(Hypertension. 1997;30:1356-1361.)
© 1997 American Heart Association, Inc.
Articles |
-Adrenergic Signal Transduction in Renin Transgenic Rats
From the Klinik III für Innere Medizin der Universität zu Köln (P.S., T.N., G.N., M.B.) and the Institut für Klinische Pharmakologie der Freien Universität Berlin (M.P.) (Germany).
| Abstract |
|---|
|
|
|---|
1-adrenoceptorG
proteinphosphoinositide-specific phospholipase C
(PLC) signal transduction pathway is assumed to play an important role
in the regulation of contractile force and in the pathophysiology of
myocardial hypertrophy. In the present study, the
components of this pathway were investigated in left ventricles of
hearts from hypertensive transgenic rats overexpressing the mouse renin
gene [TG(mREN2)27] in comparison to age- and weight-matched
Sprague-Dawley control rats. Contractile force was assessed in isolated
electrically driven left ventricular papillary muscle
strips.
1-adrenoceptor density was measured by
radioligand binding using [3H]prazosin,
steady state levels of
q/11, and G protein ß-subunits by Western
blotting. PLC activity was determined by a cell-free assay using
exogenous phospholipid vesicles containing
[3H]phosphatidylinositol (4,5)-bisphosphate as a
substrate.
1-Adrenoceptor density was significantly
increased (by 80%) in transgenic rats compared with control rats,
while the positive inotropic response to the
1-adrenoceptor agonist phenylephrine was
significantly reduced, suggesting a postreceptor defect in TG(mREN2)27.
The expression of
q and
11 was verified by reverse
transcriptionpolymerase chain reaction, and
q/11 steady state
protein levels were shown to be similar in transgenic and control rats.
Western blotting using a ß-common antibody revealed two bands at
approximately 35 and 36 kD. The quantities of both were similar in
TG(mREN2)27 compared with those in control rats. In contrast, PLC
activity was significantly reduced (by 32%) in transgenic rats. In
conclusion, our findings are consistent with a desensitization
of the
1-adrenergic signal transduction pathway at the
level of the effector.
Key Words: signal transduction
-adrenoceptors G proteins phospholipase C cardiac hypertrophy
| Introduction |
|---|
|
|
|---|
-adrenoceptors and G proteins is an important mechanism
in the regulation of contractility3 4 and
myocardial growth and hypertrophy (see References 5 and 65 6
for review). Treatment of isolated neonatal rat
cardiomyocytes with norepinephrine, which
activates the
1-adrenoceptorGq proteinPLC
signaling cascade, results in typical features of cell
hypertrophy.7 For this biological response,
the presence of
q is required.8 These findings, which
were obtained in isolated cardiomyocytes, suggest a
pathophysiological relevance of the
-adrenoceptor signaling cascade. This assumption is supported by
observations made in hearts from animals with myocardial
hypertrophy. Several animal models have been studied in the
past: SHR in the prehypertensive stage of the syndrome with already
established cardiac hypertrophy showed an increased
positive inotropic response to
1-adrenoceptor
agonists9 and an increased
norepinephrine-induced inositol phosphate
formation,10 while in the hypertensive stage
-adrenoceptor density and norepinephrine-induced
inositol phosphate formations were decreased.11
In contrast to the polygenic cause of hypertension in SHR,
TG(mREN2)27 is a well-established monogenic model of severe
arterial hypertension and cardiac
hypertrophy.12 The animals exhibit increased
sympathetic activity as measured by increased levels of circulating
norepinephrine and decreased myocardial
norepinephrine and neuropeptide Y contents.13
The ß-adrenergic signaling cascade is desensitized at two distinct
levels: the density of the ß1-adrenoceptor subtype is
decreased, while steady state levels of adenylyl
cyclase-inhibitory
i proteins are
decreased.13 Because the predominant sympathetic
neurotransmitter norepinephrine binds to
- as well as to
ß-adrenoceptors, it is intriguing to study the
-adrenergic signal
transduction cascade in TG(mREN2)27. The question of the present
study was whether and if so at which level a desensitization of the
-adrenergic signaling cascade occurs in the hypertrophied
myocardium of renin transgenic rats.
