This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wilson, E. Articles by Ives, H. E. Search for Related Content PubMed PubMed Citation Articles by Wilson, E. Articles by Ives, H. E.

(Hypertension. 1998;31:170.)
© 1998 American Heart Association, Inc.

Workshop on Vascular Biology & Hypertension: From Molecules to Humans

Strain-Responsive Regions in the Platelet-Derived Growth Factor-A Gene Promoter

Emily Wilson; Franklin Vives; Tucker Collins; Harlan E. Ives

From the Cardiovascular Research Institute, Division of Nephrology, University of California, San Francisco (EW, FV, HEI), and the Department of Pathology, Brigham and Women’s Hospital, Boston, (TC)

Correspondence to Harlan E. Ives, MD, Box 0532 HSE 672, University of California, San Francisco, CA 94143. E-mail: ives{at}itsa.ucsf.edu

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Proliferation of cultured neonatal vascular smooth muscle (VSM) cells is enhanced by exposure to cyclic mechanical strain, in part through autocrine action of secreted platelet-derived growth factor (PDGF). We examined transcription factors and DNA response elements that may participate in the induction of PDGF-A gene transcription by mechanical strain. PDGF-A mRNA increased gradually over 4 to 24 hours exposure to cyclic (1Hz) strain. This was due, at least in part, to increased transcription since a full length (890bp) PDGF-A promoter reporter construct was induced 3.5-fold in transfected VSM cells exposed to strain for 24 hours. A series of PDGF-A promoter truncation reporter constructs was used to identify potential regions of the promoter involved in regulation by strain. Strain-responsive regions were found between -262bp and -92bp and between -92bp and -41bp of the promoter. Since these regions are GC-rich and contain response elements for Egr-1 and Sp-1, we examined expression of these transcription factors in response to strain. mRNA for both factors increased over 0.5 to 4 hours of strain, while protein expression for both increased gradually over a 24 hours period. Gel shift assays with a probe specific for Egr-1 demonstrated at least 1 prominent new shifted band after 4 to 12 hours exposure to strain. An Sp-1 probe demonstrated constitutive shifted bands that did not change in response to strain. Thus, GC-rich regions in the proximal 92bp of the PDGF-A promoter contain mechanical strain-responsive elements that bind Egr-1 and possibly Sp-1.

Key Words: vascular smooth muscle • mechanical strain • transcription factors • reporter genes • growth factors

Abbreviations: VSM = vascular smooth muscle • PDGF = platelet-derived growth factor • Hz = Hertz • SHR = spontaneously hypertensive rat • GAPDH = glyceraldehyde 3-phosphate dehydrogenase • dCTP = deoxycytosine trisphosphate • ECL = enhanced chemiluminescence • RSV = Rous sarcoma virus • EDTA = ethylenediaminetetraacetic acid • DTT = dithiothreitol • dIdC = poly deoxyinosine-deoxycytosine • CAT = chloramphenicol acetyltransferase • SRE = serum response element • BSA = bovine serum albumin

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
The arterial wall is exposed to significant mechanical strain during the cardiac cycle.¹ Mechanical forces may participate in the normal development of blood vessels² and in the pathological changes observed in hypertension.^3–5 Recently, mechanical forces have been found to elicit a wide range of phenotypic responses both in intact tissues and in cultured cells.^1,6

Our laboratory has previously shown that the application of cyclic (1 Hz) mechanical strains of 10% to 20% to neonatal VSM cells cultured on deformable silicone elastomer membranes leads to increased proliferation, most likely via autocrine action of secreted PDGF.⁷ The magnitude of cyclic strain necessary to induce PDGF in this in vitro system is comparable to the strain found in many vessels in situ.¹ Both PDGF-A and -B appear in the medium after 24 hours exposure to strain; PDGF-A⁷ and -B⁸ RNAs are also increased by strain. This response to mechanical strain observed in vitro may be relevant to the pathophysiology of hypertension, as several investigators have demonstrated increased expression of PDGF in blood vessels of hypertensive animals.⁹ Negoro et al showed that antihypertensive drugs reduce expression of PDGF-A in vessel walls of hypertensive SHR rats.⁴

The PDGF-A promoter has been cloned^10,11 and many of its regulatory elements have been identified.^4,12–15 These studies suggest that a GC rich region in the proximal 100bp to 150bp of the promoter is responsible for basal PDGF-A expression and for regulation by serum¹² and phorbol esters.¹⁵

In the present study, we further characterize the molecular mechanisms by which mechanical strain regulates transcription of PDGF-A chain gene. We show that the proximal GC-rich region of the promoter is involved in regulation of the gene by mechanical forces. We identify a 54-bp fragment that contains a strain responsive region of the PDGF-A chain promoter and show that the transcription factors that interact with this region, Egr-1 and Sp-1, are regulated by mechanical strain.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cell Culture
Primary cultures of VSM cells from newborn rats were established by Peter Jones (University of Southern California, Los Angeles). From these primary cultures, the R22 D cell line was established¹⁶) and generously supplied by Dr Jones at passage 15. The cells were maintained in minimum essential medium with 10% fetal bovine serum (FBS), 2% tryptose phosphate broth, penicillin (50 U/ml), and streptomycin 50 (U/ml) in a humidified atmosphere of 5% CO₂ at 37°C. Culture medium was changed every other day until cells were confluent. Cells were subcultured with trypsin-versene and cells from passages 16–27 were used for the current studies.

