang-(1–7) binding with an affinity 13-fold lower than Ang-(1–7), suggesting that the endothelial Ang-(1–7) binding site prefers Ang-(1–7) over Ang II.
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
This study shows, for the first time, that Ang-(1–7) binds to a novel angiotensin peptide receptor that does not recognize selective AT1 or AT2 receptor antagonists. In addition, the mRNAs for the typical AT1 or AT2 receptors were not expressed in BAEC. The Ang-(1–7) binding was saturable, of high affinity, and was not inhibited by the AT1 antagonist losartan or the AT2 antagonist PD 123319. In contrast, [125I]Ang-(1–7) binding was prevented by Sar1-Ile8-Ang II, in agreement with previous studies showing that sarcosine derivatives of Ang II blocked responses to Ang-(1–7) in both the endothelium21,22 and cultured vascular cells.19,26 [125I]Ang-(1–7) binding to BAEC was completely inhibited by D-Ala7-Ang-(1–7), with an IC50 of 19.8 nmol/L. Santos et al34 showed that D-Ala7-Ang-(1–7) selectively blocked the antidiuretic effects of Ang-(1–7) in water-loaded rats as well as the changes in blood pressure produced by Ang-(1–7) injection into the medulla oblongata. Furthermore, D-Ala7-Ang-(1–7) did not compete for binding of [125I]Ang II to rat adrenal AT1 or AT2 receptors.34 The ability of D-Ala7-Ang-(1–7) to compete for [125I]Ang-(1–7) binding to BAEC with high affinity suggests that it may selectively block responses to Ang-(1–7) in endothelial cells.
This is the first characterization of a high-affinity [125I]Ang-(1–7) binding site in cultured cells. However, we previously showed that [125I]Ang-(1–7) binds to canine dorsal medulla oblongata37 as well as the rat adrenal and pituitary glands.38 Ang-(1–7) binding in both the dog and rat was of high affinity (2 to 4 nmol/L) and was specifically displaced by excess unlabeled Ang-(1–7). The ability of Ang-(1–7) to displace [125I]Ang II binding from various tissues and cell types was also investigated. We showed that Ang-(1–7) was a poor competitor for the AT1 receptor on porcine VSMC with an IC50 > 1 µmol/L18 or the AT2 receptor on differentiated NG108-15 cells39 and pancreatic acinar cells.40 Ang-(1–7) exhibited little affinity for the Ang IV receptor on BAEC, with an IC50 of 800 nmol/L.41 In contrast, Ang-(1–7) was a potent competitor for the [125I]Ang II binding site on human cardiac fibroblasts, with an IC50 of 10 nmol/L,42 and on rat mesangial cells (IC50=30 nmol/L).43 These results demonstrated that intact tissues contain high-affinity Ang-(1–7) binding sites and suggest that high-affinity Ang-(1–7) receptors may also be present in the brain, pituitary, adrenal glands, and kidney.
[125I]Ang-(1–7) binding to BAEC was not significantly reduced by either the AT1 antagonist losartan or the AT2 antagonist PD 123319. Furthermore, the mRNA for the typical AT1 or AT2 receptor was not detected in total RNA isolated from BAEC. The absence of an AT1 receptor in bovine endothelial cells was not unexpected, since Vaughan et al44 did not find AT1 receptor mRNA on Northern blots of total RNA from BAEC, using a cDNA probe against the bovine AT1 receptor. These results agree with previous studies by us22 and others21 showing that the endothelial-dependent vasodilation of canine or porcine coronary artery rings by Ang-(1–7) was not inhibited by AT1 or AT2 receptor antagonists. In contrast, Stoll et al45 reported that endothelial cells contain both AT1 and AT2 receptors that were coupled to the regulation of cell proliferation. However, their endothelial cells were isolated from the coronary vessels of SHR, suggesting variable expression of Ang II receptors in endothelial cells isolated from different species or from hypertensive animals.
