This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kleinert, H. Articles by Förstermann, U. Search for Related Content PubMed PubMed Citation Articles by Kleinert, H. Articles by Förstermann, U.

(Hypertension. 1998;31:582-588.)
© 1998 American Heart Association, Inc.

Scientific Contributions

Estrogens Increase Transcription of the Human Endothelial NO Synthase Gene

Analysis of the Transcription Factors Involved

Hartmut Kleinert; Thomas Wallerath; Christian Euchenhofer; Irmgard Ihrig-Biedert; Huige Li; ; Ulrich Förstermann

From the Department of Pharmacology, Johannes Gutenberg University, Mainz, Germany.

Correspondence and reprint requests to Dr Ulrich Förstermann, Department of Pharmacology, Johannes Gutenberg University, Obere Zahlbacher Strasse 67, D-55101 Mainz, Germany. E-mail ulrich.forstermann{at}uni-mainz.de

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Abstract—Estrogens have been found to reduce the incidence of cardiovascular disease that has been ascribed in part to an increased expression and/or activity of the vasoprotective endothelial NO synthase (NOS III). Some reports have shown that the level of expression of this constitutive enzyme can be upregulated by estrogens. The current study investigates the molecular mechanism of the NOS III upregulation in human endothelial EA.hy 926 cells. Incubation of EA.hy 926 cells with 17ß-estradiol or the more stable 17-ethinyl estradiol enhanced NOS III mRNA and protein expression up to 1.8-fold, without changing the stability of the NOS III mRNA. There was no enhancement of NOS III mRNA after incubation of EA.hy 926 cells with testosterone, progesterone, or dihydrocortisol or when 17-ethinyl estradiol was added together with the estrogen antagonist RU58668, indicating a specific estrogenic response. Nuclear run-on assays indicated that the increase in NOS III mRNA is the result of an estrogen-induced enhancement of NOS III gene transcription. In transient transfection experiments using a 1.6 kb human NOS III promoter fragment (which contains no bona fide estrogen-responsive element, ERE), basal promoter activity was enhanced 1.7-fold by 17-ethinyl estradiol. In electrophoretic mobility shift assays, nuclear extracts from estrogen-incubated EA.hy 926 cells showed no enhanced binding activity either for the ERE-like motif in the human NOS III promoter or for transcription factor GATA. However, binding of transcription factor Sp1 (which is essential for the activity of the human NOS III promoter) was significantly enhanced by estrogens. These data suggest that the estrogen stimulation of the NOS III promoter could be mediated in part by an increased activity of transcription factor Sp1.

Key Words: 17-ethinyl estradiol • 17ß-estradiol • nitric oxide synthase • transcription factor Sp1

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Sex differences in the incidence of coronary heart disease are well established. The incidence of coronary heart disease is relatively low among premenopausal women and increases sharply with the occurrence of menopause.^{1 2} The beneficial effect of estrogens in replacement therapy of postmenopausal women^{3 4} and the increased risk of coronary heart disease in young bilateral oophorectomized women⁵ support a fundamental role for estrogens as cardioprotective agents (for review see Reference 6⁶ ). Part of this effect may result from an estrogen-mediated enhancement of the activity and/or expression of endothelial nitric oxide synthase (NOS III or eNOS). NO generated by this endothelial enzyme is involved in blood pressure regulation^{7 8} and exerts protective effects in the cardiovascular system such as inhibition of platelet aggregation and adhesion, prevention of leukocyte adhesion to the vascular wall, and reduction of vascular smooth muscle proliferation (for review see References 9 through 11^{9 10 11} ). Decreased endothelial NO production has been seen in pathophysiological conditions such as atherosclerosis, diabetes, and hypertension (for review see Reference 12¹² ).

In recent years, in vivo evidence has been presented for acute vascular effects of estrogens leading to improved endothelium-mediated vasodilatation and/or NO release.^{13 14 15} Other studies in which long-term treatment with estrogens was used either indicate improved vascular NOS activity or increased expression of endothelial NOS.^{16 17} In addition, there is more direct evidence indicating that estrogens can upregulate the expression of NOS III mRNA and protein. In guinea pigs, near-term pregnancy and treatment with estradiol (but not progesterone) increased calcium-dependent NOS activity in various tissues. Pregnancy and estradiol both also enhanced NOS III mRNA in skeletal muscle, suggesting an induction of the enzyme.^{18 19} An increase in NOS III mRNA has also been seen in the aortas of pregnant or estrogen-treated, but not progesterone- or testosterone-treated, rats.²⁰ It has been technically difficult to reproduce these in vivo or ex vivo findings in cell culture models, which is a prerequisite for studying the molecular mechanism or mechanisms. Hayashi et al²¹ and Hishikawa et al²² demonstrated an increase in NOS III protein in human umbilical vein and human aortic endothelial cells, respectively, but the mechanism of this upregulation remained unclear. A recent study on bovine endothelial cells claimed that 17-ethinyl estradiol did not enhance the expression of NOS III but that it increased the release of bioactive NO by inhibiting superoxide anion production.²³

In the current study we demonstrate that 17-ethinyl estradiol and 17ß-estradiol enhance NOS III mRNA and protein expression, whereas other steroid hormones do not. The increased NOS III expression results from an increased NOS III promoter activity with unchanged mRNA stability. Nuclear extracts from estrogen-treated EA.hy 926 cells display enhanced binding activity of the transcription factor Sp1 whose activity is essential for NOS III transcription.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Reagents
17-ethinyl estradiol, 17ß-estradiol, bovine serum albumin (fraction V), dihydrocortisol, polyvinylpyrrolidone, progesterone, testosterone, and actinomycin D were purchased from Sigma. The estrogen antagonist 11ß-[4-[5-[(4,4,5,5,5-pentafluropentyl)sulfonyl]pentyloxy]phenyl]-estra-1,3,5(10)-trien-3,17-ß-diol (RU58668) was a gift from Roussel-Uclaf, Paris, France. Isotopes were from New England Nuclear/DuPont. Restriction enzymes, polynucleotide kinase, Taq DNA polymerase, dNTPs, Ficoll (type 400), oligonucleotides, and oligo-dT primers were obtained from Pharmacia. Luciferase and ß-galactosidase assay systems were from Promega and Tropix/PE Applied Biosystems, respectively. Superscript reverse transcriptase was purchased from GIBCO/BRL. DNase I, DOTAP, RNase A, RNase T1, RNase T3, and T7 RNA polymerase were from Boehringer Mannheim.

Cell Culture and RNA Extraction
Human endothelial EA.hy 926²⁴ and ECV304 cells²⁵ (from ATCC) were grown in Dulbecco's modified Eagle's medium (DMEM; GIBCO) with 10% charcoal-stripped fetal bovine serum, 2 mmol/L L-glutamine, penicillin, and streptomycin. For NOS III mRNA analyses, EA.hy 926 cells were incubated for 18 hours with 17ß-estradiol (10 nmol/L), the more stable 17-ethinyl estradiol (0.1 to 100 nmol/L), dihydrocortisol (100 nmol/L), progesterone (100 nmol/L), or testosterone (100 nmol/L), respectively. In experiments with the estrogen antagonist RU58668, EA.hy 926 cells were preincubated for 30 minutes with the antagonist (1 µmol/L) before 17-ethinyl estradiol (100 nmol/L) was added. For determination of the stability of the NOS III mRNA, cells incubated for 18 hours with or without 17-ethinyl estradiol were incubated further in the presence of 10 µg/mL actinomycin D for the periods of time indicated. Total RNA was isolated from EA.hy 926 cells by guanidinium thiocyanate/phenol/chloroform extraction.²⁶

Cloning of a Human NOS III cDNA Fragment
Two microgramsof total RNA from EA.hy 926 cells was annealed with 0.5 µg of an oligo-dT primer (Pharmacia) and reverse-transcribed with Superscript reverse transcriptase (RT, GIBCO-BRL) according to the manufacturer's instructions. RT-generated cDNAs encoding for human NOS III were amplified using PCR. Oligonucleotide primers for NOS III were GACATTGAGAGCAAAGGGCTGC (sense) and CGGCTTGTCACCTCCTGG (antisense), corresponding to positions 3111 to 3133 and 3518 to 3536 of the human NOS III cDNA.²⁷ PCR was performed in a 100 µL volume containing 1x Taq polymerase buffer (Pharmacia), 0.2 mmol/L dNTPs, 1.5 mmol/L MgCl_2, 2 U Taq polymerase, 50 pmol oligonucleotide primers and RT products (1/10 of the RT reaction). After an initial denaturation step at 95°C for 5 minutes, 30 cycles were performed (1 minute at 95°C, 1 minute at 60°C, and 1 minute at 72°C) followed by a final 10-minute extension step at 72°C. The PCR products (30 µL) were analyzed on a 1.5% agarose gel containing 0.1 µg/mL ethidium bromide. The amplified cDNA fragments (426 bp) were cloned into the EcoRV site of pCR-Script (Stratagene) using the Sure Clone Ligation Kit (Pharmacia), generating the cDNA clone pCR-NOS III-Hu. DNA sequences of the cloned PCR product were determined from plasmid templates with the ^T7Sequencing Kit (Pharmacia) using the dideoxy chain termination method.