Cells were placed in serum-free "quiescence" medium (minimun essential medium, 2% tryptose phosphate broth, 0.5 mg/ml transferrin, 0.5mg/ml BSA) and changed every day for 3 days before the initiation of strain.

Application of Cyclic Strain to Cultured Cells
Cells grown in 6-well silicone elastomer-bottomed culture plates (Flexcell Corp.) were subjected to cyclic mechanical strain using a Flexercell Stress Unit (Flexcell Corp.). The stress unit, a modification of the device described by Banes et al,¹⁷ consists of a computer-controlled vacuum unit and a base plate to hold the culture dishes. Vacuum (20 kPa) is repetitively applied (1 Hz, 0.5s on-time) at 60 cycles per minute to the rubber-bottomed dishes via the base plate, which is placed in a standard CO₂ tissue culture incubator. The computer system controls the frequency of deformation and the negative pressure applied to the plates. Application of vacuum results in maximal strain of 25% to cells at the periphery of the dishes and minimal strain in the center of the dish (< 3%).¹⁸

In all time-dependent experiments (Fig 1, 5–8), cells were placed in the strain apparatus in descending time order. All time points were then harvested at the same time. The 0 time point in each experiment thus serves as the time control for the duration of the strain manipulation.

View larger version (35K): [in this window] [in a new window]   Figure 1. Cyclic mechanical strain increases PDGF-A mRNA and protein. VSM cells on flex plates were exposed to cyclic mechanical strain for the indicated times. Fifteen µg samples of total RNA were subjected to Northern blot analysis with cDNA probes for PDGF-A and GAPDH as described in experimental procedures. Blot shown is representative of 5 independent experiments. Ten µg samples of total cell protein were electro-phoresed on 15% SDS-polyacrylamide gels and subjected to Western blot analysis with a polyclonal PDGF-A antibody (see experimental procedures). Blot shown is representative of 3 independent experiments.

View larger version (39K): [in this window] [in a new window]   Figure 5. Mechanical strain induces Egr-1 expression. VSM cells on flex plates were exposed to cyclic mechanical strain for the indicated times. Fifteen µg samples of total RNA were subjected to Northern blot analysis with cDNA probes for Egr-1 and GAPDH as described in experimental procedures. Ten µg samples of total cell protein were electorphoresed on 7% SDS-polyacrylamide gels and subjected to Western blot analysis with a polyclonal Egr-1 antibody (see experimental procedures). Blots shown are representative of 3 independent experiments.

View larger version (49K): [in this window] [in a new window]   Figure 6. Mechanical strain induces Sp-1 expression. VSM cells on flex plates were exposed to cyclic mechanical strain for the indicated times. Fifteen µg samples of total RNA were subjected to Northern blot analysis with cDNA probes for Sp-1 and GAPDH as described in experimental procedures. Ten g samples of total cell protein were electorphoresed on 7% SDS-polyacrylamide gels and subjected to Western blot analysis with a polyclonal Sp-1 antibody (see experimental procedures). Blots shown are representative of 3 independent experiments.

View larger version (66K): [in this window] [in a new window]   Figure 7. Mechanical strain induces protein interactions with consensus Egr-1 binding sequence. Cell lysates from VSM cells were subjected to mechanical strain for the indicated times and incubated for 20 minutes at room temperature with a double stranded 5' end-labeled oligodeoxynucleotide with the sequence 5'GGATCCAGCGGGGGCGAGCGGGGGCGA3'. Electrophoretic mobility gel shift analysis was performed on a 5% nondenaturing polyacrylamide gel. Data presented are representative of 3 similar experiments.

View larger version (64K): [in this window] [in a new window]   Figure 8. Mechanical strain does not induce protein interaction with consensus Sp-1 binding sequence. Cell lysates from VSM cells were subjected to mechanical strain for the indicated times and incubated for 20 minutes at room temperature with a double stranded 5' end-labeled oligodeoxynucleotide with the sequence 5'ATTCGATCGGGGCGGGGCGAGC3'. Electrophoretic mobility gel shift analysis was performed on a 5% non-denaturing polyacrylamide gel. Data presented are representative of 3 similar experiments.