[125I]Ang-(1–7) binding to BAEC was inhibited by Ang-(1–7) in a dose-dependent manner. Comparison of the binding data to models of one- and two-site fits indicated that Ang-(1–7) binds to both a high- and low-affinity site on BAEC (R2=.94; P<.05 for comparison on a one- and two-site fit). The high-affinity site corresponded to the site identified by Scatchard analysis. The low-affinity site may represent binding to an enzyme or to a G-protein-uncoupled form of the receptor. Ang II also competed for [125I]Ang-(1–7) binding to BAEC in a dose-dependent manner. The best-fit curve for binding inhibition by Ang II suggested that Ang II competes for Ang-(1–7) binding at a single site, with an IC50 of 131 nmol/L (R2=.88). This suggests that Ang-(1–7) binds to an endothelial receptor that shows a preference for Ang-(1–7) over Ang II. If the data for competition of [125I]Ang-(1–7) binding to BAEC by Ang II are modeled to a two-site fit, both a high-affinity (IC50=10.3 nmol/L, 31% of the total binding sites) and a low-affinity site (IC50=0.5 µmol/L, 69% of the total binding sites) are identified. However, comparison of the one-site and two-site binding curves by sum of squares indicated that the one-site model best fits the binding data (P=.46). This suggests that Ang II will bind to the endothelial Ang-(1–7) receptor, albeit at higher concentrations than Ang-(1–7).
We did not investigate the signal transduction mechanisms coupled to this novel Ang-(1–7) receptor in BAEC. However, we previously showed that Ang-(1–7) stimulates the release of prostaglandins from porcine aortic endothelial cells,19 as well as VSMC and astrocytes.15,18 The depressor effect of Ang-(1–7) in the areflexic rat27 and the vasodilation of piglet arterioles by Ang-(1–7)23 were blocked by inhibitors of prostaglandin synthesis, suggesting that Ang-(1–7) stimulated the release of prostaglandins. In contrast, inhibitors of nitric oxide synthase blocked the Ang-(1–7)-mediated vasodilation of canine or porcine coronary arteries21,22 and attenuated the depressor effects of Ang-(1–7) in the renovascular dog.25 The vasodilation of canine or porcine coronary arteries by Ang-(1–7) was also partially inhibited by the bradykinin B2 antagonist, Hoe 140, suggesting that Ang-(1–7) may interact with the kinin system.21,22 Thus, the Ang-(1–7) receptor on BAEC may be coupled to the release of various autocoids including prostaglandins, nitric oxide, or kinins.
Circulating levels of Ang-(1–7) are elevated after treatment of rats, dogs, or humans with ACE inhibitors.1–6 We recently showed that the plasma concentration of Ang-(1–7) was significantly increased after chronic but not acute therapy with the ACE inhibitor captopril.3 This agrees with previous studies in which the Ang-(1–7) level in rat plasma was significantly elevated after administration of ACE inhibitors.4,6 Ang-(1–7) is also present in the urine of both rats46 and humans.47 Recent findings indicate that urinary levels of Ang-(1–7) are significantly reduced in patients with essential hypertension and negatively correlate with blood pressure, suggesting that Ang-(1–7) may function as an endogenous antihypertensive.47 We also showed that responses to Ang-(1–7) are potentiated in three different models of hypertension—the SHR, the hypertensive renovascular dog, and the [mRen2]27 hypertensive rat.2,20,25 Systemic infusions of Ang-(1–7) in the SHR caused a significant reduction in the circulating levels of vasopressin, an increase in urinary prostaglandin excretion, diuresis and natriuresis, and a reduction in mean arterial pressure on day 2 of the infusion.20 Systemic infusion of Ang-(1–7) produced none of these effects in either normotensive WKY or Sprague-Dawley rats, suggesting an enhanced responsiveness to Ang-(1–7) in the SHR. The characterization of a binding site for Ang-(1–7) in endothelial cells in culture will facilitate better understanding of the role of Ang-(1–7) in the regulation of blood pressure.