Cloning of the 5'-Flanking Region From the Human NOS III Gene
Chromosomal DNA was isolated from human EA.hy 926 cells by RNase/proteinase digestion and phenol/chloroform extraction as described previously.²⁸ This DNA was used for amplification of the 5'-flanking DNA of the human NOS III gene. The PCR was performed as described above using the following oligonucleotides as primers: TGATGCTGCCTGTCACCTTG (5') and TACTGTGCGTCCACTCTGCTGC (3'). The sequences were based on published 5'-flanking sequences of the human NOS III gene.²⁹ The amplified DNA fragment (1616 bp, positions -1596 to +20) was cloned into the Sma I site of pUC 18, generating pUC-NOS III-Hu-5'. The DNA sequence of the cloned PCR products was determined using the ^T7Sequencing Kit (Pharmacia). The human NOS III 5'-flanking sequence was then inserted into the luciferase gene–containing plasmid pGI2-Basic (Promega) generating pNOS III-Hu-Luc.

Preparation of Antisense RNA Probes
To generate radiolabeled antisense RNA probes for RNase protection assays, pCR-NOS III-Hu and pCR-ß-actin-Hu³⁰ were linearized with Sma I or BstEII, extracted with phenol/chloroform, and concentrated by ethanol precipitation. One half of a microgram of this DNA was in vitro transcribed using T3 RNA polymerase (Pharmacia) and -³² P-UTP. After a 1-hour incubation, the template DNA was degraded with DNase I for 45 minutes. The radiolabeled RNA was purified using NucTrap probe purification columns (Stratagene).

RNase Protection Analyses
RNase protection assays were performed with a mixture of RNase A and RNase T1 according to the manufacturer's instructions (Boehringer Mannheim). Briefly, following denaturation, 20 µg of total RNA (prepared as described above) was hybridized with 200 000 cpm–labeled NOS III antisense RNA probe and 20 000 cpm–labeled ß-actin antisense RNA probe at 51°C for 16 hours in a volume of 40 µL hybridization buffer (40 mmol/L PIPES, pH 6.7, 1 mmol/L EDTA, 400 mmol/L NaCl, 50% formamide). Then the mixture was digested by adding 300 µL digestion buffer (10 mmol/L Tris/HCl, pH 7.4, 300 mmol/L NaCl, and 5 mmol/L EDTA) containing 3.5 µg RNase A and 37.5 U RNase T1, for 30 minutes at 30°C. The reaction was stopped by proteinase K digestion (70 µg/sample in 70 µL of 7.15 mmol/L Tris/HCl, pH 7.4, 7.15 mmol/L EDTA, 2.85% SDS; 15 minutes at 37°C) and phenol extraction. The reaction products were concentrated by ethanol precipitation and analyzed by electrophoresis on denaturing urea-polyacrylamide gels (8 mol/L urea, 6% polyacrylamide). The electrophoresis buffer was 1x TBE (89 mmol/L Tris, pH 8.3, 89 mmol/L boric acid, and 20 mmol/L EDTA). The gels were electrophoresed for 1 to 2 hours, dried, and exposed to x-ray film. The protected RNA fragments of NOS III and ß-actin were 280 and 108 nt, respectively. Densitometric analyses were performed using a Phospho-Imager (Bio-Rad). The protected NOS III bands were normalized using the protected ß-actin bands (NOS III minus tRNA background)/(ß-actin minus tRNA background)x100.

Transient Transfection of ECV304 Cells and Luciferase/ß-Galactosidase Assays
ECV304 endothelial cells²⁵ were plated in 60-mm cell culture dishes at least 24 hours before transfection. The cells (approximately 80% confluent) were transfected by lipofection with DOTAP according the manufacturer's recommendations (Boehringer Mannheim) using 5 µg of pNOS III-Hu-Luc or pGI2-Basic (Promega), and 5 µg of pCH110 (Pharmacia; containing the ß-galactosidase gene under the control of the SV40 promoter/enhancer) for normalization. ECV304 cells were used instead of EA.hy 926 cells because transfection efficiency was poor with EA.hy 926 cells. The cells were washed with culture medium 9 hours after transfection and incubated with 17-ethinyl estradiol (10 or 100 nmol/L) 24 hours after transfection. Extracts (400 µL) were prepared 18 hours later using the reporter lysis buffer (Promega). The luciferase- and ß-galactosidase activities of the extracts were determined using the Luciferase Assay System (Promega) and the Galacto-Light System (Tropix) as described.³⁰ The light units (LU) of the luciferase assay were normalized by the LU of the ß-galactosidase assay after subtraction of extract background; (LU_Luc minus background)/(LU_ß-Gal minus background)x100.

Nuclear Run-On Assay and Hybridization of De Novo Radiolabeled RNA
Nuclear run-on assays were performed as described.³¹ Briefly, EA.hy 926 cells incubated with or without estrogens were scraped from the cell culture plates with a rubber "policeman," collected by centrifugation (500g, 4°C, 10 minutes) and washed twice with ice-cold phosphate-buffered saline. The cell pellet (1x10⁶ to 3x10⁶ cells) was resuspended in 1 mL NP40 lysis buffer (10 mmol/L Tris/HCl, pH 7.4, 10 mmol/L NaCl, 3 mmol/L MgCl_2, 0.5% [vol/vol] NP40), incubated on ice for 5 minutes, and centrifuged at 500g for 5 minutes. The supernatant was removed, and the nuclear pellet was washed twice with 2 mL NP40 lysis buffer. Then the nuclei were resuspended in 100 µL nuclei freezing buffer (50 mmol/L Tris/HCl, pH 8.3, 5 mmol/L MgCl₂, 0.1 mmol/L EDTA, 40% [vol/vol] glycerol) and stored frozen until used. For run-on transcription, the nuclei were mixed with 100 µL transcription buffer (10 mmol/L Tris/HCl, pH 8.0, 5 mmol/L MgCl_2, 300 mmol/L KCl, 0.5 mmol/L each of ATP, CTP, and GTP, and 80 µCi of -³²P-UTP (800 Ci per mmol, New England Nuclear). The transcription reaction was carried out for 45 minutes at 30°C. Then, 400 U DNase I (Boehringer Mannheim) was added, and the incubation continued for another 15 minutes at 30°C. After the addition of 80 µg proteinase K and 1% SDS (final concentration), the samples were incubated at 37°C for an additional 30 minutes. After a phenol/chloroform extraction, nucleic acids were collected by ethanol precipitation. The radiolabeled RNA was hybridized at 65°C for 48 hours to DNA immobilized on nitrocellulose filters as described previously.²⁸ The DNA consisted of linearized plasmids containing either the whole bovine NOS III cDNA (kindly provided by Dr William C. Sessa³² ) or the whole human ß-actin cDNA. Bacterial DNA (pCR-Script, Stratagene, alone) was used as a negative control. The reaction was carried out in 6x SSC (0.9 mol/L NaCl; 0.09 mol/L Na citrate, pH 7.0), 5x Denhardt's reagent (0.1 g Ficoll, type 500, Pharmacia; 0.1 g of polyvinylpyrrolidone, Sigma; 0.1 g bovine serum albumin, Fraction V, Sigma in 100 mL H₂O), and 0.1% (wt/vol) SDS. After hybridization, the filters were washed twice with 2x SSC and 0.1% (wt/vol) SDS at room temperature for 30 minutes followed by two washes with 0.5x SSC and 0.1% (wt/vol) SDS at 65°C for 1 hour. Filters were air-dried and exposed to x-ray film. Densitometric analyses were performed using a Phospho-Imager (Bio-Rad).

NOS III Protein Preparation and Western Blotting
Protein isolation and Western blotting was done as previously described.³³ Briefly, EA.hy 926 cells (untreated and incubated for 36 hours with 17-ethinyl estradiol, 10 or 100 nmol/L) were homogenized on ice. CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfate, final concentration 20 mmol/L) was added, and the homogenates were incubated for 30 minutes at 4°C. Then the homogenates were centrifuged at 100 000g for 1 hour, and the supernatants (combined cytosolic and solubilized particulate fraction) were separated by SDS–polyacrylamide gel electrophoresis (SDS/PAGE, 7.5% gels). The proteins were transferred to nitrocellulose membranes (Schleicher & Schuell) by electroblotting (Bio-Rad). All subsequent steps were performed at room temperature. Blots were blocked for 60 minutes with 3 g/100 mL bovine serum albumin and 50 mg/100 mL Tween-20 in TBS (10 mmol/L Tris/HCl, pH 7.4; 150 mmol/L NaCl). They were then incubated for 90 minutes at room temperature with a polyclonal anti–NOS III antibody (Transduction Laboratories) 1:500, and a monoclonal anti–ß-tubulin antibody (Sigma) 1:500, in TBS containing 0.5 g/100 mL gelatin and 50 mg/100 mL Tween-20. Blots were washed in TBS/gelatin/Tween, and immunoreactive proteins were visualized with NBT/X-phosphate (4-nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indolyl-phosphate) after a 60-minute incubation with appropriate secondary antibodies conjugated to alkaline phosphatase.³³ Densitometric analyses were performed with a Video-Imager (BioRad). NOS III protein bands were normalized using the respective ß-tubulin protein bands (NOS III minus background)/(ß-tubulin minus background)x100.