Northern Blot Analysis
Total RNA was isolated from VSM cells using RNA STAT-60 (Tel-Test Co.). RNA (15 µg/lane) was electrophoresed on a 1% glyoxal denaturing gel and transferred to Hybond N nitrocellulose membrane (Amersham Corp.) via capillary action in 20 x SSC (3 mol/L NaCl, 0.3 mol/L sodium citrate). Blots were washed with a prehybridization buffer containing 1 mol/L NaCl, 1% SDS and were then hybridized overnight with the desired DNA probe in buffer containing 1 mol/L NaCl, 1% SDS, 10% dextran sulfate, and 10 (g/ml salmon sperm DNA. Probes were labeled with [-³²P] dCTP (3,000 Ci/mmol; Amersham Corp.) using a random prime labeling kit (Pharmacia) at 65°C. Blots were washed in SSC (0.15 mol/L NaCl, 0.015 mol/L sodium citrate)/0.1% SDS and exposed to Hyperfilm MP (Amersham Corp.) at -70°C. All blots were subsequently stripped and rehybridized with a cDNA probe to GAPDH to confirm equal loading. cDNAs used in these studies were generously provided by the following groups: rat PDGF -A (Cecilia Giachelli and Junichi Tagenchi, University of Washington, Seattle), Sp-1 (Robert Tjian, University of California, Berkeley), Egr-1 (Vikas Sukhatme, Harvard Medical School, Boston).

Western Blot Analysis
Following two washes with Ca²⁺ and Mg²⁺-free PBS (Media Tech Inc.), cells were boiled 5 minutes in PBS containing 0.5% SDS. Protein was quantified relative to a BSA standard curve using BCA reagent (Pierce). Following electrophoresis on SDS-polyacrylamide gels (percent acrylamide indicated in Figure Legends), bands were transferred electrophoretically to Hybond ECL membrane(Amersham Corp.) in transfer buffer (50 mmol/L Tris, 380 mmol/L glycine, 20% methanol) at 200 mA for 3 hours using a BioRad Transblot system (Biorad). Nonspecific protein interactions were blocked with 10% nonfat dry milk in TBS-T (20 mmol/L Tris, pH 7.5, 50 mmol/L NaCl, and 0.1% Tween-20). Membranes were then washed and incubated with the primary antibody of interest for 1 hour at room temperature. After washing in TBS-T, membranes were incubated with Horseradish peroxidase (HRP)-conjugated secondary antibodies (Amersham Corp.). Bands were visualized using enhanced chemiluminescence reagent (ECL, Amersham Corp) and Hyperfilm ECL (Amersham Corp). Antibodies to PDGF-A, Egr-1, and Sp-1 were obtained from Santa Cruz Biologies.

Transfections and Reporter Assays
PDGF-A promoter truncation constructs pACCAT12 (-890bp), pACCAT(Sac1 (-643bp), pACCAT(Xhol (-262bp), pACCAT.89 (-92bp), F11 (-41bp), were prepared as previously described.¹¹ For normalization, all constructs (20 µg/30 cm² stretch plate) were co-transfected with a plasmid containing the constitutively expressed RSV-ß-galactosidase (5 µg). Transfection was accomplished at 36° for 4 hours using DEAE-dextran with chloroquine as previously described.¹⁹ Following transfection, cells were allowed to recover for 24 hours in complete medium. Medium was then changed to quiescence medium and cells were incubated for another 24 hours. Quiescence medium was then replaced and the cells were subjected to 24 hours of mechanical strain. Cell lysates were harvested in Reporter Lysis Buffer (Promega Corp) and assayed for ß-galactosidase and CAT activity. ß-galactosidase was assayed with the Promega assay kit. CAT activity was measured by a modification of the method of Sleigh.²⁰ The resulting lysates were added to assay buffer containing¹⁴C-acetyl-CoA (0.02 mCi, 0.5 mmol/L) and unlabeled chloramphenicol (1.6 mmol/L). The mixtures were incubated at 37°C for 1 to 4 hours. The lysates were extracted with ethyl acetate. The organic phase was counted in a scintillation counter. Mock transfections were performed to determine background.