In conclusion, BAEC contain a high-affinity Ang-(1–7) receptor that is not a typical AT1 or AT2 receptor. The relative affinity of this receptor is higher for Ang-(1–7) than for Ang II, indicating a preference for Ang-(1–7) over Ang II. D-Ala7-Ang-(1–7) competes for binding to the Ang-(1–7) receptor with high affinity and may selectively block responses to Ang-(1–7) in endothelial cells. The unique characteristics of this receptor strongly suggest that endothelial cells contain a novel angiotensin peptide receptor that shows preference for Ang-(1–7).
|
Acknowledgments |
|---|
This work was supported in part by grants NS-31664 (to Dr Tallant), HL-51952 (to Dr Ferrario), and HL-50066 (to Dr Ferrario and Dr Tallant) from the National Institutes of Health, a Losartan Medical School grant from Merck, Inc (to Drs Ferrario and Tallant), and a grant-in-aid from the American Heart Association (to Dr Tallant). The authors gratefully acknowledge the technical assistance of June Tessiatore-Higson and Carolyn Kiger. We thank Dr Patricia Gallagher and Dr Debra Diz for helpful discussions in the preparation of this manuscript.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Kohara K, Brosnihan KB, Chappell MC, Khosla MC, Ferrario CM. Angiotensin-(1–7): a member of circulating angiotensin peptides. Hypertension. 1991; 17 : 131 –138.
2. Moriguchi A, Brosnihan KB, Kumagai H, Ganten D, Ferrario CM. Mechanisms of hypertension in transgenic rats expressing the mouse Ren-2 gene. Am J Physiol. 1994; 266 : R1273 –R1279.[Medline] [Order article via Infotrieve]
3. Luque M, Martin P, Martell N, Fernandez C, Brosnihan KB, Ferrario CM. Effects of captopril related to increased levels of prostacyclin and angiotensin-(1–7) in essential hypertension. J Hypertens. 1996; 14 : 799 –805.[Medline] [Order article via Infotrieve]
4. Campbell DJ, Kladis A, Duncan A-M. Nephrectomy, converting enzyme inhibition, and angiotensin peptides.
Hypertension. 1993;
22
: 513
–522.
5. Lawrence AC, Evin G, Kladis A, Campbell DJ. An alternative strategy for the radioimmunoassay of angiotensin peptides using amino-terminal-directed antisera: measurement of eight angiotensin peptides in human plasma. J Hypertens. 1990; 8 : 715 –724.[Medline] [Order article via Infotrieve]
6. Kohara K, Brosnihan KB, Ferrario CM. Angiotensin-(1–7) in the spontaneously hypertensive rat. Peptides. 1993; 14 : 883 –891.[Medline] [Order article via Infotrieve]
7. Santos RAS, Brosnihan KB, Jacobsen DW, DiCorleto P, Ferrario CM. Production of Ang-(1–7) by human vascular endothelium. Hypertension. 1992; 19 (suppl II): II-56 –II-61.[Medline] [Order article via Infotrieve]
8. Chappell MC, Tallant EA, Brosnihan KB, Ferrario CM. Processing of angiotensin peptides by NG108-15 neuroblastoma X glioma hybrid cell line. Peptides. 1990; 22 : 375 –380.
9. Santos RA, Brosnihan KB, Chappell MC, Pesquero J, Chernicky CL, Greene LJ, Ferrario CM. Converting enzyme activity and angiotensin metabolism in the dog brainstem. Hypertension. 1988; 11 (suppl I): I-53 –I-57.
10. Yamamoto K, Chappell MC, Brosnihan KB, Ferrario CM. In vivo metabolism of angiotensin I by neutral endopeptidase (EC 3.4.24.11) in spontaneously hypertensive rats.
Hypertension. 1992;
19
: 692
–696.
11. Chappell MC, Tallant EA, Brosnihan KB, Ferrario CM. Conversion of angiotensin I to angiotensin-(1–7) by thimet oligopeptidase (E.C.3.4.24.15) in vascular smooth muscle cells. J Vasc Biol Med. 1995; 5 : 129 –137.
12. Ferrario CM, Brosnihan KB, Diz DI, Jaiswal N, Khosla MC, Milsted A, Tallant EA. Angiotensin-(1–7): a new hormone of the angiotensin system. Hypertension. 1991; 18 (suppl III): III-126 –III-133.[Medline] [Order article via Infotrieve]
13. Schiavone MT, Santos RAS, Brosnihan KB, Khosla MC, Ferrario CM. Release of vasopressin from the rat hypothalamo-neurohypophysial system by angiotensin-(1–7) heptapeptide.