Electrophoretic Mobility Shift Assay
Binding activities of the estrogen receptor and the transcription factors Sp1 and GATA in the nuclei of estrogen-treated or untreated cells were determined by electrophoretic mobility shift assays using the Promega gel shift assay system. Nuclear proteins were extracted from EA.hy 926 cells by detergent lysis.³⁴ Ten micrograms of nuclear protein was incubated with 17.5 fmol ³²P-labeled double-stranded oligonucleotide containing either a bona fide estrogen receptor binding motif from the promoter of the Xenopus laevis vitellogenin A2 gene (5'-GTCAGGTCACAGTGACCTGATC-3', positions -329 to -308), an ERE-like sequence from the human NOS III promoter (5'-CTGCCTGTCACCTTGACCCTGAG-3'; positions -1591 to -1569²⁹), an Sp1-binding motif (5'-ATTCGATCGGGGCGGGGCGAGC-3'), or a GATA-binding motif (5'-CACTTGATAACAGAAAGTGATAACTCT-3'). Specificity of binding was determined by adding excess (1.75 pmol) unlabeled oligonucleotide. DNA-protein complexes were analyzed on 5% polyacrylamide gels (buffer 6.7 mmol/L Tris/HCl, pH 7.5; 3.3 mmol/L Na acetate; 1 mmol/L EDTA). The gels were dried and autoradiographed on x-ray film or a Phospho-Imager screen (Bio-Rad).

Statistical Analysis
Statistical differences between mean values were determined by ANOVA followed by the Fisher's protected least significant difference test for comparison of mean values.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Estrogens Enhance NOS III mRNA and Protein in EA.hy 926 Endothelial Cells
In human endothelial EA.hy 926 cells, 17-ethinyl estradiol enhanced NOS III mRNA in a concentration-dependent fashion (Fig 1a and 1b). Similar increases in NOS III mRNA levels were obtained when EA.hy 926 cells were incubated with 17ß-estradiol (Fig 1c). Incubation of EA.hy 926 cells with 17-ethinyl estradiol also enhanced NOS III protein expression (Fig 2).

View larger version (49K): [in this window] [in a new window]   Figure 1. RNase protection analysis using antisense RNA probes to human NOS III and ß-actin (for standardization) is shown. RNAs were prepared from untreated EA.hy 926 cells (Untr) and EA.hy 926 cells incubated with either 17-ethinyl estradiol (0.1 to 100 nmol/L) or 17ß-estradiol (10 nmol/L). Panel a shows an autoradiograph of a representative gel of a protection experiment using RNA from EA.hy 926 cells incubated with 0.1 to 100 nmol/L 17-ethinyl estradiol. T indicates tRNA control; N, NOS III antisense probe alone; A, ß-actin antisense probe alone; M, molecular weight markers (pGI2-Basic, Promega, restricted with HinfI). Panel b shows the densitometric analyses of five different gels when RNA from 17-ethinyl estradiol treated cells was used. Panel c shows the densitometric analyses of four different gels with RNA from 17ß-estradiol–treated EA.hy 926 cells. Bars represent mean±SEM. Asterisks indicate significant differences from untreated cells (*P<.05, ***P<.001).

View larger version (37K): [in this window] [in a new window]   Figure 2. Western blot analysis using a polyclonal anti–NOS III- and a monoclonal anti–ß-tubulin antibody (for normalization) is shown. Combined cytosolic and solubilized particulate protein fractions were prepared from untreated EA.hy 926 cells (Untr) and EA.hy 926 cells incubated with 17-ethinyl estradiol (10 or 100 nmol/L). M indicates molecular weight markers. The faint bands at about 100 kD are recognized by the anti–NOS III antibody and are likely to represent a proteolytic fragment of NOS III. Densitometric analyses of the video images of three Western blots indicated that NOS III protein increased to 169±16% of control (untreated cells) after 10 nmol/L 17-ethinyl estradiol and to 195±22% of control after 100 nmol/L 17-ethinyl estradiol.

In contrast to 17-ethinyl estradiol, incubation of EA.hy 926 cells with the steroids testosterone, progesterone, and dihydrocortisol did not result in any significant enhancement of NOS III mRNA expression (Fig 3). When 17-ethinyl estradiol (100 nmol/L) was added to EA.hy 926 cells preincubated with the estrogen antagonist RU58668 (1 µmol/L), there was no stimulation of NOS III mRNA expression (n=3).

View larger version (40K): [in this window] [in a new window]   Figure 3. RNase protection analysis using antisense RNA probes for human NOS III and ß-actin (for normalization) is shown. RNAs were prepared from untreated EA.hy 926 cells (Untr) and EA.hy 926 cells incubated with 17-ethinyl estradiol (17-Eest, 100 nmol/L), testosterone (Test, 100 nmol/L), progesterone (Prog, 100 nmol/L), or dihydrocortisol (Cort, 100 nmol/L). Bars represent mean±SEM of the densitometric analyses of five different gels. The asterisk indicates a significant difference from untreated cells (P<.05).

17-Ethinyl Estradiol Does Not Modify the Stability of NOS III mRNA in EA.hy 926 Endothelial Cells
When transcription was blocked with 10 µg/mL actinomycin D added to the incubation medium of EA.hy 926 cells and RNA was prepared from these cells 6 to 72 hours later, NOS III mRNA levels were found to decline over time (Fig 4). The approximate half-life of the mRNA was 48 hours. Pretreatment of EA.hy 926 cells with 17-ethinyl estradiol (10 or 100 nmol/L) enhanced the NOS III mRNA levels as shown in Fig 1, but did not change the stability of the mRNA (Fig 4).

View larger version (22K): [in this window] [in a new window]   Figure 4. Determination of the stability of the NOS III mRNA is shown. EA.hy 926 cells were preincubated without (Untr) or with 100 nmol/L 17-ethinyl estradiol for 18 hours (17- Eest). Then, actinomycin D (10 µg/mL) was added to the incubation mixture and the incubation was continued for 6, 12, 24, 48, or 72 hours. At those points in time, RNA was prepared and subjected to RNase protection analysis with antisense RNA probes to human NOS III and ß-actin (for normalization). Circles represent mean±SEM of the densitometric analyses of four different gels. The NOS III mRNA levels at the time of addition of actinomycin D (0 h) were set 100%.

17-Ethinyl Estradiol Enhances NOS III Gene Transcription and Increases the Activity of a NOS III Promoter Fragment Transfected into Human ECV304 Endothelial Cells
To analyze the effect of 17-ethinyl estradiol on the activity of the endogenous human NOS III promoter, EA.hy 926 cells were incubated with or without 10 or 100 nmol/L 17-ethinyl estradiol, and nuclei were prepared. Nuclear run-on analyses performed with these nuclei demonstrated that incubation of the cells with 17-ethinyl estradiol enhanced NOS III gene transcription 1.8-fold (Fig 5).

View larger version (31K): [in this window] [in a new window]   Figure 5. Nuclear run-on analyses are shown. Panel a shows an autoradiography of a representative filter with immobilized linearized plasmids containing either the full-length bovine NOS III cDNA (upper lane, NOS III), the full-length human ß-actin cDNA (middle lane, ß-Actin), or plasmid DNA alone (lower lane, pCR-Script). To this filter, radiolabeled RNA was hybridized that was obtained by in vitro transcription with nuclei from untreated EA.hy 926 cells (Untr) or EA.hy 926 cells incubated with 17-ethinyl estradiol (10 or 100 nmol/L) for 18 hours. Panel b shows densitometric analyses of three different filters. Bars represent mean±SEM. The asterisk indicates a significant difference from untreated cells (P<.05).

In an alternative approach, human endothelial ECV304 cells were transfected with pNOS III-Hu-Luc that contained a 1.6-kb fragment of the 5'-flanking sequence of the human NOS III gene cloned before a luciferase reporter gene. When the transfected cells were incubated for 18 hours with 10 or 100 nmol/L 17-ethinyl estradiol, promoter activity was increased up to 1.7-fold (Fig 6).

View larger version (47K): [in this window] [in a new window]   Figure 6. NOS III promoter activity is enhanced by 17-ethinyl estradiol. Human endothelial ECV304 cells were transfected with pGI2-Basic (containing a promoterless luciferase gene) or pNOS III-Hu-Luc (containing a 1.6-kb NOS III promoter fragment cloned before the luciferase gene). Twenty-four hours after transfection, endothelial cells were incubated without or with 17-ethinyl estradiol (10 or 100 nmol/L) for an additional 18 hours. Then cell extracts were prepared and luciferase activity was determined. Luciferase activity was normalized with ß-galactosidase activity as described in "Methods." Bars represent mean luciferase activity (±SEM) from four experiments. The asterisks indicate significant differences from pNOS III-Hu-Luc transfected but untreated cells (*P<.05, ***P<.001).

