Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 1997;30:1356-1361

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schnabel, P.
Right arrow Articles by Böhm, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schnabel, P.
Right arrow Articles by Böhm, M.

(Hypertension. 1997;30:1356-1361.)
© 1997 American Heart Association, Inc.


Articles

{alpha}-Adrenergic Signal Transduction in Renin Transgenic Rats

Petra Schnabel; Theo Nohr; Georg Nickenig; Martin Paul; ; Michael Böhm

From the Klinik III für Innere Medizin der Universität zu Köln (P.S., T.N., G.N., M.B.) and the Institut für Klinische Pharmakologie der Freien Universität Berlin (M.P.) (Germany).


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract The {alpha}1-adrenoceptor–G protein–phosphoinositide-specific phospholipase C (PLC) signal transduction pathway is assumed to play an important role in the regulation of contractile force and in the pathophysiology of myocardial hypertrophy. In the present study, the components of this pathway were investigated in left ventricles of hearts from hypertensive transgenic rats overexpressing the mouse renin gene [TG(mREN2)27] in comparison to age- and weight-matched Sprague-Dawley control rats. Contractile force was assessed in isolated electrically driven left ventricular papillary muscle strips. {alpha}1-adrenoceptor density was measured by radioligand binding using [3H]prazosin, steady state levels of {alpha}q/11, and G protein ß-subunits by Western blotting. PLC activity was determined by a cell-free assay using exogenous phospholipid vesicles containing [3H]phosphatidylinositol (4,5)-bisphosphate as a substrate. {alpha}1-Adrenoceptor density was significantly increased (by 80%) in transgenic rats compared with control rats, while the positive inotropic response to the {alpha}1-adrenoceptor agonist phenylephrine was significantly reduced, suggesting a postreceptor defect in TG(mREN2)27. The expression of {alpha}q and {alpha}11 was verified by reverse transcription–polymerase chain reaction, and {alpha}q/11 steady state protein levels were shown to be similar in transgenic and control rats. Western blotting using a ß-common antibody revealed two bands at approximately 35 and 36 kD. The quantities of both were similar in TG(mREN2)27 compared with those in control rats. In contrast, PLC activity was significantly reduced (by 32%) in transgenic rats. In conclusion, our findings are consistent with a desensitization of the {alpha}1-adrenergic signal transduction pathway at the level of the effector.


Key Words: signal transduction • {alpha}-adrenoceptors • G proteins • phospholipase C • cardiac hypertrophy


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The generation of the second messengers inositol-(1,4,5)-trisphosphate and diacylglycerol by PLCs is a key mechanism by which many extracellular signaling molecules regulate functions of their target cells.1 2 In the mammalian heart, stimulation of PLC enzyme via {alpha}-adrenoceptors and G proteins is an important mechanism in the regulation of contractility3 4 and myocardial growth and hypertrophy (see References 5 and 65 6 for review). Treatment of isolated neonatal rat cardiomyocytes with norepinephrine, which activates the {alpha}1-adrenoceptor–Gq protein–PLC signaling cascade, results in typical features of cell hypertrophy.7 For this biological response, the presence of {alpha}q is required.8 These findings, which were obtained in isolated cardiomyocytes, suggest a pathophysiological relevance of the {alpha}-adrenoceptor signaling cascade. This assumption is supported by observations made in hearts from animals with myocardial hypertrophy. Several animal models have been studied in the past: SHR in the prehypertensive stage of the syndrome with already established cardiac hypertrophy showed an increased positive inotropic response to {alpha}1-adrenoceptor agonists9 and an increased norepinephrine-induced inositol phosphate formation,10 while in the hypertensive stage {alpha}-adrenoceptor density– and norepinephrine-induced inositol phosphate formations were decreased.11