Proc Natl Acad Sci U S A. 1988;
85
: 4095
–4098.
14. Ambuhl P, Felix D, Imboden H, Khosla MC, Ferrario CM. Effects of angiotensin analogs and angiotensin receptor antagonists on paraventricular neurons. Regul Pept. 1992; 38 : 111 –120.[Medline] [Order article via Infotrieve]
15. Tallant EA, Jaiswal N, Diz DI, Ferrario CM. Human astrocytes contain two distinct angiotensin receptor subtypes.
Hypertension. 1991;
18
: 32
–39.
16. Jaiswal N, Tallant EA, Diz DI, Khosla MC, Ferrario CM. Subtype 2 angiotensin receptors mediate prostaglandin synthesis in human astrocytes.
Hypertension. 1991;
17
: 1115
–1120.
17. Jaiswal N, Jaiswal RK, Tallant EA, Diz DI, Ferrario CM. Alterations in prostaglandin production in spontaneously hypertensive rat smooth muscle cells.
Hypertension. 1993;
21
: 900
–905.
18. Jaiswal N, Tallant EA, Jaiswal RK, Diz DI, Ferrario CM. Differential regulation of prostaglandin synthesis by angiotensin peptides in porcine aortic smooth muscle cells: subtypes of angiotensin receptors involved.
J Pharmacol Exp Ther. 1993;
265
: 664
–673.
19. Jaiswal N, Diz DI, Chappell MC, Khosla MC, Ferrario CM. Stimulation of endothelial cell prostaglandin production by angiotensin peptides: characterization of receptors. Hypertension. 1992; 19 (suppl II): II-49 –II-55.[Medline] [Order article via Infotrieve]
20. Benter IF, Ferrario CM, Morris M, Diz DI. Antihypertensive actions of angiotensin-(1–7) in spontaneously hypertensive rats. Am J Physiol. 1995; 269 : H313 –H319.[Medline] [Order article via Infotrieve]
21. Porsti I, Bara AT, Busse R, Hecker M. Release of nitric oxide by angiotensin-(1–7) from porcine coronary endothelium: implications for a novel angiotensin receptor. Br J Pharmacol. 1994; 111 : 652 –654.[Medline] [Order article via Infotrieve]
22. Brosnihan KB, Li P, Ferrario CM. Angiotensin-(1–7) dilates canine coronary arteries through kinins and nitric oxide.
Hypertension. 1996;
27
: 523
–528.
23. Meng W, Busija DW. Comparative effects of angiotensin-(1–7) and angiotensin II on piglet pial arterioles.
Stroke. 1993;
24
: 2041
–2045.
24. Osei SY, Ahima RS, Minkes RK, Weaver JP, Khosla MC, Kadowitz PJ. Differential responses to angiotensin-(1–7) in the feline mesenteric and hindquarters vascular beds. Eur J Pharmacol. 1993; 234 : 35 –42.[Medline] [Order article via Infotrieve]
25. Nakamoto H, Ferrario CM, Fuller SB, Robaczwski DL, Winicov E, Dean RH. Angiotensin-(1–7) and nitric oxide interaction in renovascular hypertension.
Hypertension. 1995;
25
: 796
–802.
26. Freeman EJ, Chisolm GM, Ferrario CM, Tallant EA. Angiotensin-(1–7) inhibits vascular smooth muscle cell growth.
Hypertension. 1996;
28
: 104
–108.
27. Benter IF, Diz DI, Ferrario CM. Cardiovascular actions of angiotensin-(1–7). Peptides. 1993; 14 : 679 –684.[Medline] [Order article via Infotrieve]
28. Cocks TM, Angus JA, Campbell JH, Campbell GR. Release and properties of endothelium-derived relaxing factor (EDRF) from endothelial cells in culture. J Cell Physiol. 1985; 123 : 310 –320.[Medline] [Order article via Infotrieve]
29. Lowry OH, Rosebrough MJ, Farr AL, Randall RJ. Protein measurement with the folin-phenol reagent.
J Biol Chem. 1951;
193
: 265
–275.