Effect of 17-Ethinyl Estradiol on the Binding of Nuclear Extracts to Transcription Factor-Binding DNA Motifs
The known sequence of the human NOS III promoter contains no bona fide ERE²⁹ but several ERE half sites. At positions -1585 to -1573, the human NOS III promoter contains the sequence 5'-CTGTCACCTTGACCC-3'. This sequence has the highest homology to the published ERE consensus sequence 5'-AGGTCANNNTGACCT-3'.^{35 36} Therefore, we performed electrophoretic mobility shift assays using oligonucleotides that contained either a bona fide ERE sequence from the Xenopus laevis vitellogenin A2 promoter (positions -329 to -308) or the ERE-like sequence of the human NOS III promoter. As shown in Fig 7a, 17-ethinyl estradiol enhanced the binding activity of the estrogen receptor to the bona fide ERE-containing oligonucleotide (complex 1e, n=3). In contrast there was no specific binding of the activated estrogen receptor to the oligonucleotide that contained the ERE-like sequence of the human NOS III promoter (n=3, data not shown).

View larger version (49K): [in this window] [in a new window]   Figure 7. Electrophoretic mobility shift assay using nuclear extracts from untreated EA.hy 926 cells or cells incubated with 17-ethinyl estradiol is shown. Extracts were incubated with radiolabeled double-stranded oligonucleotides containing either a consensus ERE from the promoter of the Xenopus laevis vitellogenin A2 gene (panel a) or a consensus binding motif for transcription factor Sp1 (panel b). Samples were analyzed on native polyacrylamide gels. The oligonucleotides were incubated either with nuclear extracts from untreated endothelial cells (Untr) or with nuclear extracts from endothelial cells incubated with 17-ethinyl estradiol (10 or 100 nmol/L). The fourth lane shows competition experiments with the addition of a 100-fold excess of unlabeled oligonucleotides. Complexes 1e, 1s, and 2s are likely to result from specific protein-DNA interactions because their formation was prevented by unlabeled oligonucleotide. The gels shown are representative of three or four gels yielding similar results.

Because the enhancement of NOS III promoter activity by 17-ethinyl estradiol was unlikely to represent a direct ERE-estrogen receptor interaction, we tested the effect of 17-ethinyl estradiol on the binding activity of other transcription factors known to be important for the activity of the human NOS III promoter. Recent data by three independent groups have demonstrated an essential role of transcription factor Sp1.^{37 38 39} As shown in Fig 7b, nuclear extracts from 17-ethinyl estradiol–incubated EA.hy 926 cells demonstrated enhanced Sp1 binding activities (n=4). A mutation of the putative binding site for transcription factor GATA on the human NO III promoter has been shown to reduce transcription by about 30%.³⁷ However, in our electrophoretic mobility shift assays, nuclear extracts from estrogen-treated endothelial cells showed unchanged binding activity to oligonucleotides that contained the GATA consensus sequence (n=4, data not shown).

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
The current work used a cell culture model to elucidate the molecular mechanism or mechanisms of the estrogen-stimulated increases in NOS III mRNA and/or protein expression previously seen under in vivo^{18 19 20} and in vitro conditions.^{21 22} The upregulation of the NOS III mRNA demonstrated in EA.hy 926 endothelial cells was an estrogen-specific effect; other steroid hormones such as testosterone, progesterone, and dihydrocortisol did not change NOS III expression (Fig 3). The stimulatory effect of estrogens seems to be purely transcriptional; mRNA stability remained unchanged after incubation of EA.hy 926 endothelial cells with 17-ethinyl estradiol (Fig 4). The estrogen concentrations required for this effect were in the physiological range. They were slightly higher than those found in the plasma of nonpregnant females but lower than those found in human plasma during pregnancy.

The human NOS III promoter contains consensus sequences for the binding of transcription factors Sp1, GATA, AP-1, NF-1, and NF-B; as well as heavy metal-, acute-phase response–, shear stress–, and sterol-regulatory cis elements. The known promoter sequence^{29 40 41 42} contains no TATA box and no bona fide ERE. Functional relevance has only been demonstrated for a few of these binding sites. Deletion and mutation analyses revealed an essential role of the Sp1 binding site at position -103 for promoter activity.^{37 38 39} Also mutation of the consensus GATA site at position -230 reduced human NOS III promoter activity by about 30%.³⁷ The modest upregulation of NOS III mRNA by incubation of bovine aortic endothelial cells with transforming growth factor-ß1 has been reported to be a result of enhanced promoter activity through increased binding of the transcription factor NF-1 to its responsive element in the bovine NOS III promoter.⁴³

Reporter gene assays with constructs containing 1.6 kb of the 5'-flanking sequence of the human NOS III promoter showed a significant basal activity of this human promoter in endothelial cells (Fig 6). In our transfection experiments, the activity of this NOS III promoter fragment was enhanced 1.7-fold by 17-ethinyl estradiol (Figs 6), thus explaining the total increase in NOS III mRNA seen in endothelial cells (Fig 1).

Incubation of EA.hy 926 cells with 17-ethinyl estradiol enhanced the binding activity of nuclear extracts to a bona fide ERE. However, when the sequence from the human NOS III promoter that is closest to the consensus ERE was used,^{35 36} no binding of nuclear proteins occurred. Therefore, it seems that the estrogen-induced enhancement of NOS III promoter activity is not a direct result of an interaction of the activated estrogen receptor with the NOS III promoter. Increased NOS III transcription in EA.hy 926 cells was paralleled by an increased binding activity transcription factor Sp1 (Fig 7b), whereas binding activity of transcription factor GATA remained unchanged. Therefore, it is tempting to speculate that in the absence of a functional ERE, the estrogen-induced increase in promoter activity is the result of an enhanced binding activity of the essential transcription factor Sp1.

Recently, Arnal et al have reported that estrogen did not change NOS III expression in human umbilical vein endothelial cells, but rather that it reduced the superoxide production of the endothelial cells, thus allowing for more active NO to be released.²³ The enzyme or enzymes responsible for superoxide production and potentially regulated by estrogens have not been identified. Our cell model does show an increase in NOS III mRNA and protein in response to estrogens and therefore mimics the in vivo situation described by other groups.^{18 19 20} The increase in NOS III expression demonstrated in the current study may seem relatively small, but it is likely to be of significant physiological relevance. In fact, a greater effect could be physiologically critical given the regulatory effects of NOS III on blood pressure and platelet function (for review see References 9 and 12^{9 12} ). In addition, recent studies have indicated a variety of cardiovascular protective functions of endothelial-derived NO that goes beyond vasodilatation and inhibition of platelet aggregation. These include the reduced expression of chemokines and adhesion molecules as well as the inhibition of smooth muscle proliferation in the vascular wall (for review see References 9 through 11^{9 10 11} ). In this context, even moderate increases in endothelial NOS expression may bear significant protective effects against cardiovascular disease, and this mechanism could account for at least part of the cardiovascular protective effects of estrogens.⁶

	Selected Abbreviations and Acronyms

 

ERE = estrogen-responsive element GATA = transcription factor GATA NO = nitric oxide NOS = nitric oxide synthase NOS III = endothelial-type NOS PCR = polymerase chain reaction RU58668 = 11ß-[4-[5-[(4,4,5,5,5-pentafluropentyl) sulfonyl]pentyloxy]phenyl]-estra-1,3,5(10)-trien-3,17-ß-diol Sp1 = transcription factor Sp1

	Acknowledgments

 
This work was supported by Grants Fo 144/3-2 and Fo 144/4-1 from the Deutsche Forschungsgemeinschaft, Bonn, Germany, and a Grant from the Ministry of the Environment of the State of Rhineland-Palatinate, Germany. We thank Bärbel Hering for expert help with the cell culture.

Received June 20, 1997; first decision August 12, 1997; accepted August 27, 1997.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Wenger NK, Speroff L, Packard B. Cardiovascular health and disease in women. N Engl J Med. 1993;329:247–256.[Free Full Text]

2. Barret-Connor E, Bush TL. Estrogen and coronary heart disease in women. JAMA. 1991;265:1861–1867.[Abstract/Free Full Text]

3. Grady D, Rubin SM, Petitti DB, Fox CS, Black D, Ettinger B, Ernster VL, Cummings SR. Hormone therapy to prevent disease and prolong life in postmenopausal women. Ann Intern Med. 1992;117:1016–1037.