In contrast to the polygenic cause of hypertension in SHR, TG(mREN2)27 is a well-established monogenic model of severe arterial hypertension and cardiac hypertrophy.12 The animals exhibit increased sympathetic activity as measured by increased levels of circulating norepinephrine and decreased myocardial norepinephrine and neuropeptide Y contents.13 The ß-adrenergic signaling cascade is desensitized at two distinct levels: the density of the ß1-adrenoceptor subtype is decreased, while steady state levels of adenylyl cyclase-inhibitory {alpha}i proteins are decreased.13 Because the predominant sympathetic neurotransmitter norepinephrine binds to {alpha}- as well as to ß-adrenoceptors, it is intriguing to study the {alpha}-adrenergic signal transduction cascade in TG(mREN2)27. The question of the present study was whether and if so at which level a desensitization of the {alpha}-adrenergic signaling cascade occurs in the hypertrophied myocardium of renin transgenic rats.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Transgenic Animals
TG(mREN2)27 were housed and bred in the animal laboratory of the Max Delbrück Centrum for Molecular Medicine, Berlin, Germany. At the age of 5 weeks, heterozygous male animals were transferred to the animal laboratory of the University of Cologne. Sprague-Dawley control rats were obtained from the Laboratorium für Versuchstierkunde, Hannover, Germany. Animals were housed according to the guidelines of animal care of the University of Cologne. The animals were held on a standard laboratory diet (Altromin R) and tap water ad libitum. They were exposed to 12-hour dark and light cycles at 20°C to 22°C. Experiments were performed at the age of 12 to 14 weeks, an age at which hypertension is fully established.12 Rats were killed by a blow on the head, hearts were rapidly removed and arrested in 0.9% ice-cold NaCl. Hearts of TG(mREN2)27 exhibited concentric hypertrophy but no dilatation or any signs of heart failure like excessive scarring. No signs of venous congestion were observed in any other organ.

Contraction Experiments
Contraction experiments were performed on electrically driven papillary muscles isolated from the left ventricles of rat hearts as described previously.14 After the hearts were excised and weighed, papillary muscle strips of uniform size (diameter <1 mm, length 3 to 6 mm) were dissected in aerated bathing solution at room temperature. The bathing solution was a modified Tyrode's solution of previously described composition.14 Resting force of about 10 mN was applied and kept constant throughout the experiments. Strips were paced at 1 Hz and allowed to equilibrate in the drug-free bathing solution until complete mechanical stabilization was achieved. In experiments with phenylephrine, the preparations were pre-exposed to 1 µmol/L propranolol for 30 minutes, and dose-response curves were obtained in the presence of propranolol. After a washout period of 30 to 60 minutes, concentration-response curves for extracellular calcium were performed.

Membrane Preparation
Left ventricular myocardial tissue was chilled in ice-cold homogenization buffer (20 mmol/L Tris-Cl, pH 7.4; 1 mmol/L EDTA; 1 mmol/L dithiothreitol; 1 µmol/L leupeptin; 100 µmol/L phenylmethylsulfonyl fluoride; 2 µg/mL soybean trypsin inhibitor; 3 µmol/L benzamidine; 1 µmol/L pepstatin). Connective tissue was trimmed away, and the remaining tissue was minced with scissors and homogenized by hand for 1 minute using a glass-glass-homogenizer. The suspension was centrifuged for 15 minutes at 480g and 4°C in a Beckman JA-20 rotor. The supernatant was diluted with the same volume of homogenization buffer containing 1 mol/L KCl and incubated on ice for 15 minutes. The homogenate was centrifuged at 100 000g for 30 minutes at 4°C in a Beckman Ti-60 rotor, and the pellet was resuspended in homogenization buffer and recentrifuged at 100 000g for 30 minutes at 4°C. This washing step was repeated once and the final pellet was resuspended in a suitable volume of homogenization buffer.

Radioligand Binding Experiments
{alpha}-Adrenoceptors in rat left ventricular myocardium were detected by radioligand binding of [3H]prazosin. Membrane preparations were incubated with increasing concentrations (0.01 to 3.0 nmol/L) of [3H]prazosin in a total volume of 250 µL in the presence of 50 mmol/L Tris-Cl, pH 7.4, and 10 mmol/L MgCl2 for 60 minutes at 37°C as described.14 Specific binding was determined as the difference in binding in the absence and presence of 10 µmol/L phentolamine. Non-specific binding was less than 30% at the ligand concentration, resulting in half-maximal binding. The density (Bmax) and the apparent affinity (KD) of binding sites were obtained from Scatchard plots determined by linear regression analysis.

Western Blotting
Rabbit antibodies raised against the carboxy terminus of both {alpha}q and {alpha}11(Catalog No. 371751-Q) as well as ßcommon antibodies (Catalog No. 371738-Q) were purchased from Calbiochem. Sodium dodecyl sulfate–polyacrylamide gel electrophoresis using 10% (wt/vol) polyacrylamide and immunoblotting were performed as described.15 Immunoreactive proteins were detected using the ECL Western blotting detection system (Amersham).