30. Chappell MC, Brosnihan KB, Diz DI, Ferrario CM. Identification of angiotensin-(1–7) in rat brain: evidence for differential processing of angiotensin peptides.
J Biol Chem. 1989;
264
: 16518
–16521.
31. Sasaki K, Yamano Y, Bardhan S, Iwai N, Murray JJ, Hasegawa M, Matsuda Y, Inagami T. Cloning and expression of a complementary DNA encoding a bovine adrenal angiotensin II type-1 receptor. Nature. 1991; 351 : 230 –233.[Medline] [Order article via Infotrieve]
32. Kambayash Y, Bardhan S, Takahashi K, Tsuzuki S, Inui H, Hamakubo T, Inagami T. Molecular cloning of a novel angiotensin II receptor isoform involved in phosphotyrosine phosphatase inhibition.
J Biol Chem. 1993;
268
: 24543
–24546.
33. Tsuzuki S, Ichiki T, Nakakubo H, Kitami Y, Guo D-F, Shirai H, Inagami T. Molecular cloning and expression of the gene encoding human angiotensin II type 2 receptor. Biochem Biophys Res Commun. 1994; 200 : 1449 –1454.[Medline] [Order article via Infotrieve]
34. Santos RAS, Campagnole-Santos MJ, Baracho NCV, Fontes MAP, Silva LCS, Neves LAA, Oliveira DR, Caligiorne SM, Rodrigues ARV, Gropen C Jr, Carvalho WS, Silva ACSE, Khosla MC. Characterization of a new angiotensin antagonist selective for angiotensin-(1–7): evidence that the actions of angiotensin-(1–7) are mediated by specific angiotensin receptors. Brain Res Bull. 1994; 35 : 293 –298.[Medline] [Order article via Infotrieve]
35. Laredo J, Hamilton BP, Shah JR, Hamlyn JM. Angiotensin type-2 receptor mediates the secretion of endogenous ouabain from bovine adrenocortical cells. Hypertension. 1996; 28 : 511 . Abstract.
36. Quali R, Poulette S, Penhoat A, Saez JM. Characterization and coupling of angiotensin-II receptor subtypes in cultured bovine adrenal fasciculata cells. J Steroid Biochem Mol Biol. 1992; 43 : 271 –280.[Medline] [Order article via Infotrieve]
37. Diz DI, Ferrario CM. Angiotensin receptor heterogeneity in the dorsal medulla oblongata as defined by angiotensin-(1–7). In: Raizada MK, Phillips MI, Sumners C, eds. Recent Advances in Cellular and Molecular Aspects of Angiotensin Receptors. New York, NY: Plenum Press; 1996: 225 –235.
38. Diz DI, Bosch SM, Ferrario CM. High affinity angiotensin-(1–7) binding sites in the rat brain, pituitary and adrenal. FASEB J. 1992; 6 : A1165 . Abstract.
39. Tallant EA, Diz DI, Khosla MC, Ferrario CM. Identification and regulation of angiotensin II receptor subtypes on NG108-15 cells.
Hypertension. 1991;
17
: 1135
–1143.
40. Chappell MC, Jacobsen DW, Tallant EA. Characterization of angiotensin II receptor subtypes in pancreatic acinar AR42J cells. Peptides. 1995; 16 : 741 –747.[Medline] [Order article via Infotrieve]
41. Bernier SG, Servant G, Boudreau M, Fournier A, Guillemette G. Characterization of a binding site for angiotensin IV on bovine aortic endothelial cells. Eur J Pharmacol. 1995; 291 : 191 –200.[Medline] [Order article via Infotrieve]
42. Neub M, Regitz-Zagrosek V, Hildebrandt A, Fleck E. Human cardiac fibroblasts express an angiotensin receptor with unusual binding characteristics which is coupled to cellular proliferation. Biochem Bio-phys Res Commun. 1994; 204 : 1334 –1339.[Medline] [Order article via Infotrieve]
43. Ernsberger P, Zhou J, Damon TH, Douglas JG. Angiotensin II receptor subtypes in cultured rat renal mesangial cells. Am J Physiol. 1992; 263 : F411 –F416.[Medline] [Order article via Infotrieve]
44. Vaughan DE, Lazos SA, Tong K. Angiotensin II regulates the expression of plasminogen activator inhibitor-I in cultured endothelial cells. J Clin Invest. 1995; 95 : 995 –1001.[Medline] [Order article via Infotrieve]
45. Stoll M, Steckelings UM, Paul M, Bottari SP, Metzger R, Unger T. The angiotensin AT2-receptor mediates inhibition of cell proliferation in coronary endothelial cells. J Clin Invest. 1995; 95 : 651 –657.[Medline] [Order article via Infotrieve]
46. Chappell MC, Diz DI, Ferrario CM. Urinary angiotensin-(1–7): influence of converting enzyme and neprilysin inhibition. Hypertension. 1995; 26 : 542 . Abstract.