4. Stampfer MJ, Colditz GA, Willett WC, Manson JE, Rosner B, Speizer FE, Hennekens CH. Postmenopausal estrogen therapy and cardiovascular disease: ten year follow-up from the nurse's health study. N Engl J Med. 1991;325:756–762.[Abstract]

5. Stampfer MJ, Colditz GA, Willet WC. Menopause and heart disease: a review. Ann N Y Acad Sci. 1989;592:193–203.[Medline] [Order article via Infotrieve]

6. Farhat MY, Lavigne MC, Ramwell PW. The vascular protective effects of estrogen. FASEB J. 1996;10:615–624.[Abstract]

7. Rees DD, Palmer RM, Moncada S. Role of endothelium-derived nitric oxide in the regulation of blood pressure. Proc Natl Acad Sci U S A. 1989;86:3375–3378.[Abstract/Free Full Text]

8. Huang PL, Huang ZH, Mashimo H, Bloch KD, Moskowitz MA, Bevan JA, Fishman MC. Hypertension in mice lacking the gene for endothelial nitric oxide synthase. Nature. 1995;377:239–242.[Medline] [Order article via Infotrieve]

9. Förstermann U, Closs EI, Pollock JS, Nakane M, Schwarz P, Gath I, Kleinert H. Nitric oxide synthase isozymes: characterization, molecular cloning and functions. Hypertension. 1994;23:1121–1131.[Abstract/Free Full Text]

10. Moncada S, Higgs EA. Molecular mechanisms and therapeutic strategies related to nitric oxide. FASEB J. 1995;9:1319–1330.[Abstract]

11. Gibbons GH, Dzau VJ. Molecular therapies for vascular diseases. Science. 1996;272:689–693.[Abstract]

12. Moncada S, Higgs A. Mechanisms of disease: the L-arginine nitric oxide pathway. N Engl J Med. 1993;329:2002–2012.[Free Full Text]

13. Gilligan DM, Quyyumi AA, Cannon RO, Johnson GB, Schenke WH. Effects of physiological levels of estrogen on coronary vasomotor function in postmenopausal women. Circulation. 1994;89:2545–2551.[Abstract/Free Full Text]

14. Gilligan DM, Badar DM, Panza JA, Quyyumi AA, Cannon RO. Acute vascular effects of estrogen in postmenopausal women. Circulation. 1994;90:786–791.[Abstract/Free Full Text]

15. Keaney JF, Shwaery GT, Xu AM, Nicolosi RJ, Loscalzo J, Foxall TL, Vita JA. 17 Beta-estradiol preserves endothelial vasodilator function and limits low-density lipoprotein oxidation in hypercholesterolemic swine. Circulation. 1994;89:2251–2259.[Abstract/Free Full Text]

16. Brosnihan KB, Moriguchi A, Nakamoto H, Dean RH, Ganten D, Ferrario CM. Estrogen augments the contribution of nitric oxide to blood pressure regulation in transgenic hypertensive rats expressing the mouse Ren-2 gene. Am J Hypertens. 1994;7:576–582.[Medline] [Order article via Infotrieve]

17. Lieberman EH, Gerhard MD, Uehata A, Walsh BW, Selwyn AP, Ganz P, Yeung AC, Creager MA. Estrogen improves endothelium-dependent, flow-mediated vasodilation in postmenopausal women. Ann Intern Med. 1994;121:936–941.[Abstract/Free Full Text]

18. Weiner CP, Lizasoain I, Baylis SA, Knowles RG, Charles IG, Moncada S. Induction of calcium-dependent nitric oxide synthases by sex hormones. Proc Natl Acad Sci U S A. 1994;91:5212–5216.[Abstract/Free Full Text]

19. Weiner CP, Knowles RG, Moncada S. Induction of nitric oxide synthases early in pregnancy. Am J Obstet Gynecol. 1994;171:838–843.[Medline] [Order article via Infotrieve]

20. Goetz RM, Morano I, Calovini T, Studer R, Holtz J. Increased expression of endothelial constitutive nitric oxide synthase in rat aorta during pregnancy. Biochem Biophys Res Commun. 1994;205:905–910.[Medline] [Order article via Infotrieve]

21. Hayashi T, Yamada K, Esaki T, Kuzuya M, Satake S, Ishikawa T, Hidaka H, Iguchi A. Estrogen increases endothelial nitric oxide by a receptor- mediated system. Biochem Biophys Res Commun. 1995;214:847–855.[Medline] [Order article via Infotrieve]

22. Hishikawa K, Nakaki T, Marumo T, Suzuki H, Kato R, Saruta T. Up-regulation of nitric oxide synthase by estradiol in human aortic endothelial cells. FEBS Lett. 1995;360:291–293.[Medline] [Order article via Infotrieve]

23. Arnal JF, Clamens S, Pechet C, Negre-Salvayre A, Allera C, Girolami JP, Salvayre R, Bayard F. Ethinyl estradiol does not enhance the expression of nitric oxide synthase in bovine endothelial cells but increases the release of bioactive nitric oxide by inhibiting superoxide anion production. Proc Natl Acad Sci U S A. 1996;93:4108–4113.[Abstract/Free Full Text]

24. Edgell CJ, McDonald CC, Graham JB. Permanent cell line expressing human factor VIII-related antigen established by hybridization. Proc Natl Acad Sci U S A. 1983;80:3734–3737.[Abstract/Free Full Text]

25. Takahashi K, Sawasaki Y, Hata J, Mukai K, Goto T. Spontaneous transformation and immortalization of human endothelial cells. In Vitro Cell Dev Biol. 1990;26:265–274.[Medline] [Order article via Infotrieve]

26. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–159.[Medline] [Order article via Infotrieve]

27. Marsden PA, Schappert KT, Chen HS, Flowers M, Sundell CL, Wilcox JN, Lamas S, Michel T. Molecular cloning and characterization of human endothelial nitric oxide synthase. FEBS Lett. 1992;307:287–293.[Medline] [Order article via Infotrieve]

28. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. Plainview, NY: Cold Spring Harbor Laboratory Press; 1989.

29. Marsden PA, Heng HHQ, Scherer SW, Stewart RJ, Hall AV, Shi XM, Tsui LC, Schappert KT. Structure and chromosomal localization of the human constitutive endothelial nitric oxide synthase gene. J Biol Chem. 1993;268:17478–17488.[Abstract/Free Full Text]

30. Kleinert H, Euchenhofer C, Ihrig-Biedert I, Förstermann U. Glucocorticoids inhibit the induction of nitric oxide synthase II by down-regulating cytokine-induced activity of transcription factor nuclear factor-B. Mol Pharmacol. 1996;49:15–21.[Abstract]

31. Greenberg ME, Ziff EB. Stimulation of 3T3 cells induces transcription of the c-fos proto-oncogene. Nature. 1984;311:433–438.[Medline] [Order article via Infotrieve]

32. Sessa WC, Harrison JK, Barber CM, Zeng D, Durieux ME, D'Angelo DD, Lynch KR, Peach MJ. Molecular cloning and expression of a cDNA encoding endothelial cell nitric oxide synthase. J Biol Chem. 1992;267:15274–15276.[Abstract/Free Full Text]

33. Wallerath T, Gath I, Aulitzky WE, Pollock JS, Kleinert H, Förstermann U. Identification of the NO synthase isoforms expressed in human neutrophil granulocytes, megakaryocytes and platelets. Thromb Haemost. 1997;77:163–167.[Medline] [Order article via Infotrieve]

34. Osborn L, Kunkel S, Nabel GJ. Tumor necrosis factor alpha and interleukin 1 stimulate the human immunodeficiency virus enhancer by activation of the nuclear factor kappa B. Proc Natl Acad Sci U S A. 1989;86:2336–2340.[Abstract/Free Full Text]

35. Lucas PC, Granner DK. Hormone response domains in gene transcription. Annu Rev Biochem. 1992;61:1131–1173.[Medline] [Order article via Infotrieve]

36. Beato M. Gene regulation by steroid hormones. Cell. 1989;56:335–344.[Medline] [Order article via Infotrieve]

37. Zhang R, Min W, Sessa WC. Functional analysis of the human endothelial nitric oxide synthase promoter: SP1 and GATA factors are necessary for basal transcription in endothelial cells. J Biol Chem. 1995;270:15320–15326.[Abstract/Free Full Text]

38. Wariishi S, Miyahara K, Toda K, Ogoshi S, Doi Y, Ohnishi S, Mitsui Y, Yui Y, Kawai C, Shizuta Y. A SP1 binding site in the GC-rich region is essential for a core promoter activity of the human endothelial nitric oxide synthase gene. Biochem Biophys Res Commun. 1995;216:729–735.[Medline] [Order article via Infotrieve]

39. Tang JL, Zembowicz A, Xu XM, Wu KK. Role of Sp1 in transcriptional activation of human nitric oxide synthase type III gene. Biochem Biophys Res Commun. 1995;213:673–680.[Medline] [Order article via Infotrieve]

40. Robinson LJ, Weremowicz S, Morton CC, Michel T. Isolation and chromosomal localization of the human endothelial nitric oxide synthase (NOS3) gene. Genomics. 1994;19:350–357.[Medline] [Order article via Infotrieve]

41. Nadaud S, Bonnardeaux A, Lathrop M, Soubrier F. Gene structure, polymorphism and mapping of the human endothelial nitric oxide synthase gene. Biochem Biophys Res Commun. 1994;198:1027–1033.[Medline] [Order article via Infotrieve]

42. Miyahara K, Kawamoto T, Sase K, Yui Y, Toda K, Yang LX, Hattori R, Aoyama T, Yamamoto Y, Doi Y, Ogoshi S, Hashimoto K, Kawai C, Sasayama S, Shizuta Y. Cloning and structural characterization of the human endothelial nitric-oxide-synthase gene. Eur J Biochem. 1994;223:719–726.[Medline] [Order article via Infotrieve]

43. Inoue N, Venema RC, Sayegh HS, Ohara Y, Murphy TJ, Harrison DG. Molecular regulation of the bovine endothelial cell nitric oxide synthase by transforming growth factor-beta(1). Arterioscler Thromb Vasc Biol. 1995;15:1255–1261.[Abstract/Free Full Text]