Gel Shift Assays
Following exposure to strain, whole cell extracts from VSM cells were prepared for electrophoretic mobility shift assays as described previously.²¹ Briefly, cells from 1 stretch plate (30 cm²) were suspended in 1 mL of PBS and were harvested by centrifugation. The pellet was resuspended in 100 mL of extraction buffer (20 mmol/L Hepes (pH 7.8), 450 mmol/L NaCl, 0.4 mmol/L EDTA, 0.5 mmol/L DTT, 25% glycerol, 0.5 mmol/L PMSF). The extract was subjected to 3 cycles of freeze (dry ice/ethanol bath) and thaw (37°C). Cellular debris was removed by centrifugation (14,000g) for 10 minutes at 4°C. Protein determinations on the resulting supernatant were performed using BCA reagent (Pierce) with BSA as a standard. Electrophoretic mobility shift assays were carried out using 5–10 µg of whole cell extract and 10 fmol/ml of labeled double stranded oligodeoxynucleotides in 5 x binding buffer (20% glycerol, 5 mmol/L MgCl₂, 2.5 mmol/L EDTA, 2.5 mmol/L DTT, 250 mmol/L NaCl, 50 mmol/L Tris HCl, pH 7.5, 0.25 mg/ml poly dIdC · poly dIdC) (Promega). Oligodeoxynucleotides were 5' terminally labeled with T4 polynucleotide kinase (Promega) and [-³²P ]-ATP (3000 Ci/mmol/L) (Amersham). Electrophoresis was carried out on a 5% nondenaturing polyacrylamide gel with 0.5 x TBE (44.5 mmol/L Tris base, 44.5 mmol/L borax, 1 mmol/L EDTA). Autoradiography was performed with Hyperfilm-MP (Amersham) at 80°C.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cyclic Mechanical Strain Induces Expression of PDGF-A in VSM Cells
We first assessed the detailed time course (0.5 to 24 hours) for expression of PDGF-A mRNA and protein during exposure of neonatal rat VSM cells to cyclic strain (1 Hz). The major 2.8 kb PDGF-A transcript, as assessed by Northern blot analysis, was expressed at low levels in the unstrained cells and was significantly increased in response to strain (Fig 1, top). Expression peaked at 4 to 8 hours and remained elevated for at least 24 hours. PDGF-A protein expression, as measured by Western blot analysis, was nondetectable in control cells, first appeared following 2 hours of mechanical strain, and continued to increase for at least 24 hours (Fig 1, bottom).

Identification of Regions of the PDGF-A Promoter Required for Strain-Induced Gene Expression
To begin analysis of the molecular basis for strain-induced expression of PDGF-A mRNA, VSM cells were transiently transfected with a reporter construct containing the "full length" (890bp) PDGF-A promoter fused to CAT reporter cDNA (Fig 2A). Normalized CAT activity increased by approximately 3.5 fold following exposure to cyclic mechanical strain for 24 hours (Fig 2B), indicating that cyclic mechanical strain induces transcription from the PDGF-A promoter.

View larger version (25K): [in this window] [in a new window]   Figure 2. Mechanical strain increases PDGF-A promoter activity. (A) Schematic of 890bp PDGF-A promoter CAT construct (pAC-CAT12) used to transfect VSM cells. (B) Cells on flex plates were transiently transfected with pAC-CAT12 and RSV-ßgal plasmids) as described in experimental procedures. Cells were exposed to cyclic mechanical strain for 24 hours. Following cell lysis, CAT and ß-galactosidase activities were determined. Data from 3 independent experiments was combined and is presented as fold increase (±SE) in normalized CAT activity compared to control cells.

To determine the minimal promoter region that mediates strain-induced increases in PDGF-A, reporter constructs bearing 5' nested deletions of the promoter (Fig 3) were transfected into VSM cells. Transfected cells were subjected to 24 hours of cyclic mechanical strain (Fig 3). The -643bp construct responded similarly to strain as the -890bp full-length promoter. The -262bp construct had reduced basal promoter activity, but an increased response to strain. The -92bp construct exhibited increased basal promoter activity compared to the full-length promoter, but still responded to strain. The -41bp construct, as previously reported¹¹ was inactive. Thus, regions of the PDGF-A promoter between -262bp and -92bp and between -92bp and -41bp appear to confer responsiveness to mechanical strain. Further analysis was directed at the region from -92bp to -41bp of the promoter.

View larger version (22K): [in this window] [in a new window]   Figure 3. Effect of mechanical strain on reporter gene expression driven by 5' deletions of PDGF A promoter. VSM cells were transiently transfected with PDGF-A promoter truncation constructs pACCAT12 (-890), pACCATSac1 (-643), pACCATXho1 (-262), pACCAT.89 (-92), F11 (-41), and RSV-ß-gal. Cells were exposed to cyclic mechanical strain for 24 hours. CAT activity was measured and normalized to ß-galactosidase) activity as in Figure 2. Normalized CAT activity for the -890 construct in cells not subjected to strain was arbitrarily set at 1.0. Data shown is representative of 3 independent experiments.

Analysis of the DNA sequence in this region (Fig 4) identifies the consensus sequences for 3 Sp-1 and 3 Egr-1 binding sites.¹¹ Since both Sp-1 and Egr-1 are positive regulatory factors for PDGF-A expression in other systems,^4,15 we examined the expression of these factors in response to mechanical strain.

View larger version (17K): [in this window] [in a new window]   Figure 4. DNA sequence of minimal promoter necessary for strain-induced transcription. Underlining identifies consensus binding sequence (GNGGGGGNG) for Egr-1 protein (N=any nucleotide); <*******> identifies consensus binding sequence (GGGCGG) for Sp-1; +1 identifies transcription start site.