47. Ferrario CM, Martell N, Pinillas C, Yunis C, Brosnihan KB, Chappell MC, Novikov S, Perez D, Flack JM, Luque M. Essential hypertension is associated with low urinary levels of angiotensin-(1–7). Hypertension. 1996; 28 : 515 . Abstract.
This article has been cited by other articles:
 |
|
 |
|
  D. R. Soto-Pantoja, J. Menon, P. E. Gallagher, and E. A. Tallant Angiotensin-(1-7) inhibits tumor angiogenesis in human lung cancer xenografts with a reduction in vascular endothelial growth factor Mol. Cancer Ther., June 1, 2009; 8(6): 1676 - 1683. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. O. Sampaio, R. A. Souza dos Santos, R. Faria-Silva, L. T. da Mata Machado, E. L. Schiffrin, and R. M. Touyz Angiotensin-(1-7) Through Receptor Mas Mediates Endothelial Nitric Oxide Synthase Activation via Akt-Dependent Pathways Hypertension, January 1, 2007; 49(1): 185 - 192. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Iwata, R. T. Cowling, D. Gurantz, C. Moore, S. Zhang, J. X.-J. Yuan, and B. H. Greenberg Angiotensin-(1-7) binds to specific receptors on cardiac fibroblasts to initiate antifibrotic and antitrophic effects Am J Physiol Heart Circ Physiol, December 1, 2005; 289(6): H2356 - H2363. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. E. Walters, T. A. Gaspari, and R. E. Widdop Angiotensin-(1-7) Acts as a Vasodepressor Agent Via Angiotensin II Type 2 Receptors in Conscious Rats Hypertension, May 1, 2005; 45(5): 960 - 966. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. E. Gallagher and E.A. Tallant Inhibition of human lung cancer cell growth by angiotensin-(1-7) Carcinogenesis, November 1, 2004; 25(11): 2045 - 2052. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Ebihara, G. Seno Di Marco, M. Aparecida Juliano, and D. E. Casarini Neutral endopeptidase expression in mesangial cells Journal of Renin-Angiotensin-Aldosterone System, December 1, 2003; 4(4): 228 - 233. [Abstract] [PDF]
|
|
|
|
 |
|
 L. S. Zisman, R. S. Keller, B. Weaver, Q. Lin, R. Speth, M. R. Bristow, and C. C. Canver Increased Angiotensin-(1-7)-Forming Activity in Failing Human Heart Ventricles: Evidence for Upregulation of the Angiotensin-Converting Enzyme Homologue ACE2 Circulation, October 7, 2003; 108(14): 1707 - 1712. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. A. A. Neves, A. F. Williams, D. B. Averill, C. M. Ferrario, M. P. Walkup, and K. B. Brosnihan Pregnancy Enhances the Angiotensin (Ang)-(1-7) Vasodilator Response in Mesenteric Arteries and Increases the Renal Concentration and Urinary Excretion of Ang-(1-7) Endocrinology, August 1, 2003; 144(8): 3338 - 3343. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Haulica, W. Bild, C. N Mihaila, T. Ionita, C. P Boisteanu, and B. Neagu Biphasic effects of angiotensin (1-7) and its interactions with angiotensin II in rat aorta Journal of Renin-Angiotensin-Aldosterone System, June 1, 2003; 4(2): 124 - 128. [Abstract] [PDF]
|
|
|
|
|
|
W. O. Sampaio, A. A. S. Nascimento, and R. A. S. Santos Regulation of Cardiovascular Signaling by Kinins and Products of Similar Converting Enzyme Systems: Systemic and regional hemodynamic effects of angiotensin-(1-7) in rats Am J Physiol Heart Circ Physiol, June 1, 2003; 284(6): H1985 - H1994. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Vauquelin, Y. Michotte, I. Smolders, S. Sarre, G. Ebinger, A. Dupont, and P. Vanderheyden Cellular targets for angiotensin II fragments: pharmacological and molecular evidence Journal of Renin-Angiotensin-Aldosterone System, December 1, 2002; 3(4): 195 - 204. [Abstract] [PDF]