This article has been cited by other articles:

				J. Zhou, Y. Zhu, M. Cheng, D. Dinesh, T. Thorne, K. K. Poh, D. Liu, C. Botros, Y. L. Tang, N. Reisdorph, et al. Regulation of Vascular Contractility and Blood Pressure by the E2F2 Transcription Factor Circulation, September 29, 2009; 120(13): 1213 - 1221. [Abstract] [Full Text] [PDF]

				J.-L. Balligand, O. Feron, and C. Dessy eNOS Activation by Physical Forces: From Short-Term Regulation of Contraction to Chronic Remodeling of Cardiovascular Tissues Physiol Rev, April 1, 2009; 89(2): 481 - 534. [Abstract] [Full Text] [PDF]

				M. Zerr-Fouineau, M. Jourdain, C. Boesch, M. Hecker, C. Bronner, and V. B. Schini-Kerth Certain Progestins Prevent the Enhancing Effect of 17{beta}-Estradiol on NO-Mediated Inhibition of Platelet Aggregation by Endothelial Cells Arterioscler Thromb Vasc Biol, April 1, 2009; 29(4): 586 - 593. [Abstract] [Full Text] [PDF]

				S. K. Nishiyama, D. W. Wray, and R. S. Richardson Sex and limb-specific ischemic reperfusion and vascular reactivity Am J Physiol Heart Circ Physiol, September 1, 2008; 295(3): H1100 - H1108. [Abstract] [Full Text] [PDF]

				V. M. Miller and S. P. Duckles Vascular Actions of Estrogens: Functional Implications Pharmacol. Rev., June 1, 2008; 60(2): 210 - 241. [Abstract] [Full Text] [PDF]

				P. Wohlfart, H. Xu, A. Endlich, A. Habermeier, E. I. Closs, T. Hubschle, C. Mang, H. Strobel, T. Suzuki, H. Kleinert, et al. Antiatherosclerotic Effects of Small-Molecular-Weight Compounds Enhancing Endothelial Nitric-Oxide Synthase (eNOS) Expression and Preventing eNOS Uncoupling J. Pharmacol. Exp. Ther., May 1, 2008; 325(2): 370 - 379. [Abstract] [Full Text] [PDF]

				C. Pinna, A. Cignarella, P. Sanvito, V. Pelosi, and C. Bolego Prolonged Ovarian Hormone Deprivation Impairs the Protective Vascular Actions of Estrogen Receptor {alpha}Agonists Hypertension, April 1, 2008; 51(4): 1210 - 1217. [Abstract] [Full Text] [PDF]

				J. Li, A. Wilson, R. Kuruba, Q. Zhang, X. Gao, F. He, L.-M. Zhang, B. R. Pitt, W. Xie, and S. Li FXR-mediated regulation of eNOS expression in vascular endothelial cells Cardiovasc Res, January 1, 2008; 77(1): 169 - 177. [Abstract] [Full Text] [PDF]

				D. Z. I. Cherney, J. W. Scholey, D. C. Cattran, A. K. Kang, J. Zimpelmann, C. Kennedy, V. Lai, K. D. Burns, and J. A. Miller The effect of oral contraceptives on the nitric oxide system and renal function Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1539 - F1544. [Abstract] [Full Text] [PDF]

				A. H. Eid, K. Maiti, S. Mitra, M. A. Chotani, S. Flavahan, S. R. Bailey, C. S. Thompson-Torgerson, and N. A. Flavahan Estrogen increases smooth muscle expression of {alpha}2C-adrenoceptors and cold-induced constriction of cutaneous arteries Am J Physiol Heart Circ Physiol, September 1, 2007; 293(3): H1955 - H1961. [Abstract] [Full Text] [PDF]

				B. N. Torgrimson, J. R. Meendering, P. F. Kaplan, and C. T. Minson Endothelial function across an oral contraceptive cycle in women using levonorgestrel and ethinyl estradiol Am J Physiol Heart Circ Physiol, June 1, 2007; 292(6): H2874 - H2880. [Abstract] [Full Text] [PDF]

				A. M. Corbacho, J. P. Eiserich, L. A. Zuniga, G. Valacchi, and A. C. Villablanca Compromised Aortic Vasoreactivity in Male Estrogen Receptor-{alpha}-Deficient Mice during Acute Lipopolysaccharide-Induced Inflammation Endocrinology, March 1, 2007; 148(3): 1403 - 1411. [Abstract] [Full Text] [PDF]

				F. Di Lisa A Female Way to Protect the Heart: Say NO to Calcium Circ. Res., February 17, 2006; 98(3): 298 - 300. [Full Text] [PDF]

				D. Cevik, O. Unay, F. Durmusoglu, T. Yurdun, and A S. Bilsel Plasma markers of NO synthase activity in women after ovarian hyperstimulation: influence of estradiol on ADMA Vascular Medicine, February 1, 2006; 11(1): 7 - 12. [Abstract] [PDF]

				T. P. Burris and V. Krishnan Estrogen: A Mitochrondrial Energizer That Keeps on Going Mol. Pharmacol., October 1, 2005; 68(4): 956 - 958. [Abstract] [Full Text] [PDF]

				C. J. Abularrage, A. N. Sidawy, G. Aidinian, N. Singh, J. M. Weiswasser, and S. Arora Evaluation of Macrocirculatory Endothelium-Dependent and Endothelium-Independent Vasoreactivity in Vascular Disease Perspectives in Vascular Surgery and Endovascular Therapy, September 1, 2005; 17(3): 245 - 253. [Abstract] [PDF]

				R. P. Brandes, I. Fleming, and R. Busse Endothelial aging Cardiovasc Res, May 1, 2005; 66(2): 286 - 294. [Abstract] [Full Text] [PDF]

				L. L. Gibson, L. Hahner, S. Osborne-Lawrence, Z. German, K. K. Wu, K. L. Chambliss, and P. W. Shaul Molecular Basis of Estrogen-Induced Cyclooxygenase Type 1 Upregulation in Endothelial Cells Circ. Res., March 18, 2005; 96(5): 518 - 525. [Abstract] [Full Text] [PDF]

				T. Simoncini, P. Mannella, L. Fornari, A. Caruso, M. Y. Willis, S. Garibaldi, C. Baldacci, and A. R. Genazzani Differential Signal Transduction of Progesterone and Medroxyprogesterone Acetate in Human Endothelial Cells Endocrinology, December 1, 2004; 145(12): 5745 - 5756. [Abstract] [Full Text] [PDF]

				T. Simoncini, P. Mannella, L. Fornari, A. Caruso, G. Varone, S. Garibaldi, and A. R. Genazzani Tibolone Activates Nitric Oxide Synthesis in Human Endothelial Cells J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4594 - 4600. [Abstract] [Full Text] [PDF]

				V. Bourdeau, J. Deschenes, R. Metivier, Y. Nagai, D. Nguyen, N. Bretschneider, F. Gannon, J. H. White, and S. Mader Genome-Wide Identification of High-Affinity Estrogen Response Elements in Human and Mouse Mol. Endocrinol., June 1, 2004; 18(6): 1411 - 1427. [Abstract] [Full Text] [PDF]

				P. Neumann, N. Gertzberg, and A. Johnson TNF-{alpha} induces a decrease in eNOS promoter activity Am J Physiol Lung Cell Mol Physiol, February 1, 2004; 286(2): L452 - L459. [Abstract] [Full Text] [PDF]

				D. Sumi and L. J. Ignarro Estrogen-related receptor {alpha}1 up-regulates endothelial nitric oxide synthase expression PNAS, November 25, 2003; 100(24): 14451 - 14456. [Abstract] [Full Text] [PDF]

				J. M. Muller-Delp, D. B. Lubahn, K. E. Nichol, B. J. Philips, E. M. Price, E. M. Curran, and M. H. Laughlin Regulation of nitric oxide-dependent vasodilation in coronary arteries of estrogen receptor-{alpha}-deficient mice Am J Physiol Heart Circ Physiol, November 1, 2003; 285(5): H2150 - H2157. [Abstract] [Full Text] [PDF]

				T. Simoncini, P. Mannella, L. Fornari, G. Varone, A. Caruso, and A. R. Genazzani Dehydroepiandrosterone Modulates Endothelial Nitric Oxide Synthesis Via Direct Genomic and Nongenomic Mechanisms Endocrinology, August 1, 2003; 144(8): 3449 - 3455. [Abstract] [Full Text] [PDF]

				M. H. Laughlin, W. V. Welshons, M. Sturek, J. W. E. Rush, J. R. Turk, J. A. Taylor, B. M. Judy, K. K. Henderson, and V. K. Ganjam Gender, exercise training, and eNOS expression in porcine skeletal muscle arteries J Appl Physiol, July 1, 2003; 95(1): 250 - 264. [Abstract] [Full Text] [PDF]

				C. R. Rosenfeld, C. Chen, T. Roy, and X.-T. Liu Estrogen Selectively Up-Regulates eNOS and nNOS in Reproductive Arteries By Transcriptional Mechanisms Reproductive Sciences, May 1, 2003; 10(4): 205 - 215. [Abstract] [PDF]