Mechanical Strain Induces Expression of Both Egr-1 and Sp-1
Steady-state levels of mRNA and protein for Egr-1 and Sp-1 were determined after exposure to mechanical strain for 0.5 to 24 hours. Mechanical strain rapidly induced expression of Egr-1 message, which peaked at 30 to 60 minutes of exposure (Fig 5, top). Message levels then dropped nearly to basal but remained marginally elevated for the remainder of the time course and transiently increased a second time 12 hours after the onset of cyclic mechanical strain. In parallel, there was a gradual increase in Egr-1 protein levels, which appeared to peak approximately 12 hours after the initiation of mechanical strain (Fig 5, bottom).

In contrast to the immediate response seen for Egr-1 mRNA expression, induction of Sp-1 message was slower and more prolonged (Fig 6, top). Sp-1 mRNA increased gradually during the first few hours of exposure to strain, peaked at 4 hours and remained elevated for at least 24 hours. Sp-1 protein expression was also increased in response to mechanical strain. The increase was first evident at 30 minutes and continued to increase gradually for 24 hours (Fig 6, bottom). Since expression of both Egr-1 and Sp-1 was induced by mechanical strain, we next determined whether strain causes protein binding to the DNA response elements for these transcription factors.

³²P-labeled oligonucleotides corresponding to the consensus sequence for Egr-1 (Fig 7) was used in electrophoretic mobility shift assays. With the Egr-1 probe, there was a prominent constitutive band (A) that increased in intensity after 12 hours of mechanical strain. In addition, there was a new band (B) that first became evident after 4 hours of strain and increased in intensity after 8 to 12 hours of strain. In contrast, when the Sp-1 probe was used, there were two constitutive bands, but no new shifted bands were seen in response to strain (Fig 8). All labeled shifted bands, constitutive and strain-induced, were eliminated by the presence of a 50 fold to 100 fold molar excess of an unlabeled oligodeoxyribonucleotide of the same sequence (data not shown).

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
These studies were aimed at identification of regions within the promoter of the PDGF-A chain gene that confer responsiveness to cyclic mechanical strain. We show that this process can be readily studied in cultured VSM cells using transfected PDGF-A promoter reporter constructs. A "full-length" 890bp promoter CAT construct was induced more than 3-fold by mechanical strain, showing that at least part of the induction of this gene by strain occurs at the transcriptional level. This promoter construct contains binding sites for a number of known transcription factors. Eight Sp-1 sites, four Egr-1 sites, an AP-2 site, a serum response element (SRE), and a GC factor site have been identified in this 890bp region of the PDGF-A promoter^22–25 (Fig 2).

Sites that might participate the induction of the PDGF-A gene by strain were further analyzed by promoter truncation analysis. Using this approach, several regions of the promoter were identified. The region from -643bp to -240bp appears to contain a positive element for basal transcription and the region from -240bp to -92bp appears to contain both a negative element for basal transcription and a positive element for the strain response. Finally, the proximal 92bp of the promoter supports basal transcription and a significant response to mechanical strain. This GC-rich region, which contains binding sites for the transcription factors Egr-1 and Sp-1, has previously been implicated in regulation of the PDGF-A gene by a variety of stimuli (see Introduction). In view of the importance of this region of the promoter in overall regulation of PDGF-A expression, the remaining studies of this work were limited to its analysis.

We found that expression of Egr-1 and Sp-1 is regulated by cyclic mechanical strain in a unique temporal fashion. Egr-1 mRNA exhibited two peaks of increased expression (at 30 minutes and 12 hours), while Sp-1 mRNA exhibited a single peak at 4 hours to 8 hours after initiation of strain. Both proteins began to increase after 1 hour of strain and continue to increase for about 12 hours. Gel shift analysis with a labeled dsDNA corresponding to the consensus binding sequence for Egr-1 revealed a new shifted band appearing at 8 hours to 24 hours after the onset of cyclic strain, roughly comparable to the time of maximal Egr-1 protein expression. On the other hand, a probe for the Sp-1 consensus-binding site did not reveal shifted bands in response to strain.

The failure to demonstrate shifted bands in response to mechanical strain with a simple Sp-1 probe does not rule out the possibility that Sp-1 may be involved in strain regulation of PDGF-A. Work from other laboratories suggests that Sp-1 is probably involved in regulation of PDGF-A expression, perhaps through complex interactions on the promoter. Kaetzel and coworkers²⁶ demonstrated a requirement for the Sp-1 core sequence, and not the Egr-1 sequence, for formation of specific DNA-protein complexes on the PDGF-A promoter. Negoro and coworkers⁴ examined the role of various transcription factors (Sp-1, Egr-1, AP-2, serum response factor (SRF), and GC binding factor) in the induction of PDGF-A by increased blood pressure. Among these factors, only Sp-1 was regulated by changes in blood pressure. Our finding of increased expression of Sp-1 by mechanical strain suggests that this factor probably also participates in the regulation of PDGF-A by mechanical strain. Taken together, the various expression and gel shift assays in the current work implicate Egr-1, and possibly Sp-1, in the induction of PDGF-A by continuous cyclic mechanical strain.