|
|
|
|
|
|
G. Wiemer, L. W. Dobrucki, F. R. Louka, T. Malinski, and H. Heitsch AVE 0991, a Nonpeptide Mimic of the Effects of Angiotensin-(1-7) on the Endothelium Hypertension, December 1, 2002; 40(6): 847 - 852. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Kucharewicz, R. Pawlak, T. Matys, D. Pawlak, and W. Buczko Antithrombotic Effect of Captopril and Losartan Is Mediated by Angiotensin-(1-7) Hypertension, November 1, 2002; 40(5): 774 - 779. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Xu, O. A. Carretero, Y.-H. Liu, E. G. Shesely, F. Yang, A. Kapke, and X.-P. Yang Role of AT2 Receptors in the Cardioprotective Effect of AT1 Antagonists in Mice Hypertension, September 1, 2002; 40(3): 244 - 250. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Ren, J. L. Garvin, and O. A. Carretero Vasodilator Action of Angiotensin-(1-7) on Isolated Rabbit Afferent Arterioles Hypertension, March 1, 2002; 39(3): 799 - 802. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Sasaki, Y. Higashi, K. Nakagawa, H. Matsuura, G. Kajiyama, and T. Oshima Effects of Angiotensin-(1-7) on Forearm Circulation in Normotensive Subjects and Patients With Essential Hypertension Hypertension, July 1, 2001; 38(1): 90 - 94. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Heringer-Walther, E. N. Batista, T. Walther, M. C. Khosla, R. A. S. Santos, and M. J. Campagnole-Santos Baroreflex Improvement in SHR After ACE Inhibition Involves Angiotensin-(1-7) Hypertension, May 1, 2001; 37(5): 1309 - 1314. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. D. P. Machado, R. A. S. Santos, and S. P. Andrade Mechanisms of angiotensin-(1-7)-induced inhibition of angiogenesis Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2001; 280(4): R994 - R1000. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. M. Moritz, D. J. Campbell, and E. M. Wintour Angiotensin-(1-7) in the ovine fetus Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2001; 280(2): R404 - R409. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Heitsch, S. Brovkovych, T. Malinski, and G. Wiemer Angiotensin-(1-7)-Stimulated Nitric Oxide and Superoxide Release From Endothelial Cells Hypertension, January 1, 2001; 37(1): 72 - 76. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. L. Malendowicz, P. V. Ennezat, M. Testa, L. Murray, E. H. Sonnenblick, T. Evans, and T. H. LeJemtel Angiotensin II Receptor Subtypes in the Skeletal Muscle Vasculature of Patients With Severe Congestive Heart Failure Circulation, October 31, 2000; 102(18): 2210 - 2213. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. K. HANDA Metabolism Alters the Selectivity of Angiotensin-(1-7) Receptor Ligands for Angiotensin Receptors J. Am. Soc. Nephrol., August 1, 2000; 11(8): 1377 - 1386. [Abstract] [Full Text]
|
|
|
|
 |
|
 M. A. P. FONTES, O. BALTATU, S. M. CALIGIORNE, M. J. CAMPAGNOLE-SANTOS, D. GANTEN, M. BADER, and R. A. S. SANTOS Angiotensin peptides acting at rostral ventrolateral medulla contribute to hypertension of TGR(mREN2)27 rats Physiol Genomics, April 27, 2000; 2(3): 137 - 142. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Hayashi, A. Miyamoto, B. Berisha, M. R. Kosmann, K. Okuda, and D. Schams Regulation of Angiotensin II Production and Angiotensin Receptors in Microvascular Endothelial Cells from Bovine Corpus Luteum Biol Reprod, January 1, 2000; 62(1): 162 - 167. [Abstract] [Full Text]