| Methods |
|---|
|
|
|---|
Contraction Experiments
Contraction experiments were performed on electrically driven
papillary muscles isolated from the left ventricles of rat hearts as
described previously.14 After the hearts were excised and
weighed, papillary muscle strips of uniform size (diameter <1 mm,
length 3 to 6 mm) were dissected in aerated bathing solution at
room temperature. The bathing solution was a modified Tyrode's
solution of previously described composition.14 Resting
force of about 10 mN was applied and kept constant throughout the
experiments. Strips were paced at 1 Hz and allowed to equilibrate in
the drug-free bathing solution until complete mechanical stabilization
was achieved. In experiments with phenylephrine, the
preparations were pre-exposed to 1 µmol/L
propranolol for 30 minutes, and dose-response curves were
obtained in the presence of propranolol. After a washout
period of 30 to 60 minutes, concentration-response curves for
extracellular calcium were performed.
Membrane Preparation
Left ventricular myocardial tissue was chilled in
ice-cold homogenization buffer (20
mmol/L Tris-Cl, pH 7.4; 1 mmol/L EDTA; 1
mmol/L dithiothreitol; 1 µmol/L leupeptin;
100 µmol/L phenylmethylsulfonyl fluoride; 2
µg/mL soybean trypsin inhibitor; 3
µmol/L benzamidine; 1 µmol/L pepstatin).
Connective tissue was trimmed away, and the remaining tissue was minced
with scissors and homogenized by hand for 1 minute using a
glass-glass-homogenizer. The suspension was
centrifuged for 15 minutes at 480g and 4°C in a
Beckman JA-20 rotor. The supernatant was diluted with the same volume
of homogenization buffer containing 1 mol/L
KCl and incubated on ice for 15 minutes. The homogenate was
centrifuged at 100 000g for 30 minutes at 4°C in
a Beckman Ti-60 rotor, and the pellet was resuspended in
homogenization buffer and recentrifuged at
100 000g for 30 minutes at 4°C. This washing step was
repeated once and the final pellet was resuspended in a suitable volume
of homogenization buffer.
Radioligand Binding Experiments
-Adrenoceptors in rat left ventricular
myocardium were detected by radioligand binding
of [3H]prazosin. Membrane preparations were incubated
with increasing concentrations (0.01 to 3.0 nmol/L) of
[3H]prazosin in a total volume of 250 µL in the
presence of 50 mmol/L Tris-Cl, pH 7.4, and 10
mmol/L MgCl2 for 60 minutes at 37°C as
described.14 Specific binding was determined as the
difference in binding in the absence and presence of 10
µmol/L phentolamine. Non-specific binding was less
than 30% at the ligand concentration, resulting in half-maximal
binding. The density (Bmax) and the apparent affinity
(KD) of binding sites were obtained from
Scatchard plots determined by linear regression analysis.
Western Blotting
Rabbit antibodies raised against the carboxy terminus of both
q and
11(Catalog No. 371751-Q) as well as ßcommon antibodies
(Catalog No. 371738-Q) were purchased from Calbiochem. Sodium
dodecyl sulfatepolyacrylamide gel electrophoresis
using 10% (wt/vol) polyacrylamide and
immunoblotting were performed as
described.15 Immunoreactive proteins were detected using
the ECL Western blotting detection system (Amersham).
PLC Assay
Inositol phosphate formation was assayed for 30 minutes at
25°C using exogenous phospholipid vesicles containing
[3H]phosphatidylinositol 4,5-bisphosphate
(PtdIP2) as substrate.16 The reaction mixture
(70 µL) contained 280 µmol/L phosphatidylethanolamine,
28 µmol/L [3H]PtdIP2 (5 Ci/mol)
50 mmol/L Tris-maleate (pH 7.0), 10 mmol/L
LiCl, 10 mmol/L 2,3-diphosphoglycerate, 3
mmol/L EGTA, and 3.2 mmol/L sodium deoxycholate. The
reaction was terminated by the addition of 350 µL
chloroform/methanol/concentrated HCl (500/500/3 by volume) and
vortexing. Subsequently, 100 µL of 1 mol/L HCl containing
5 mmol/L EGTA was added. Phase separation was accelerated
by centrifugation at 12 000g for 1 minute
in an Eppendorf microfuge. Two hundred microliters of the aqueous phase
were counted in a Beckman scintillation counter using Zinsser Quicksafe
scintillation fluid. When absolute enzyme activities of different
myocardial samples were compared, they were assayed in the same
experiment. Triplicate determinations were performed for each
sample.