Overlapping Egr-1 and Sp-1 binding sites are found in the promoters of numerous other genes thought to be involved in the response to vascular injury or in development of vascular occlusive disease.²⁷ These genes include transforming growth factor ß,²² tissue factor,^28,29z urokinase-type plasminogen activator³⁰ and PDGF-B.²⁷ Kachigian and coworkers²⁷ have suggested that the rapid induction of Egr-1 in response to endothelial injury may be important in orchestrating the expression of these (and other) genes.

To date, there is only limited information on the regulation of gene expression by mechanical forces in general.³¹ Resnick et al³² found a "shear stress responsive element" in the PDGF-B promoter, but it is not clear that this element participates in the response to cellular strain. Our demonstration of an important role for Egr-1, and possibly Sp-1, in the induction of PDGF-A by cyclic mechanical strain adds to this growing body of information. Further investigation of the mechanism(s) by which these transcription factors are induced by a strain should yield deeper insight into the process of mechanotransduction.

	Acknowledgments

 
This work was supported by National Institutes of Health grants HL-48474 and HL-41210. We wish to thank Grace Ma, Henning Morawietz, and Peter Reusch for useful discussions during the course of this work.

Received September 16, 1997; first decision October 22, 1997; accepted October 31, 1997.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Osol G. Mechanotransduction by vascular smooth muscle. J Vasc Res. 1995; 32 : 275 –292.[Medline] [Order article via Infotrieve]

2. Langille BL. Remodeling of developing and mature arteries: endothelium, smooth muscle, and matrix. J Cardiovasc Pharmacol. 1993; 21 : Suppl 1 S11 –S17.[Medline] [Order article via Infotrieve]

3. Folkow B, Grimby G, Thulesius O. Adaptive structural changes of the vascular wall in hypertension and their relationship to control of peripheral resistance. Acta Physiol Scand. 1958; 44 : 255 –272.[Medline] [Order article via Infotrieve]

4. Negoro N, Kanayama Y, Haraguchi M, Umetani N, Nishimura M, Konishi Y, Iwai J, Okamura M, Inoue T, Takeda T. Blood pressure regulates platelet-derived growth factor A-chain gene expression in vascular smooth muscle cells in vivo: An autocrine mechanism promoting hypertensive vascular hypertrophy. J Clin Invest. 1995; 95 : 1140 –1150.[Medline] [Order article via Infotrieve]

5. Skalak TC, Price RJ. The role of mechanical stresses in microvascular remodeling. Microcirculation. 1996; 3 : 143 –165.[Medline] [Order article via Infotrieve]

6. Allen SP, Liang HM, Hill MA, Prewitt RL. Elevated pressure stimulates protooncogene expression in isolated mesenteric arteries. Am J Physiol. 1996; 271 : H1517 –23.[Medline] [Order article via Infotrieve]

7. Wilson E, Mai Q, Sudhir K, Weiss RH, Ives HE. Mechanical strain induces growth of vascular smooth muscle cells via autocrine action of PDGF. J Cell Biol. 1993; 123 : 741 –747.[Abstract/Free Full Text]

8. Ma Y-H, Ling S, Ives HE. Mechanical strain induces expression of PDGF-B chain and PDGF-b receptor in vascular smooth muscle cells. Mol Biol Cell. 1996; 7 : 353a . Abstract.

9. Sarzani R, Arnaldi G, Takasaki I, Brecher P, Chobanian AV. Effects of hypertension and aging on platelet-derived growth factor and platelet-derived growth factor receptor expression in rat aorta and heart. Hypertension. 1991; 18 : 93 –99.[Abstract/Free Full Text]

10. Bonthron DT, Morton CC, Orkin SH, Collins T. Platelet-derived growth factor A chain: Gene structure, chromosomal location, and basis for alternative mRNA splicing. Proc Natl Acad Sci U S A. 1988; 85 : 1492 –1496.[Abstract/Free Full Text]

11. Gashler AL, Bonthron DT, Madden SL, Rauscher FJ, III. Human platelet-derived growth factor A chain is transcriptionally repressed by the Wilms’ tumor suppressor WT1. Proc Natl Acad Sci U S A. 1992; 89 : 10984 –10988.[Abstract/Free Full Text]

12. Lin X, Wang Z, Gu L, Deuel TF. Functional analysis of the human platelet-derived growth factor A-chain promoter. J Biol Chem. 1992; 267 : 25614 –25619.[Abstract/Free Full Text]