				T. Wallerath, D. Poleo, H. Li, and U. Forstermann Red wine increases the expression of human endothelial nitric oxide synthase: a mechanism that may contribute to its beneficial cardiovascular effects J. Am. Coll. Cardiol., February 5, 2003; 41(3): 471 - 478. [Abstract] [Full Text] [PDF]

				H. Harada, K. P. Pavlick, I. N. Hines, D. J. Lefer, J. M. Hoffman, S. Bharwani, R. E. Wolf, and M. B. Grisham Sexual dimorphism in reduced-size liver ischemia and reperfusion injury in mice: Role of endothelial cell nitric oxide synthase PNAS, January 21, 2003; 100(2): 739 - 744. [Abstract] [Full Text] [PDF]

				I. Fleming and R. Busse Molecular mechanisms involved in the regulation of the endothelial nitric oxide synthase Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2003; 284(1): R1 - R12. [Abstract] [Full Text] [PDF]

				F. S. Gragasin, Y. Xu, I. A. Arenas, N. Kainth, and S. T. Davidge Estrogen Reduces Angiotensin II-Induced Nitric Oxide Synthase and NAD(P)H Oxidase Expression in Endothelial Cells Arterioscler Thromb Vasc Biol, January 1, 2003; 23(1): 38 - 44. [Abstract] [Full Text] [PDF]

				K. L. Chambliss and P. W. Shaul Estrogen Modulation of Endothelial Nitric Oxide Synthase Endocr. Rev., October 1, 2002; 23(5): 665 - 686. [Abstract] [Full Text] [PDF]

				T. Wallerath, G. Deckert, T. Ternes, H. Anderson, H. Li, K. Witte, and U. Forstermann Resveratrol, a Polyphenolic Phytoalexin Present in Red Wine, Enhances Expression and Activity of Endothelial Nitric Oxide Synthase Circulation, September 24, 2002; 106(13): 1652 - 1658. [Abstract] [Full Text] [PDF]

				J. L. Mershon, R. S. Baker, and K. E. Clark Estrogen increases iNOS expression in the ovine coronary artery Am J Physiol Heart Circ Physiol, September 1, 2002; 283(3): H1169 - H1180. [Abstract] [Full Text] [PDF]

				A.C. Duncan, J.R. Petrie, M.J. Brosnan, A.M. Devlin, R.A. Bass, D.S. Charnock-Jones, J.M.C. Connell, A.F. Dominiczak, and M.A. Lumsden Is estradiol cardioprotection a nitric oxide-mediated effect? Hum. Reprod., July 1, 2002; 17(7): 1918 - 1924. [Abstract] [Full Text] [PDF]

				S. Earley and T. C. Resta Estradiol attenuates hypoxia-induced pulmonary endothelin-1 gene expression Am J Physiol Lung Cell Mol Physiol, July 1, 2002; 283(1): L86 - L93. [Abstract] [Full Text] [PDF]

				T. Simoncini, G. Varone, L. Fornari, P. Mannella, M. Luisi, F. Labrie, and A. R. Genazzani Genomic and Nongenomic Mechanisms of Nitric Oxide Synthesis Induction in Human Endothelial Cells by a Fourth-Generation Selective Estrogen Receptor Modulator Endocrinology, June 1, 2002; 143(6): 2052 - 2061. [Abstract] [Full Text] [PDF]

				A. M. McNeill, C. Zhang, F. Z. Stanczyk, S. P. Duckles, and D. N. Krause Estrogen Increases Endothelial Nitric Oxide Synthase via Estrogen Receptors in Rat Cerebral Blood Vessels: Effect Preserved After Concurrent Treatment With Medroxyprogesterone Acetate or Progesterone Stroke, June 1, 2002; 33(6): 1685 - 1691. [Abstract] [Full Text] [PDF]

				X. Wang and A. A. Abdel-Rahman Estrogen modulation of eNOS activity and its association with caveolin-3 and calmodulin in rat hearts Am J Physiol Heart Circ Physiol, June 1, 2002; 282(6): H2309 - H2315. [Abstract] [Full Text] [PDF]

				F. Gobeil Jr, I. Dumont, A. M. Marrache, A. Vazquez-Tello, S. G. Bernier, D. Abran, X. Hou, M. H. Beauchamp, C. Quiniou, A. Bouayad, et al. Regulation of eNOS Expression in Brain Endothelial Cells by Perinuclear EP3 Receptors Circ. Res., April 5, 2002; 90(6): 682 - 689. [Abstract] [Full Text] [PDF]

				Y. Chu, D. D. Heistad, K. L. Knudtson, K. G. Lamping, and F. M. Faraci Quantification of mRNA for Endothelial NO Synthase in Mouse Blood Vessels by Real-Time Polymerase Chain Reaction Arterioscler Thromb Vasc Biol, April 1, 2002; 22(4): 611 - 616. [Abstract] [Full Text] [PDF]

				A. C. Villablanca, K. A. Lewis, and J. C. Rutledge Time- and dose-dependent differential upregulation of three genes by 17beta -estradiol in endothelial cells J Appl Physiol, March 1, 2002; 92(3): 1064 - 1073. [Abstract] [Full Text] [PDF]

				C. K. Roberts, N. D. Vaziri, and R. J. Barnard Protective effects of estrogen on gender-specific development of diet-induced hypertension J Appl Physiol, November 1, 2001; 91(5): 2005 - 2009. [Abstract] [Full Text] [PDF]

				G. G. Geary, A. M. McNeill, J. A. Ospina, D. N. Krause, K. S. Korach, and S. P. Duckles Genome and Hormones: Gender Differences in Physiology: Selected Contribution: Cerebrovascular NOS and cyclooxygenase are unaffected by estrogen in mice lacking estrogen receptor-alpha J Appl Physiol, November 1, 2001; 91(5): 2391 - 2399. [Abstract] [Full Text] [PDF]

				M. R. I. Williams, R. A. Westerman, B. A. Kingwell, J. Paige, P. A. Blombery, K. Sudhir, and P. A. Komesaroff Variations in Endothelial Function and Arterial Compliance during the Menstrual Cycle J. Clin. Endocrinol. Metab., November 1, 2001; 86(11): 5389 - 5395. [Abstract] [Full Text] [PDF]

				B. C Kone Molecular biology of natriuretic peptides and nitric oxide synthases Cardiovasc Res, August 15, 2001; 51(3): 429 - 441. [Abstract] [Full Text] [PDF]

				W. Tschugguel, F. Stonek, Z. Zhegu, W. Dietrich, C. Schneeberger, T. Stimpfl, T. Waldhoer, W. Vycudilik, and J. C. Huber Estrogen Increases Endothelial Carbon Monoxide, Heme Oxygenase 2, and Carbon Monoxide-Derived cGMP by a Receptor-Mediated System J. Clin. Endocrinol. Metab., August 1, 2001; 86(8): 3833 - 3839. [Abstract] [Full Text] [PDF]

				N. N. Chan, R. J. MacAllister, H. M. Colhoun, P. Vallance, and A. D. Hingorani Changes in Endothelium-Dependent Vasodilatation and {{alpha}}-Adrenergic Responses in Resistance Vessels during the Menstrual Cycle in Healthy Women J. Clin. Endocrinol. Metab., June 1, 2001; 86(6): 2499 - 2504. [Abstract] [Full Text] [PDF]

				U. Hink, H. Li, H. Mollnau, M. Oelze, E. Matheis, M. Hartmann, M. Skatchkov, F. Thaiss, R. A. K. Stahl, A. Warnholtz, et al. Mechanisms Underlying Endothelial Dysfunction in Diabetes Mellitus Circ. Res., February 2, 2001; 88 (2): e14 - e22. [Abstract] [Full Text] [PDF]

				Y. Higashi, M. Sanada, S. Sasaki, K. Nakagawa, C. Goto, H. Matsuura, K. Ohama, K. Chayama, and T. Oshima Effect of Estrogen Replacement Therapy on Endothelial Function in Peripheral Resistance Arteries in Normotensive and Hypertensive Postmenopausal Women Hypertension, February 1, 2001; 37(2): 651 - 657. [Abstract] [Full Text] [PDF]

				T. C. Resta, N. L. Kanagy, and B. R. Walker Estradiol-induced attenuation of pulmonary hypertension is not associated with altered eNOS expression Am J Physiol Lung Cell Mol Physiol, January 1, 2001; 280(1): L88 - L97. [Abstract] [Full Text] [PDF]

				K. Sampei, A. S. Mandir, Y. Asano, P. C. Wong, R. J. Traystman, V. L. Dawson, T. M. Dawson, P. D. Hurn, and C. Y. Hsu Stroke Outcome in Double-Mutant Antioxidant Transgenic Mice Editorial Comment Stroke, November 1, 2000; 31(11): 2685 - 2691. [Abstract] [Full Text] [PDF]

				M. Noris, M. Todeschini, S. Zappella, S. Bonazzola, C. Zoja, D. Corna, F. Gaspari, F. Marchetti, S. Aiello, and G. Remuzzi 17beta -Estradiol corrects hemostasis in uremic rats by limiting vascular expression of nitric oxide synthases Am J Physiol Renal Physiol, October 1, 2000; 279(4): F626 - F635. [Abstract] [Full Text] [PDF]