RT-PCR
Total RNA from rat left ventricular myocardial
tissue was prepared according to the modified method of Chomczynski and
Sacchi17 using the RNA Clean Kit from AGS. Aliquots of
1.25 µg of total RNA were subjected to Moloney Mouse Leukemia Virus
Reverse Transcriptase (GIBCO-BRL; 200 U) for 10 minutes at 23°C, 45
minutes at 42°C, and 5 minutes at 95°C as described16
in the presence of 100 pmol random hexamer (Boehringer) and 29
U RNase inhibitor (Promega). Subsequent PCR amplifications
of the first-strand cDNA was performed in a 100 µL reaction using
Thermus aquaticus DNA polymerase (2.5 U;
Boehringer). The reaction mixture was made up of the same
components as those previously described.16 For the
amplification of the 205 bp
q fragment, 35 cycles of 95°C for 1
minute, 55°C for 1 minute, and 72°C for 1 minute followed by 72°C
for 7 minutes were performed in the presence of 50 pmol of the
oligonucleotide primers 5'-GTAGCCGACCCTTCCTATCT-3'
(upstream) and 5'-ATTCGCTAAGCGCTACTAGA-3' (downstream). For the
amplification of the 540 kD
11 fragment, 35 cycles of 55°C for 1
minute and 72°C for 1 minute followed by 72°C for 7 minutes were
performed in the presence of 50 pmol of each of the
oligonucleotide primers
5'-ATCTTCACGGCCATGCAGGCCATG-3' (upstream) and
5'-GGGGTAGGTGATGATTGTGCG-3' (downstream). The primer pairs have
previously been shown to be specific for
q and
11,
respectively.18 In the absence of reverse transcriptase,
no amplification products were obtained, indicating that the
products were generated by amplification of cDNA and not by
contaminations with genomic DNA. Under the conditions applied for the
amplification of
q and
11, no amplification products were
detected for
14 and
16, which is highly homologous to
15
cloned from the mouse,18 respectively. The primer
sequences were GTATCGCCATGCCCTCTTTC (upstream) and
AGGATTCTGGTCTTGATACAG (downstream) for
14 and
CACCACGCTAGCCTGGTCATG (upstream) and GCGCCCTTCTTGCTGCCCTCGGG
(downstream) for
16, respectively.
Statistical Analysis
Data are expressed as mean±SEM. Statistical significance was
estimated using Student's t test for unpaired observations.
A value of P<.05 was considered significant.
KD values and the drug concentration producing
the half-maximal effect (EC50) were determined graphically
in each individual experiment. EC50 values are given with
95% confidence limits.
| Results |
|---|
|
|
|---|
-adrenergic signal transduction pathway in TG(mREN2)27 rats, a
well-established model for hypertensive cardiac
hypertrophy, in comparison with Sprague-Dawley control
rats. Receptor density was determined by saturation
radioligand binding experiments using the
1-selective antagonist
[3H]prazosin. Receptor densities of left
ventricular membranes from transgenic (n=6) and control
(n=6) rats are shown in Fig 1
1-adrenoceptor
density of 80% [71.2±6.5 fmol/mg protein in TG(mREN2)27
versus 39.5±5.1 fmol/mg protein in controls;
P<.05] was observed. Receptor affinities as judged by the
KD values [0.24, range 0.12 to 0.50,
nmol/L in TG(mREN2)27 versus 0.42, range 0.32 to 0.55,
nmol/L in control amimals] were not significantly changed in
TG(mREN2)27 versus control animals (not shown).