13. Takimoto Y, Kuramoto A. Gene regulation by the 5' -untranslated region of the platelet-derived growth factor-A chain. Biochim Biophys Acta. 1994; 1222 : 511 –514.[Medline] [Order article via Infotrieve]

14. Wang Z-Y, Qui. Q-Q, Deuel TF. An S1 nuclease sensitive region in the PDGF A-chain gene promoter contains a positive transcriptional regulatory element. Biochem Biophys Res Comm. 1994; 198 : 103 –110.[Medline] [Order article via Infotrieve]

15. Khachigian LM, Williams AJ, Collins T. Interplay of Sp-1 and Egr-1 in the proximal platelet-derived growth factor A-chain promoter in cultured vascular endothelial cells. J Biol Chem. 1995; 270 : 27679 –27686.[Abstract/Free Full Text]

16. Jones PA, Scott-Burden T, Gevers W. Glycoprotein, elastin, and collagen secretion by rat smooth muscle cells. Proc Natl Acad Sci U S A. 1979; 76 : 353 –357.[Abstract/Free Full Text]

17. Banes AJ, Gilbert J, Taylor D, Monbureau O. A new vacuum-operated stress-providing instrument that applies static or variable duration cycle tension or compression to cells in vitro. J Cell Sci. 1985; 75 : 35 –42.[Abstract]

18. Gilbert JA, Weinhold PS, Banes AJ, Link GW, Jones GL. Strain profiles for circular cell culture plates containing flexible surfaces employed to mechanically deform cells in vitro. J Biomechanics. 1994; 9 : 1169 –1177.

19. Lopta MA, Cleveland DW, Sollner-Webb B. High-level expression of a chloramphenicol acetyltransferase gene by DEAE-dextran-mediated DNA transfection coupled with dimethylsulfoxide of glycerol shock treatment. Nuc Acids Res . 1984; 12 : 5707 –5717.[Abstract/Free Full Text]

20. Sleigh MJ. A nonchromatographic assay for expression of the chloramphenicol acetyltransferase gene in eucaryotic cells. Anal Biochem. 1986; 156 : 251 –256.[Medline] [Order article via Infotrieve]

21. Suzuki E. Guo K, Kolman M, Yu Y-T, Walsh K. Serum induction of MEF2/RSRF expression in vascular myocytes is mediated at the level of translation. Mol Cell Biol. 1995; 15 : 3415 –3423.[Abstract]

22. Norman C, Runswick M, Pollock R, Treisman R. Isolation and properties of cDNA clones encoding SRF, a transcription factor that binds to the c-fos serum response element. Cell. 1988; 55 : 989 –1003.[Medline] [Order article via Infotrieve]

23. Briggs MR, Kadonaga JT, Bell SP, Tjian R. Purification and biochemical characterization of the promoter-specific transcription factor, Sp1. Science. 1986; 234 : 47 –52.[Abstract/Free Full Text]

24. Christy B, Nathans D. DNA binding site of the growth factor-inducible protein Zif268. Proc Natl Acad Sci U S A. 1989; 86 : 8737 –8741.[Abstract/Free Full Text]

25. Mitchell PJ, Wang C, Tjian R. Positive and negative regulation of transcription in vitro: enhancer-binding protein AP-2 is inhibited by SV40 T antigen. Cell. 1987; 50 : 847 –861.[Medline] [Order article via Infotrieve]

26. Kaetzel DM, Maul RS, Liu B, Bonthron D, Fenstermaker RA, Coyne DW. Platelet-derived growth factor A-chain gene transcription is mediated by positive and negative regulatory regions in the promoter. Biochem J . 1994; 301 : 321 –327.[Medline] [Order article via Infotrieve]

27. Khachigian LM, Lindner V, Williams AJ, Collins T. Egr-1-induced endothelial gene expression: A common theme in vascular injury. Science. 1996; 271 : 1427 –1430.[Abstract]

28. Mackman N. Regulation of the tissue factor gene. FASEB J. 1995; 9 : 883 –889.[Abstract]

29. Cui MZ, Parry GC, Edgington TS, Mackman N. Regulation of tissue factor gene expression in epithelial cells. Induction by serum and phorbol 12-myristate 13-acetate. Arteriosder Thromb. 1994; 14 : 807 –814.