|
|
|
|
|
|
M. C. Chappell, M. N. Gomez, N. T. Pirro, and C. M. Ferrario Release of Angiotensin-(1-7) From the Rat Hindlimb : Influence of Angiotensin-Converting Enzyme Inhibition Hypertension, January 1, 2000; 35(1): 348 - 352. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Linz, P. Wohlfart, B. A Scholkens, T. Malinski, and G. Wiemer Interactions among ACE, kinins and NO Cardiovasc Res, August 15, 1999; 43(3): 549 - 561. [Full Text] [PDF]
|
|
|
|
|
|
A. J. M. Roks, P. P. van Geel, Y. M. Pinto, H. Buikema, R. H. Henning, D. de Zeeuw, and W. H. van Gilst Angiotensin-(1–7) Is a Modulator of the Human Renin-Angiotensin System Hypertension, August 1, 1999; 34(2): 296 - 301. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. K. Handa Angiotensin-(1-7) can interact with the rat proximal tubule AT4 receptor system Am J Physiol Renal Physiol, July 1, 1999; 277(1): F75 - F83. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Yamada, S. N. Iyer, M. C. Chappell, D. Ganten, and C. M. Ferrario Converting Enzyme Determines Plasma Clearance of Angiotensin-(1–7) Hypertension, September 1, 1998; 32(3): 496 - 502. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Gorelik, L. A. Carbini, and A. G. Scicli Angiotensin 1-7 Induces Bradykinin-Mediated Relaxation in Porcine Coronary Artery J. Pharmacol. Exp. Ther., July 1, 1998; 286(1): 403 - 410. [Abstract] [Full Text]
|
|
|
|
|
|
S. N. Iyer, M. C. Chappell, D. B. Averill, D. I. Diz, and C. M. Ferrario Vasodepressor Actions of Angiotensin-(1–7) Unmasked During Combined Treatment With Lisinopril and Losartan Hypertension, February 1, 1998; 31(2): 699 - 705. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Gohlke, C. Pees, and T. Unger AT2 Receptor Stimulation Increases Aortic Cyclic GMP in SHRSP by a Kinin-Dependent Mechanism Hypertension, January 1, 1998; 31(1): 349 - 355. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. N. Iyer, C. M. Ferrario, and M. C. Chappell Angiotensin-(1-7) Contributes to the Antihypertensive Effects of Blockade of the Renin-Angiotensin System Hypertension, January 1, 1998; 31(1): 356 - 361. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Dimmeler, V. Rippmann, U. Weiland, J. Haendeler, and A. M. Zeiher Angiotensin II Induces Apoptosis of Human Endothelial Cells : Protective Effect of Nitric Oxide Circ. Res., December 19, 1997; 81(6): 970 - 976. [Abstract] [Full Text]
|
|
|
|
|
|
C. M. Ferrario, M. C. Chappell, E. A. Tallant, K. B. Brosnihan, and D. I. Diz Counterregulatory Actions of Angiotensin-(1-7) Hypertension, September 1, 1997; 30(3): 535 - 541. [Abstract] [Full Text]
|
|
|
|
|
|
R. R. Britto, R. A. S. Santos, C. R. Fagundes-Moura, M. C. Khosla, and M. J. Campagnole-Santos Role of Angiotensin-(1-7) in the Modulation of the Baroreflex in Renovascular Hypertensive Rats Hypertension, September 1, 1997; 30(3): 549 - 556. [Abstract] [Full Text]
|
|
|
|
 |
|
 C. F. Deacon, A. Plamboeck, S. Moller, and J. J. Holst GLP-1-(9-36) amide reduces blood glucose in anesthetized pigs by a mechanism that does not involve insulin secretion Am J Physiol Endocrinol Metab, April 1, 2002; 282(4): E873 - E879. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||