|
In order to investigate whether the observed increase in
-adrenoceptor density resulted in an increased positive inotropic
effect of
-adrenoceptor agonists, the effect of
phenylephrine on cardiac contractility was
assessed. The maximal positive inotropic effect of
phenylephrine in left ventricular papillary
muscle strips was significantly reduced in TG(mREN2)27 compared with
that in control animals (0.6±0.3 mN, n=7, versus 2.5±0.8 mN, n=7;
P<.05) (Fig 2
, left). In
contrast, the potency as judged by the EC50 values for
phenylephrine did not differ significantly between the two
groups [5.5 (range 2.9 to 10.4) µmol/L in TG(mREN2)27
versus 9.9 (range 3.6 to 26.0) µmol/L in control
animals). Increasing the extracellular calcium concentration led to
similar positive inotropic responses in both groups (Fig 2
, right). The
maximal increases in force of contraction were 5.0±0.8 mN for
TG(mREN2)27 and 4.5±1.2 mN for control animals. The EC50
values for calcium were also similar in TG(mREN2)27 (3938, range 2766
to 5607, µmol/L) and control animals (4438, range 3205 to
6146, µmol/L).
|
In order to elucidate the molecular basis of the apparent mismatch
between increased
1-adrenoceptor density and decreased
1-adrenoceptormediated positive inotropic response in
TG(mREN2)27, G protein
-subunits of the Gq family, which couple
-adrenoceptors to PLC, were investigated. First, the expression of
the members of the Gq family known so far (
q,
11,
14, and
16) was examined by RT-PCR. Transcripts for both
q and
11 were
detected by these methods in transgenic and control rats (Fig 3
). In contrast,
14 and
16 were not
present in the myocardium of control and transgenic
rats (not shown). These results indicate that the expression pattern of
q subtypes is not changed in TG(mREN2)27. Because the RT-PCR
experiments shown were not suitable to quantify the message of
q and
11, Western blots were performed to compare the steady state protein
levels in control and transgenic rats (Fig 4
). The antibody used recognized the
C-termini of both
q and
11. As shown in Fig 4
, an immunoreactive
band was detected at approximately 42 kD, the expected molecular weight
of
q and
11. Protein levels were very similar in control and
transgenic rats. Thus, it seems unlikely that changes in
q proteins
account for the decreased inotropic responsiveness of TG(mREN2)27 to
-adrenergic agonists.
|
|
Not only
q but also free ß
-subunits are able to
activate PLCß isozymes. Therefore, decreased levels of
ß
-subunits might contribute to the alteration in
-adrenergic signal transduction in TG(mREN2)27. To test this
hypothesis, steady state protein levels of ß
-subunits were
assessed by Western blotting using an antibody raised against an
internal peptide present in all known ß-subunits. As demonstrated
in Fig 5
, two proteins of an apparent
molecular weight of 35 and 36 kD, respectively, were detected. This
finding indicates that more than one ß-subunit is present in the
myocardium of both control and transgenic rats. The
intensities of both the 35 and 36 kD band were similar in both groups,
indicating that changes in the levels of G protein subunits are
unlikely to account for the
-adrenergic signal transduction defect
in TG(mREN2)27.
|
Another possible alteration of the
-adrenergic signal transduction
cascade might affect the effector enzyme, PLC. Therefore, PLC activity
was measured in the same membrane preparations as receptor densities
and G protein levels. A representative experiment
performed in the presence of 100 µmol/L calcium, a
concentration at which PLC is maximally activated, is shown in
Fig 6
. PLC activity was reduced by 32%
[22.4±2.2 nmol/min per mg protein in TG(mREN2)27 rats versus
33.1±3.1 nmol/min per mg protein in control rats] in
transgenic rats compared with control rats. This decrease was
statistically significant. The data presented here are
consistent with desensitization of the
1-adrenergic signal tranduction cascade at the level of
the effector.
|
| Discussion |
|---|
|
|
|---|
-adrenoceptor density, the positive inotropic response to
-adrenoceptor agonists is decreased in transgenic rats expressing
the mouse renin gene. These findings suggest alterations of the
signaling cascade distal to the receptor. The expression of
q and
11, the two ubiquitously expressed members of the Gq family, was
verified in left ventricles of control and transgenic rats by RT-PCR.
The two additional members
14 and
16, which are known to exhibit
a more restricted expression pattern,18 were not detected
under the conditions applied. The steady state levels of
q/11, the
-subunits of the Gq family expressed in the heart, were unchanged.
The levels of both 35 and 36 kD ß-subunits were also similar in
control and transgenic rats. In contrast, PLC activity was
significantly decreased in TG(mREN2)27.