30. Verde P, Boast S, Franze A, Robbiati F, Blasi F. An upstream enhancer and a negative element in the 5' flanking region of the human urokinase plasminogen activator gene. Nucleic Acids Res. 1988; 16 : 10699 –10716.[Abstract/Free Full Text]

31. Resnick N, Gimbrone MA. Hemodynamic forces are complex regulators of endothelial gene expression. FASEB J. 1995; 9 : 874 –882.[Abstract]

32. Resnick N, Collins T, Atkinson W, Bonthron DT, Dewey CF, Jr, Gimbrone MA, Jr. Platelet-derived growth factor B chain promoter contains a cis-acting shear-stress-responsive element. Proc Natl Acad Sci U S A. 1993; 90 : 4591 –4595.[Abstract/Free Full Text]

This article has been cited by other articles:

				T. Khomenko, S. Szabo, X. Deng, M. R. Jadus, H. Ishikawa, K. Osapay, Z. Sandor, and L. Chen Suppression of early growth response factor-1 with egr-1 antisense oligodeoxynucleotide aggravates experimental duodenal ulcers Am J Physiol Gastrointest Liver Physiol, June 1, 2006; 290(6): G1211 - G1218. [Abstract] [Full Text] [PDF]

				L. Wang, H.-W. Liu, K. D. McNeill, G. Stelmack, J. E. Scott, and A. J. Halayko Mechanical Strain Inhibits Airway Smooth Muscle Gene Transcription via Protein Kinase C Signaling Am. J. Respir. Cell Mol. Biol., July 1, 2004; 31(1): 54 - 61. [Abstract] [Full Text] [PDF]

				J. Goldman, L. Zhong, and S. Q. Liu Degradation of alpha -actin filaments in venous smooth muscle cells in response to mechanical stretch Am J Physiol Heart Circ Physiol, May 1, 2003; 284(5): H1839 - H1847. [Abstract] [Full Text] [PDF]

				P. R. Standley, A. Camaratta, B. P. Nolan, C. T. Purgason, and M. A. Stanley Cyclic stretch induces vascular smooth muscle cell alignment via NO signaling Am J Physiol Heart Circ Physiol, November 1, 2002; 283(5): H1907 - H1914. [Abstract] [Full Text] [PDF]

				H. M. LANGEVIN, D. L. CHURCHILL, and M. J. CIPOLLA Mechanical signaling through connective tissue: a mechanism for the therapeutic effect of acupuncture FASEB J, October 1, 2001; 15(12): 2275 - 2282. [Abstract] [Full Text] [PDF]

				B. C. Berk Vascular Smooth Muscle Growth: Autocrine Growth Mechanisms Physiol Rev, July 1, 2001; 81(3): 999 - 1030. [Abstract] [Full Text] [PDF]

				S. Ling, G. Deng, H. E. Ives, K. Chatterjee, G. M. Rubanyi, P. A. Komesaroff, and K. Sudhir Estrogen inhibits mechanical strain-induced mitogenesis in human vascular smooth muscle cells via down-regulation of Sp-1 Cardiovasc Res, April 1, 2001; 50(1): 108 - 114. [Abstract] [Full Text] [PDF]

				Y. Feng, J.-H. Yang, H. Huang, S. P. Kennedy, T. G. Turi, J. F. Thompson, P. Libby, and R. T. Lee Transcriptional Profile of Mechanically Induced Genes in Human Vascular Smooth Muscle Cells Circ. Res., December 3, 1999; 85(12): 1118 - 1123. [Abstract] [Full Text] [PDF]

				L. M. Khachigian, F. S. Santiago, L. A. Rafty, O. L.-W. Chan, G. J. Delbridge, A. Bobik, T. Collins, and A. C. Johnson GC Factor 2 Represses Platelet-Derived Growth Factor A-Chain Gene Transcription and Is Itself Induced by Arterial Injury Circ. Res., June 11, 1999; 84(11): 1258 - 1267. [Abstract] [Full Text] [PDF]

				H. Morawietz, Y.-H. Ma, F. Vives, E. Wilson, V. P. Sukhatme, J. Holtz, and H. E. Ives Rapid Induction and Translocation of Egr-1 in Response to Mechanical Strain in Vascular Smooth Muscle Cells Circ. Res., April 2, 1999; 84(6): 678 - 687. [Abstract] [Full Text] [PDF]

				P. R. Standley, T. J. Obards, and C. L. Martina Cyclic stretch regulates autocrine IGF-I in vascular smooth muscle cells: implications in vascular hyperplasia Am J Physiol Endocrinol Metab, April 1, 1999; 276(4): E697 - E705. [Abstract] [Full Text] [PDF]

				J. E. Bishop and G. Lindahl Regulation of cardiovascular collagen synthesis by mechanical load Cardiovasc Res, April 1, 1999; 42(1): 27 - 44. [Full Text] [PDF]

				K. Tamura, Y. E. Chen, M. Lopez-Ilasaca, L. Daviet, N. Tamura, T. Ishigami, M. Akishita, I. Takasaki, Y. Tokita, R. E. Pratt, et al. Molecular Mechanism of Fibronectin Gene Activation by Cyclic Stretch in Vascular Smooth Muscle Cells J. Biol. Chem., October 27, 2000; 275(44): 34619 - 34627. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wilson, E. Articles by Ives, H. E. Search for Related Content PubMed PubMed Citation Articles by Wilson, E. Articles by Ives, H. E.