				L. P. Thompson, G. Pinkas, and C. P. Weiner Chronic 17{beta}-Estradiol Replacement Increases Nitric Oxide-Mediated Vasodilation of Guinea Pig Coronary Microcirculation Circulation, July 25, 2000; 102(4): 445 - 451. [Abstract] [Full Text] [PDF]

				H. Hikiji, W. S. Shin, T. Koizumi, T. Takato, T. Susami, Y. Koizumi, Y. Okai-Matsuo, and T. Toyo-Oka Peroxynitrite production by TNF-alpha and IL-1beta : implication for suppression of osteoblastic differentiation Am J Physiol Endocrinol Metab, June 1, 2000; 278(6): E1031 - E1037. [Abstract] [Full Text] [PDF]

				H. Fraser, S. T. Davidge, and A. S. Clanachan Activation of Ca2+-independent nitric oxide synthase by 17{beta}-estradiol in post-ischemic rat heart Cardiovasc Res, April 1, 2000; 46(1): 111 - 118. [Abstract] [Full Text] [PDF]

				H. Li and U. Förstermann Structure-Activity Relationship of Staurosporine Analogs in Regulating Expression of Endothelial Nitric-Oxide Synthase Gene Mol. Pharmacol., March 1, 2000; 57(3): 427 - 435. [Abstract] [Full Text]

				G. R. Drummond, H. Cai, M. E. Davis, S. Ramasamy, and D. G. Harrison Transcriptional and Posttranscriptional Regulation of Endothelial Nitric Oxide Synthase Expression by Hydrogen Peroxide Circ. Res., February 18, 2000; 86(3): 347 - 354. [Abstract] [Full Text] [PDF]

				J. Navarro-Antolin, J. Rey-Campos, and S. Lamas Transcriptional Induction of Endothelial Nitric Oxide Gene by Cyclosporine A. A ROLE FOR ACTIVATOR PROTEIN-1 J. Biol. Chem., February 4, 2000; 275(5): 3075 - 3080. [Abstract] [Full Text] [PDF]

				A. J Maxwell, B. E Anderson, and J. P Cooke Nutritional therapy for peripheral arterial disease: a double-blind, placebo-controlled, randomized trial of HeartBar(R) Vascular Medicine, February 1, 2000; 5(1): 11 - 19. [Abstract] [PDF]

				F. Squadrito, D. Altavilla, G. Squadrito, A. Saitta, D. Cucinotta, L. Minutoli, B. Deodato, M. Ferlito, G. M. Campo, A. Bova, et al. Genistein supplementation and estrogen replacement therapy improve endothelial dysfunction induced by ovariectomy in rats Cardiovasc Res, January 14, 2000; 45(2): 454 - 462. [Abstract] [Full Text] [PDF]

				T. Munzel, H. Li, H. Mollnau, U. Hink, E. Matheis, M. Hartmann, M. Oelze, M. Skatchkov, A. Warnholtz, L. Duncker, et al. Effects of Long-Term Nitroglycerin Treatment on Endothelial Nitric Oxide Synthase (NOS III) Gene Expression, NOS III-Mediated Superoxide Production, and Vascular NO Bioavailability Circ. Res., January 7, 2000; 86 (1): e7 - e12. [Abstract] [Full Text] [PDF]

				E. I. Closs, J.-S. Scheld, M. Sharafi, and U. Förstermann Substrate Supply for Nitric-Oxide Synthase in Macrophages and Endothelial Cells: Role of Cationic Amino Acid Transporters Mol. Pharmacol., January 1, 2000; 57(1): 68 - 74. [Abstract] [Full Text]

				T. Wallerath, K. Witte, S. C. Schafer, P. M. Schwarz, W. Prellwitz, P. Wohlfart, H. Kleinert, H.-A. Lehr, B. Lemmer, and U. Forstermann Down-regulation of the expression of endothelial NO synthase is likely to contribute to glucocorticoid-mediated hypertension PNAS, November 9, 1999; 96(23): 13357 - 13362. [Abstract] [Full Text] [PDF]

				J. Case and C. A. Davison Estrogen Alters Relative Contributions of Nitric Oxide and Cyclooxygenase Products to Endothelium-Dependent Vasodilation J. Pharmacol. Exp. Ther., November 1, 1999; 291(2): 524 - 530. [Abstract] [Full Text]

				M. Zhang, B. Luo, S.-J. Chen, G. A. Abrams, and M. B. Fallon Endothelin-1 stimulation of endothelial nitric oxide synthase in the pathogenesis of hepatopulmonary syndrome Am J Physiol Gastrointest Liver Physiol, November 1, 1999; 277(5): G944 - G952. [Abstract] [Full Text] [PDF]

				A. M. McNeill, N. Kim, S. P. Duckles, D. N. Krause, and H. A. Kontos Chronic Estrogen Treatment Increases Levels of Endothelial Nitric Oxide Synthase Protein in Rat Cerebral Microvessels • Editorial Comment Stroke, October 1, 1999; 30(10): 2186 - 2190. [Abstract] [Full Text] [PDF]

				A. Papapetropoulos, R. D. Rudic, and W. C Sessa Molecular control of nitric oxide synthases in the cardiovascular system Cardiovasc Res, August 15, 1999; 43(3): 509 - 520. [Abstract] [Full Text] [PDF]

				S. Kerr, M. J. Brosnan, M. McIntyre, J. L. Reid, A. F. Dominiczak, and C. A. Hamilton Superoxide Anion Production Is Increased in a Model of Genetic Hypertension : Role of the Endothelium Hypertension, June 1, 1999; 33(6): 1353 - 1358. [Abstract] [Full Text] [PDF]

				C. A. D. Nascimento, K. Kauser, and G. M. Rubanyi Effect of 17beta -estradiol in hypercholesterolemic rabbits with severe endothelial dysfunction Am J Physiol Heart Circ Physiol, May 1, 1999; 276(5): H1788 - H1794. [Abstract] [Full Text] [PDF]

				J. Zhang, G. A. Massmann, C. P. Mirabile, and J. P. Figueroa Nonpregnant Sheep Uterine Type I and Type III Nitric Oxide Synthase Expression Is Differentially Regulated by Estrogen Biol Reprod, May 1, 1999; 60(5): 1198 - 1203. [Abstract] [Full Text]

				H. J. Knot, K. M. Lounsbury, J. E. Brayden, and M. T. Nelson Gender differences in coronary artery diameter reflect changes in both endothelial Ca2+ and ecNOS activity Am J Physiol Heart Circ Physiol, March 1, 1999; 276(3): H961 - H969. [Abstract] [Full Text] [PDF]

				M. L Kuroski de Bold Estrogen, natriuretic peptides and the renin-angiotensin system Cardiovasc Res, March 1, 1999; 41(3): 524 - 531. [Abstract] [Full Text] [PDF]

				M.A Barbacanne, J Rami, J.B Michel, J.P Souchard, M Philippe, J.P Besombes, F Bayard, and J.F Arnal Estradiol increases rat aorta endothelium-derived relaxing factor (EDRF) activity without changes in endothelial NO synthase gene expression: possible role of decreased endothelium-derived superoxide anion production Cardiovasc Res, March 1, 1999; 41(3): 672 - 681. [Abstract] [Full Text] [PDF]

				P. M. Schwarz, B. Gierten, J.-P. Boissel, and U. Förstermann Expressional Down-Regulation of Neuronal-Type Nitric Oxide Synthase I by Glucocorticoids in N1E-115 Neuroblastoma Cells Mol. Pharmacol., August 1, 1998; 54(2): 258 - 263. [Abstract] [Full Text]

				U. Förstermann, J.-p. Boissel, and H. Kleinert Expressional control of the `constitutive' isoforms of nitric oxide synthase (NOS I and NOS III) FASEB J, July 1, 1998; 12(10): 773 - 790. [Abstract] [Full Text]

				X. Wang and A. A. Abdel-Rahman Estrogen modulation of eNOS activity and its association with caveolin-3 and calmodulin in rat hearts Am J Physiol Heart Circ Physiol, June 1, 2002; 282(6): H2309 - H2315. [Abstract] [Full Text] [PDF]

				Y. Chu, D. D. Heistad, K. L. Knudtson, K. G. Lamping, and F. M. Faraci Quantification of mRNA for Endothelial NO Synthase in Mouse Blood Vessels by Real-Time Polymerase Chain Reaction Arterioscler Thromb Vasc Biol, April 1, 2002; 22(4): 611 - 616. [Abstract] [Full Text] [PDF]

				F. Gobeil Jr, I. Dumont, A. M. Marrache, A. Vazquez-Tello, S. G. Bernier, D. Abran, X. Hou, M. H. Beauchamp, C. Quiniou, A. Bouayad, et al. Regulation of eNOS Expression in Brain Endothelial Cells by Perinuclear EP3 Receptors Circ. Res., April 5, 2002; 90(6): 682 - 689. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kleinert, H. Articles by Förstermann, U. Search for Related Content PubMed PubMed Citation Articles by Kleinert, H. Articles by Förstermann, U.