These findings could be explained by several mechanisms. First, the
receptor could be uncoupled from Gq/11 despite quantitatively unchanged
q/11 and ß
-subunit protein levels. A qualitative alteration of
G protein
- and/or ß
-subunits might be responsible for such a
functional signal transduction defect. However, the data obtained by
assaying PLC activity provide indirect evidence against this
hypothesis. Enzyme activity was measured in a cell-free system in which
no receptor activation occurs. The decrease in activity in transgenic
rats was similar at different calcium concentrations. Under the
conditions as described in the legend to Fig 6
, the enzyme is maximally
stimulated by calcium, independently from receptors and G proteins. The
second and more likely explanation for the data presented is a
defect of PLC itself. This could be a decrease in steady state PLC
protein levels, a change in PLC isozyme expression pattern, or a
decrease in specific activity. Unfortunately, the quantitation of PLC
protein and mRNA levels in rat heart is very difficult due to a low
abundance of the respective transcripts and proteins. Moreover, it is
possible that rat heart contains as yet unknown PLC isozymes, changes
of which might contribute to the decrease in activity observed in
TG(mREN2)27.
An example for a decrease in specific activity of a PLC isozyme has
been reported recently.19 In Alzheimer's disease,
protein levels of PLC
1 are increased, while PLC activity
is unchanged, indicating a decrease in the specific activity of
PLC
1. The first study providing evidence for an
agonist-induced desensitization process distal to G proteins has been
published recently.20 Cross-desensitization of the
fMet-Leu-Phe receptorG proteinPLC-signaling cascade by other
chemotactic receptors has been found to occur at the level of PLC in
RBL-2H3 rat basophilic leukemia cells transfected with the respective
receptors.20 Similarly, the data reported in the
present study could be explained by desensitization of the
-adrenergic signaling cascade at the level of the effector enzyme
PLC. In TG(mREN2)27, the sympathetic nervous system is
activated, and norepinephrine levels are increased
in the periphery and decreased in the heart in comparison with control
rats.13 Since norepinephrine is an agonist for
- and ß-adrenergic receptors, the PLC downregulation could be
either the result of homologous desensitization via
-adrenoceptors
or cross-desensitization via ß-adrenoceptors. This question will have
to be addressed by studies in which transgenic animals are treated with
- and ß-blockers, respectively. However, a mechanism distinct from
increased norepinephrine levels and its sequelae must be
involved in PLC desensitization in TG(mREN2)27 as in a polygenic
hypertrophy model, the SHR, circulating
norepinephrine levels are also increased, but
-adrenoceptor density is decreased.11 There are
contradictory results on inositol phosphate formation in response to
-adrenergic stimulation in SHR: Ivorra et al11 reported
a decrease, Kawaguchi et al10 an increase, in the PLC
response to norepinephrine in SHR. The positive inotropic
response to
-adrenergic activation has been reported to be increased
in prehypertensive SHR.9 In another condition in which the
sympathetic nervous system is activated, ie, human heart
failure, the results on
-adrenergic signal transduction are also
controversial. While Bristow et al21 and Böhm et
al22 reported an unchanged
-adrenoceptor density in
heart failure, Steinfath et al23 found an increased
-adrenoceptor density and reduced
-adrenergic positive inotropic
effect. In heart failure, the
-adrenergic signal transduction
pathway is of particular relevance because it might be a reserve
mechanism to maintain inotropy in a state in which the ß-adrenergic
system is desensitized. In this context it is noteworthy that there are
considerable species differences regarding
1-adrenoceptor density and the extent of
1-adrenoceptormediated positive inotropic effects. In
rat heart, these effects are particularly pronounced,3 and
the increase in force of contraction has been shown to correlate with
the increase in inositol phosphate formation.3 4
Desensitization of the ß-adrenergic signaling cascade, ie,
downregulation of ß1-adrenoceptors and increase of
Gi proteins, has been observed in both SHR24
and TG(mREN2)27.13 Maximal adenylyl cyclase activity was
unchanged in both models, indicating an unchanged effector level.