PLC Assay
Inositol phosphate formation was assayed for 30 minutes at 25°C using exogenous phospholipid vesicles containing [3H]phosphatidylinositol 4,5-bisphosphate (PtdIP2) as substrate.16 The reaction mixture (70 µL) contained 280 µmol/L phosphatidylethanolamine, 28 µmol/L [3H]PtdIP2 (5 Ci/mol) 50 mmol/L Tris-maleate (pH 7.0), 10 mmol/L LiCl, 10 mmol/L 2,3-diphosphoglycerate, 3 mmol/L EGTA, and 3.2 mmol/L sodium deoxycholate. The reaction was terminated by the addition of 350 µL chloroform/methanol/concentrated HCl (500/500/3 by volume) and vortexing. Subsequently, 100 µL of 1 mol/L HCl containing 5 mmol/L EGTA was added. Phase separation was accelerated by centrifugation at 12 000g for 1 minute in an Eppendorf microfuge. Two hundred microliters of the aqueous phase were counted in a Beckman scintillation counter using Zinsser Quicksafe scintillation fluid. When absolute enzyme activities of different myocardial samples were compared, they were assayed in the same experiment. Triplicate determinations were performed for each sample.

RT-PCR
Total RNA from rat left ventricular myocardial tissue was prepared according to the modified method of Chomczynski and Sacchi17 using the RNA Clean Kit from AGS. Aliquots of 1.25 µg of total RNA were subjected to Moloney Mouse Leukemia Virus Reverse Transcriptase (GIBCO-BRL; 200 U) for 10 minutes at 23°C, 45 minutes at 42°C, and 5 minutes at 95°C as described16 in the presence of 100 pmol random hexamer (Boehringer) and 29 U RNase inhibitor (Promega). Subsequent PCR amplifications of the first-strand cDNA was performed in a 100 µL reaction using Thermus aquaticus DNA polymerase (2.5 U; Boehringer). The reaction mixture was made up of the same components as those previously described.16 For the amplification of the 205 bp {alpha}q fragment, 35 cycles of 95°C for 1 minute, 55°C for 1 minute, and 72°C for 1 minute followed by 72°C for 7 minutes were performed in the presence of 50 pmol of the oligonucleotide primers 5'-GTAGCCGACCCTTCCTATCT-3' (upstream) and 5'-ATTCGCTAAGCGCTACTAGA-3' (downstream). For the amplification of the 540 kD {alpha}11 fragment, 35 cycles of 55°C for 1 minute and 72°C for 1 minute followed by 72°C for 7 minutes were performed in the presence of 50 pmol of each of the oligonucleotide primers 5'-ATCTTCACGGCCATGCAGGCCATG-3' (upstream) and 5'-GGGGTAGGTGATGATTGTGCG-3' (downstream). The primer pairs have previously been shown to be specific for {alpha}q and {alpha}11, respectively.18 In the absence of reverse transcriptase, no amplification products were obtained, indicating that the products were generated by amplification of cDNA and not by contaminations with genomic DNA. Under the conditions applied for the amplification of {alpha}q and {alpha}11, no amplification products were detected for {alpha}14 and {alpha}16, which is highly homologous to {alpha}15 cloned from the mouse,18 respectively. The primer sequences were GTATCGCCATGCCCTCTTTC (upstream) and AGGATTCTGGTCTTGATACAG (downstream) for {alpha}14 and CACCACGCTAGCCTGGTCATG (upstream) and GCGCCCTTCTTGCTGCCCTCGGG (downstream) for {alpha}16, respectively.

Statistical Analysis
Data are expressed as mean±SEM. Statistical significance was estimated using Student's t test for unpaired observations. A value of P<.05 was considered significant. KD values and the drug concentration producing the half-maximal effect (EC50) were determined graphically in each individual experiment. EC50 values are given with 95% confidence limits.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
The aim of the present study was to investigate the {alpha}-adrenergic signal transduction pathway in TG(mREN2)27 rats, a well-established model for hypertensive cardiac hypertrophy, in comparison with Sprague-Dawley control rats. Receptor density was determined by saturation radioligand binding experiments using the {alpha}1-selective antagonist [3H]prazosin. Receptor densities of left ventricular membranes from transgenic (n=6) and control (n=6) rats are shown in Fig 1Down. A profound and statistically significant increase in {alpha}1-adrenoceptor density of 80% [71.2±6.5 fmol/mg protein in TG(mREN2)27 versus 39.5±5.1 fmol/mg protein in controls; P<.05] was observed. Receptor affinities as judged by the KD values [0.24, range 0.12 to 0.50, nmol/L in TG(mREN2)27 versus 0.42, range 0.32 to 0.55, nmol/L in control amimals] were not significantly changed in TG(mREN2)27 versus control animals (not shown).