It is tempting to speculate that a mechanism influencing the function
of the
-adrenergic signaling cascade independently from sympathetic
activation might be related to the
renin-angiotensin-aldosterone system. Although
the levels of circulating angiotensin II are not increased
in TG(mREN2)27, there is evidence that the local
renin-angiotensin-aldosterone system in the
heart is activated.12 25 Angiotensin
II receptor agonist treatment of TG(mREN2)27 would be useful to
investigate a possible influence of the
renin-angiotensin-aldosterone system on the
-adrenergic signal transduction pathway.
Taken together, the data presented are consistent with
a desensitization of the
-adrenoceptorG proteinPLC signal
transduction pathway at the level of the effector enzyme. Future
studies will have to characterize the pattern of PLC isozyme expression
in control and transgenic rat hearts and to quantify the mRNA levels of
the respective isozyme or isozymes by quantitative PCR. Furthermore,
the pathophysiological relevance of PLC
desensitization will have to be elucidated. Cardiac-specific
overexpression of
1-adrenoceptors might be useful to
investigate whether an increase in receptor density results in a
compensatory decrease in PLC activity and in cardiac
hypertrophy and/or failure, which is clinically
important.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
| Footnotes |
|---|
Received December 24, 1996; first decision January 15, 1997; accepted May 2, 1997.
| References |
|---|
|
|
|---|
2.
Nishizuka Y. Intracellular signaling by
hydrolysis of phospholipids and activation of protein kinase C.
Science. 1992;258:607-614.
3.
Endoh M. Myocardial
1-adrenoceptors mediate positive inotropic effect and
changes in phosphatidylinositol metabolism: species
differences in receptor distribution and the intracellular coupling
process in mammalian ventricular
myocardium. Circ Res. 1991;68:1179-1190.
4.
Scholz J, Troll U, Sandig P, Schmitz W, Scholz H,
Schulte am Esch J. Existence and
1-adrenergic
stimulation of inositol polyphosphates in mammalian heart.
Mol Pharmacol. 1992;42:134-140.[Abstract]
5.
Terzic A, Puceat M, Vassort G, Vogel SM.
Cardiac
1-adrenoceptors: an overview.
Pharmacoll Rev. 1993;45:147-175.
6. Schmitz W, Eschenhagen T, Mende U, Müller FU, Scholz H. The role of alpha1-adrenergic and muscarinic receptors in cardiac function. Eur Heart J. 1991;12(suppl F):83-87.
7. Simpson PC. Norepinephrine-stimulated hypertrophy of cultured rat myocardial cells is an alpha1 adrenergic response. J Clin Invest. 1983;72:732-738.
8.
LaMorte VJ, Thorburn J, Absher D, Spiegel A, Heller
Brown J, Chien KR, Feramisco JR, Knowlton KU. Gq- and
ras-dependent pathways mediate hypertrophy of neonatal rat
ventricular myocytes following
1-adrenergic
stimulation. J Biol Chem. 1994;269:13490-13496.
9.
Böhm M, Mende U, Schmitz W, Scholz H.
Increased sensitivity to
-adrenoceptor stimulation but intact
muscarinergic and purinergic isoprenaline-antagonistic
effect in prehypertensive cardiac hypertrophy of
spontaneously hypertensive rats. Naunyn Schmiedeberg's
Arch Pharmacol. 1986;333:284-289.[Medline]
[Order article via Infotrieve]
10.
Kawaguchi H, Sano H, Iizuka K, Okada H, Kudo T,
Kageyama K, Muramoto S, Murakami T, Okamoto H, Mochizuki N, Kitabatake
A. Phosphatidylinositol metabolism in hypertrophic
rat heart. Circ Res. 1993;72:966-972.
11.
Ivorra D, Gascon S, Vila E, Badia A.
-Adrenoceptor subtypes and inositol phosphate production in
heart ventricles of spontaneously hypertensive rats.
J Cardiovasc Pharmacol. 1993;21:931-936.[Medline]
[Order article via Infotrieve]
12. Mullins JJ, Peters J, Ganten D. Fulminant hypertension in transgenic rats harbouring the mouse Ren-2 gene. Nature. 1990;344:541-544.[Medline] [Order article via Infotrieve]
13.
Böhm M, Moll M, Schmid B, Paul M, Ganten D,
Castellano M, Erdmann E. ß-adrenergic neuroeffector mechanisms
in cardiac hypertrophy of renin transgenic rats.
Hypertension. 1994;24:653-662.
14.