View larger version (46K):
[in this window]
[in a new window]
 
Figure 1. {alpha}-Adrenoceptor densities in left ventricles from control (Control; open bar) and transgenic [TG(mREN2)27; hatched bar] rats. Membrane preparations and radioligand binding of [3H]prazosin were performed as described in "Methods." Receptor densities (Bmax) were obtained from Scatchard plots determined by linear regression analysis. The values correspond to mean±SEM. *P<.05 vs Control.

In order to investigate whether the observed increase in {alpha}-adrenoceptor density resulted in an increased positive inotropic effect of {alpha}-adrenoceptor agonists, the effect of phenylephrine on cardiac contractility was assessed. The maximal positive inotropic effect of phenylephrine in left ventricular papillary muscle strips was significantly reduced in TG(mREN2)27 compared with that in control animals (0.6±0.3 mN, n=7, versus 2.5±0.8 mN, n=7; P<.05) (Fig 2Down, left). In contrast, the potency as judged by the EC50 values for phenylephrine did not differ significantly between the two groups [5.5 (range 2.9 to 10.4) µmol/L in TG(mREN2)27 versus 9.9 (range 3.6 to 26.0) µmol/L in control animals). Increasing the extracellular calcium concentration led to similar positive inotropic responses in both groups (Fig 2Down, right). The maximal increases in force of contraction were 5.0±0.8 mN for TG(mREN2)27 and 4.5±1.2 mN for control animals. The EC50 values for calcium were also similar in TG(mREN2)27 (3938, range 2766 to 5607, µmol/L) and control animals (4438, range 3205 to 6146, µmol/L).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 2. Maximal positive inotropic effects of phenylephrine (1000 µmol/L, left) and Ca2+ (10 mmol/L, right) in papillary muscle strips from control (Control; open bars) and transgenic [TG(mREN2)27; hatched bars] rats. Basal force of contraction was 4.9±0.8 mN for control rats and 4.0±0.9 mN for transgenic rats. The effect of phenylephrine was measured in the presence of 1 µmol/L propranolol. The values are mean±SEM. *P<.05 vs Control.

In order to elucidate the molecular basis of the apparent mismatch between increased {alpha}1-adrenoceptor density and decreased {alpha}1-adrenoceptor–mediated positive inotropic response in TG(mREN2)27, G protein {alpha}-subunits of the Gq family, which couple {alpha}-adrenoceptors to PLC, were investigated. First, the expression of the members of the Gq family known so far ({alpha}q, {alpha}11, {alpha}14, and {alpha}16) was examined by RT-PCR. Transcripts for both {alpha}q and {alpha}11 were detected by these methods in transgenic and control rats (Fig 3Down). In contrast, {alpha}14 and {alpha}16 were not present in the myocardium of control and transgenic rats (not shown). These results indicate that the expression pattern of {alpha}q subtypes is not changed in TG(mREN2)27. Because the RT-PCR experiments shown were not suitable to quantify the message of {alpha}q and {alpha}11, Western blots were performed to compare the steady state protein levels in control and transgenic rats (Fig 4Down). The antibody used recognized the C-termini of both {alpha}q and {alpha}11. As shown in Fig 4Down, an immunoreactive band was detected at approximately 42 kD, the expected molecular weight of {alpha}q and {alpha}11. Protein levels were very similar in control and transgenic rats. Thus, it seems unlikely that changes in {alpha}q proteins account for the decreased inotropic responsiveness of TG(mREN2)27 to {alpha}-adrenergic agonists.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 3. Expression of {alpha}q and {alpha}11 in left ventricular myocardium from control (C) and transgenic (TG) rats. Total RNA (5 µg) was isolated and first-strand cDNA synthesis was performed by reverse transcription using random primers and Moloney Mouse Leukemia Virus Reverse Transcriptase. First-strand cDNA from control (lanes 2 and 5) and transgenic (lanes 3 and 6) rats was subjected to PCRs using oligonucleotide primers specific for {alpha}q (lanes 1 through 3) and {alpha}11 (lanes 4 through 6), respectively. Primer sequences and PCR conditions are given in "Methods." PCRs were performed in the absence of template DNA, but in the presence of primers for {alpha}q (lane 1) and {alpha}11 (lane 4), respectively, as negative controls. A molecular weight marker is shown on the right.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 4. Immunochemical detection of {alpha}q/11 in left ventricular membrane preparations from control (C) and transgenic (TG) rats. Membrane preparations (150 µg/lane) were subjected to SDS-PAGE (10%, wt/vol, polyacrylamide), and immunoblotting was performed using antibodies reactive against {alpha}q and {alpha}11. Immunoreactive proteins were visualized by chemoluminescence as described in "Methods." The positions of the molecular mass standards are indicated.

Not only {alpha}q but also free ß{gamma}-subunits are able to activate PLCß isozymes. Therefore, decreased levels of ß{gamma}-subunits might contribute to the alteration in {alpha}-adrenergic signal transduction in TG(mREN2)27. To test this hypothesis, steady state protein levels of ß{gamma}-subunits were assessed by Western blotting using an antibody raised against an internal peptide present in all known ß-subunits. As demonstrated in Fig 5Down, two proteins of an apparent molecular weight of 35 and 36 kD, respectively, were detected. This finding indicates that more than one ß-subunit is present in the myocardium of both control and transgenic rats. The intensities of both the 35 and 36 kD band were similar in both groups, indicating that changes in the levels of G protein subunits are unlikely to account for the {alpha}-adrenergic signal transduction defect in TG(mREN2)27.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 5. Immunochemical detection of G protein ß-subunits in left ventricular membrane preparations from control (C) and transgenic (TG) rats. Membrane preparations (150 µg/lane) were subjected to SDS-PAGE (10%, wt/vol, polyacrylamide), and immunoblotting was performed using antibodies reactive against all known ß-subunits. Immunoreactive proteins were visualized by chemoluminescence as described in "Methods." The positions of the molecular mass standards are indicated.

Another possible alteration of the {alpha}-adrenergic signal transduction cascade might affect the effector enzyme, PLC. Therefore, PLC activity was measured in the same membrane preparations as receptor densities and G protein levels. A representative experiment performed in the presence of 100 µmol/L calcium, a concentration at which PLC is maximally activated, is shown in Fig 6Down. PLC activity was reduced by 32% [22.4±2.2 nmol/min per mg protein in TG(mREN2)27 rats versus 33.1±3.1 nmol/min per mg protein in control rats] in transgenic rats compared with control rats. This decrease was statistically significant. The data presented here are consistent with desensitization of the {alpha}1-adrenergic signal tranduction cascade at the level of the effector.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 6. Inositol phosphate formation in left ventricular myocardial membrane preparations from control (Control; open bar) and transgenic [TG(mREN2)27; hatched bar] rats. Membrane preparations (0.5 µg/tube) were incubated with phospholipid vesicles containing PtdIP2 for 30 minutes at 25°C in the presence of 100 µmol/L free Ca2+. The activities were measured in the same experiment. The experiment shown is representative of at least three experiments performed. Values are mean±SEM. *P<.05 vs Control.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The present study demonstrates that despite an increased {alpha}-adrenoceptor density, the positive inotropic response to {alpha}-adrenoceptor agonists is decreased in transgenic rats expressing the mouse renin gene. These findings suggest alterations of the signaling cascade distal to the receptor. The expression of {alpha}q and {alpha}11, the two ubiquitously expressed members of the Gq family, was verified in left ventricles of control and transgenic rats by RT-PCR. The two additional members {alpha}14 and {alpha}16, which are known to exhibit a more restricted expression pattern,18 were not detected under the conditions applied. The steady state levels of {alpha}q/11, the {alpha}-subunits of the Gq family expressed in the heart, were unchanged. The levels of both 35 and 36 kD ß-subunits were also similar in control and transgenic rats. In contrast, PLC activity was significantly decreased in TG(mREN2)27.

These findings could be explained by several mechanisms. First, the receptor could be uncoupled from Gq/11 despite quantitatively unchanged {alpha}q/11 and ß{gamma}-subunit protein levels. A qualitative alteration of G protein {alpha}- and/or ß{gamma}-subunits might be responsible for such a functional signal transduction defect. However, the data obtained by assaying PLC activity provide indirect evidence against this hypothesis. Enzyme activity was measured in a cell-free system in which no receptor activation occurs. The decrease in activity in transgenic rats was similar at different calcium concentrations. Under the conditions as described in the legend to Fig 6Up, the enzyme is maximally stimulated by calcium, independently from receptors and G proteins. The second and more likely explanation for the data presented is a defect of PLC itself. This could be a decrease in steady state PLC protein levels, a change in PLC isozyme expression pattern, or a decrease in specific activity. Unfortunately, the quantitation of PLC protein and mRNA levels in rat heart is very difficult due to a low abundance of the respective transcripts and proteins. Moreover, it is possible that rat heart contains as yet unknown PLC isozymes, changes of which might contribute to the decrease in activity observed in TG(mREN2)27.

An example for a decrease in specific activity of a PLC isozyme has been reported recently.19 In Alzheimer's disease, protein levels of PLC{delta}1 are increased, while PLC activity is unchanged, indicating a decrease in the specific activity of PLC{delta}1. The first study providing evidence for an agonist-induced desensitization process distal to G proteins has been published recently.20 Cross-desensitization of the fMet-Leu-Phe receptor–G protein–PLC-signaling cascade by other chemotactic receptors has been found to occur at the level of PLC in RBL-2H3 rat basophilic leukemia cells transfected with the respective receptors.20 Similarly, the data reported in the present study could be explained by desensitization of the {alpha}-adrenergic signaling cascade at the level of the effector enzyme PLC. In TG(mREN2)27, the sympathetic nervous system is activated, and norepinephrine levels are increased in the periphery and decreased in the heart in comparison with control rats.13 Since norepinephrine is an agonist for {alpha}- and ß-adrenergic receptors, the PLC downregulation could be either the result of homologous desensitization via {alpha}-adrenoceptors or cross-desensitization via ß-adrenoceptors. This question will have to be addressed by studies in which transgenic animals are treated with {alpha}- and ß-blockers, respectively. However, a mechanism distinct from increased norepinephrine levels and its sequelae must be involved in PLC desensitization in TG(mREN2)27 as in a polygenic hypertrophy model, the SHR, circulating norepinephrine levels are also increased, but {alpha}-adrenoceptor density is decreased.11 There are contradictory results on inositol phosphate formation in response to {alpha}-adrenergic stimulation in SHR: Ivorra et al11 reported a decrease, Kawaguchi et al10 an increase, in the PLC response to norepinephrine in SHR. The positive inotropic response to {alpha}-adrenergic activation has been reported to be increased in prehypertensive SHR.9 In another condition in which the sympathetic nervous system is activated, ie, human heart failure, the results on {alpha}-adrenergic signal transduction are also controversial. While Bristow et al21 and Böhm et al22 reported an unchanged {alpha}-adrenoceptor density in heart failure, Steinfath et al23 found an increased {alpha}-adrenoceptor density and reduced {alpha}-adrenergic positive inotropic effect. In heart failure, the {alpha}-adrenergic signal transduction pathway is of particular relevance because it might be a reserve mechanism to maintain inotropy in a state in which the ß-adrenergic system is desensitized. In this context it is noteworthy that there are considerable species differences regarding {alpha}1-adrenoceptor density and the extent of {alpha}1-adrenoceptor–mediated positive inotropic effects. In rat heart, these effects are particularly pronounced,3 and the increase in force of contraction has been shown to correlate with the increase in inositol phosphate formation.3 4 Desensitization of the ß-adrenergic signaling cascade, ie, downregulation of ß1-adrenoceptors and increase of Gi proteins, has been observed in both SHR24 and TG(mREN2)27.13 Maximal adenylyl cyclase activity was unchanged in both models, indicating an unchanged effector level.

It is tempting to speculate that a mechanism influencing the function of the {alpha}-adrenergic signaling cascade independently from sympathetic activation might be related to the renin-angiotensin-aldosterone system. Although the levels of circulating angiotensin II are not increased in TG(mREN2)27, there is evidence that the local renin-angiotensin-aldosterone system in the heart is activated.12 25 Angiotensin II receptor agonist treatment of TG(mREN2)27 would be useful to investigate a possible influence of the renin-angiotensin-aldosterone system on the {alpha}-adrenergic signal transduction pathway.

Taken together, the data presented are consistent with a desensitization of the {alpha}-adrenoceptor–G protein–PLC signal transduction pathway at the level of the effector enzyme. Future studies will have to characterize the pattern of PLC isozyme expression in control and transgenic rat hearts and to quantify the mRNA levels of the respective isozyme or isozymes by quantitative PCR. Furthermore, the pathophysiological relevance of PLC desensitization will have to be elucidated. Cardiac-specific overexpression of {alpha}1-adrenoceptors might be useful to investigate whether an increase in receptor density results in a compensatory decrease in PLC activity and in cardiac hypertrophy and/or failure, which is clinically important.


*    Selected Abbreviations and Acronyms
 
PLC = phosphoinositide-specific phospholipase C
SDS-PAGE = sodium dodecyl sulfate–polyacrylamide gel electrophoresis
SHR = spontaneously hypertensive rat(s)
RT-PCR = reverse transcription–polymerase chain reaction
TG(mREN2)27 = transgenic rats expressing the mouse Ren-2 gene


*    Acknowledgments
 
This work was supported by the Deutsche Forschungsgemeinschaft (Schn 517/1-1) and the Bundesministerium für Bildung, Wissenschaft, Forschung und Technologie (01 KS 9502). Dr Böhm is a recipient of the Gerhard Hess program of the Deutsche Forschungsgemeinschaft (Bö 896/3-2). We thank Katja Moosdorf for excellent technical assistance.


*    Footnotes
 
Reprint requests to Dr Petra Schnabel, Klinik III für Innere Medizin, Universität zu Köln, Joseph-Stelzmann-Str 9, 50924 Köln, Germany.

Received December 24, 1996; first decision January 15, 1997; accepted May 2, 1997.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Berridge MJ. Inositol triphosphate and calcium signalling. Nature. 1993;361:315-325.[Medline] [Order article via Infotrieve]

2. Nishizuka Y. Intracellular signaling by hydrolysis of phospholipids and activation of protein kinase C. Science. 1992;258:607-614.[Abstract/Free Full Text]

3. Endoh M. Myocardial {alpha}1-adrenoceptors mediate positive inotropic effect and changes in phosphatidylinositol metabolism: species differences in receptor distribution and the intracellular coupling process in mammalian ventricular myocardium. Circ Res. 1991;68:1179-1190.[Abstract/Free Full Text]

4. Scholz J, Troll U, Sandig P, Schmitz W, Scholz H, Schulte am Esch J. Existence and {alpha}1-adrenergic stimulation of inositol polyphosphates in mammalian heart. Mol Pharmacol. 1992;42:134-140.[Abstract]

5. Terzic A, Puceat M, Vassort G, Vogel SM. Cardiac {alpha}1-adrenoceptors: an overview. Pharmacoll Rev. 1993;45:147-175.

6. Schmitz W, Eschenhagen T, Mende U, Müller FU, Scholz H. The role of alpha1-adrenergic and muscarinic receptors in cardiac function. Eur Heart J. 1991;12(suppl F):83-87.

7. Simpson PC. Norepinephrine-stimulated hypertrophy of cultured rat myocardial cells is an alpha1 adrenergic response. J Clin Invest. 1983;72:732-738.

8. LaMorte VJ, Thorburn J, Absher D, Spiegel A, Heller Brown J, Chien KR, Feramisco JR, Knowlton KU. Gq- and ras-dependent pathways mediate hypertrophy of neonatal rat ventricular myocytes following {alpha}1-adrenergic stimulation. J Biol Chem. 1994;269:13490-13496.[Abstract/Free Full Text]

9. Böhm M, Mende U, Schmitz W, Scholz H. Increased sensitivity to {alpha}-adrenoceptor stimulation but intact muscarinergic and purinergic isoprenaline-antagonistic effect in prehypertensive cardiac hypertrophy of spontaneously hypertensive rats. Naunyn Schmiedeberg's Arch Pharmacol. 1986;333:284-289.[Medline] [Order article via Infotrieve]

10. Kawaguchi H, Sano H, Iizuka K, Okada H, Kudo T, Kageyama K, Muramoto S, Murakami T, Okamoto H, Mochizuki N, Kitabatake A. Phosphatidylinositol metabolism in hypertrophic rat heart. Circ Res. 1993;72:966-972.[Abstract/Free Full Text]

11. Ivorra D, Gascon S, Vila E, Badia A. {alpha}-Adrenoceptor subtypes and inositol phosphate production in heart ventricles of spontaneously hypertensive rats. J Cardiovasc Pharmacol. 1993;21:931-936.[Medline] [Order article via Infotrieve]

12. Mullins JJ, Peters J, Ganten D. Fulminant hypertension in transgenic rats harbouring the mouse Ren-2 gene. Nature. 1990;344:541-544.[Medline] [Order article via Infotrieve]

13. Böhm M, Moll M, Schmid B, Paul M, Ganten D, Castellano M, Erdmann E. ß-adrenergic neuroeffector mechanisms in cardiac hypertrophy of renin transgenic rats. Hypertension. 1994;24:653-662.[Abstract/Free Full Text]

14. Tawfik-Schlieper H, Moll M, Schmid B, Schwinger RHG, Paul M, Ganten D, Böhm M. Alterations of cardiac {alpha}- and ß-adrenoceptors and inotropic responsiveness in hypertensive transgenic rats harbouring the mouse renin gene (TGR(mREN2)27). Clin Exp Hypertens. 1995;17:631-648.

15. Schnabel P, Schreck R, Schiller DL, Camps M, Gierschik P. Stimulation of phospholipase C by a mutationally activated G protein {alpha}16 subunit. Biochem Biophys Res Commun. 1992;188:1018-1023.[Medline] [Order article via Infotrieve]

16. Schnabel P, Gäs H, Nohr T, Camps M, Böhm M. Identification and characterization of G protein-regulated phospholipase C in human myocardium. J Mol Cell Cardiol. 1996;28:2419-2427.[Medline] [Order article via Infotrieve]

17. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156-159.[Medline] [Order article via Infotrieve]

18. Wilkie TM, Scherle PA, Strathmann MP, Slepak VZ, Simon MI. Characterization of G-protein {alpha} subunits in the Gq class: expression in murine tissues and in stromal and hematopoietic cell lines. Proc Natl Acad Sci U S A. 1991;88:10049-10053.[Free Full Text]

19. Shimohama S, Matsushima H, Fujimoto S, Takenawa T, Taniguchi T, Kameyama M, Kimura J. Differential involvement of phospholipase C in Alzheimer's disease. Gerontology. 1995;41:13-19.

20. Richardson R, Ali H, Tomhave ED, Haribabu B, Snyderman R. Cross-desensitization of chemoattractant receptors at multiple levels: evidence for a role for inhibition of phospholipase C activity. J Biol Chem. 1995;270:27829-27833.[Abstract/Free Full Text]

21. Bristow MR, Minobe W, Rasmussen R, Hershberger RE, Hoffman BB. {alpha}1-Adrenergic receptors in nonfailing and failing human heart. J Pharmacol Exp Ther. 1988;247:1039-1045.[Abstract/Free Full Text]

22. Böhm M, Diet F, Feiler G, Kemkes B, Kreuzer E, Weinhold C, Erdmann E. Subsensitivity of the failing human heart to isoprenaline and milrinone is related to beta-adrenoceptor downregulation. J Cardiovasc Pharmacol. 1988;14:726-732.

23. Steinfath M, Danielsen W, von der Leyen H, Mende U, Meyer W, Neumann J, Nose M, Reich T, Schmitz W, Scholz H, Starbatty J, Stein B, Döring V, Kalmar P, Haverich A. Reduced {alpha}1- and ß2-adrenoceptor-mediated positive inotropic effects in human end-stage heart failure. Br J Pharmacol. 1992;105:463-469.[Medline] [Order article via Infotrieve]

24. Böhm M, Castellano M, Paul M, Erdmann E. Cardiac norepinephrine, ß-adrenoceptors, and Gi{alpha}-proteins in prehypertensive and hypertensive spontaneously hypertensive rats. J Cardiovasc Pharmacol. 1994;23:980-987.[Medline] [Order article via Infotrieve]

25. Ganten D, Lindpaintner K, Ganten U, Peters J, Zimmermann F, Bader M, Mullins J. Transgenic rats: new animal models in hypertension research. Hypertension. 1991;17:843-855.[Free Full Text]




This article has been cited by other articles:


Home page
J CARDIOVASC PHARMACOL THERHome page
L. Cao, M. H. Weil, S. Sun, and W. Tang
Vasopressor Agents for Cardiopulmonary Resuscitation
Journal of Cardiovascular Pharmacology and Therapeutics, June 1, 2003; 8(2): 115 - 121.
[Abstract] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. M. Jacinto, J. J. Mullins, and K. D. Mitchell
Enhanced renal vascular responsiveness to angiotensin II in hypertensive ren-2 transgenic rats
Am J Physiol Renal Physiol, February 1, 1999; 276(2): F315 - F322.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
O. Zolk, M. Flesch, G. Nickenig, P. Schnabel, and M. Bohm
Alteration of intracellular Ca2+-handling and receptor regulation in hypertensive cardiac hypertrophy: insights from Ren2-transgenic rats
Cardiovasc Res, July 1, 1998; 39(1): 242 - 256.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schnabel, P.
Right arrow Articles by Böhm, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schnabel, P.
Right arrow Articles by Böhm, M.