Tawfik-Schlieper H, Moll M, Schmid B, Schwinger RHG,
Paul M, Ganten D, Böhm M. Alterations of cardiac
- and
ß-adrenoceptors and inotropic responsiveness in hypertensive
transgenic rats harbouring the mouse renin gene (TGR(mREN2)27).
Clin Exp Hypertens. 1995;17:631-648.
15.
Schnabel P, Schreck R, Schiller DL, Camps M, Gierschik
P. Stimulation of phospholipase C by a mutationally
activated G protein
16 subunit. Biochem
Biophys Res Commun. 1992;188:1018-1023.[Medline]
[Order article via Infotrieve]
16. Schnabel P, Gäs H, Nohr T, Camps M, Böhm M. Identification and characterization of G protein-regulated phospholipase C in human myocardium. J Mol Cell Cardiol. 1996;28:2419-2427.[Medline] [Order article via Infotrieve]
17. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156-159.[Medline] [Order article via Infotrieve]
18.
Wilkie TM, Scherle PA, Strathmann MP, Slepak VZ, Simon
MI. Characterization of G-protein
subunits in the Gq class:
expression in murine tissues and in stromal and hematopoietic cell
lines. Proc Natl Acad Sci U S A. 1991;88:10049-10053.
19. Shimohama S, Matsushima H, Fujimoto S, Takenawa T, Taniguchi T, Kameyama M, Kimura J. Differential involvement of phospholipase C in Alzheimer's disease. Gerontology. 1995;41:13-19.
20.
Richardson R, Ali H, Tomhave ED, Haribabu B, Snyderman
R. Cross-desensitization of chemoattractant receptors at
multiple levels: evidence for a role for inhibition of phospholipase C
activity. J Biol Chem. 1995;270:27829-27833.
21.
Bristow MR, Minobe W, Rasmussen R, Hershberger RE,
Hoffman BB.
1-Adrenergic receptors in nonfailing
and failing human heart. J Pharmacol Exp Ther. 1988;247:1039-1045.
22. Böhm M, Diet F, Feiler G, Kemkes B, Kreuzer E, Weinhold C, Erdmann E. Subsensitivity of the failing human heart to isoprenaline and milrinone is related to beta-adrenoceptor downregulation. J Cardiovasc Pharmacol. 1988;14:726-732.
23.
Steinfath M, Danielsen W, von der Leyen H, Mende U,
Meyer W, Neumann J, Nose M, Reich T, Schmitz W, Scholz H, Starbatty J,
Stein B, Döring V, Kalmar P, Haverich A. Reduced
1- and ß2-adrenoceptor-mediated positive
inotropic effects in human end-stage heart failure.
Br J Pharmacol. 1992;105:463-469.[Medline]
[Order article via Infotrieve]
24.
Böhm M, Castellano M, Paul M, Erdmann E.
Cardiac norepinephrine, ß-adrenoceptors, and
Gi
-proteins in prehypertensive and hypertensive spontaneously
hypertensive rats. J Cardiovasc Pharmacol. 1994;23:980-987.[Medline]
[Order article via Infotrieve]
25.
Ganten D, Lindpaintner K, Ganten U, Peters J,
Zimmermann F, Bader M, Mullins J. Transgenic rats: new animal
models in hypertension research. Hypertension. 1991;17:843-855.
This article has been cited by other articles:
![]() |
L. Cao, M. H. Weil, S. Sun, and W. Tang Vasopressor Agents for Cardiopulmonary Resuscitation Journal of Cardiovascular Pharmacology and Therapeutics, June 1, 2003; 8(2): 115 - 121. [Abstract] [PDF] |
||||
![]() |
S. M. Jacinto, J. J. Mullins, and K. D. Mitchell Enhanced renal vascular responsiveness to angiotensin II in hypertensive ren-2 transgenic rats Am J Physiol Renal Physiol, February 1, 1999; 276(2): F315 - F322. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Zolk, M. Flesch, G. Nickenig, P. Schnabel, and M. Bohm Alteration of intracellular Ca2+-handling and receptor regulation in hypertensive cardiac hypertrophy: insights from Ren2-transgenic rats Cardiovasc Res, July 1, 1998; 39(1): 242 - 256. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Hypertension Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1997 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |