From the Department of Physiology, University of Melbourne, Parkville
(F.J.C., S.B.H.), and the Bone Marrow Transplant Unit, Alfred Hospital,
Prahran (M.K.), Victoria, Australia.
Correspondence to Stephen B. Harrap, Department of Physiology, University of Melbourne, Parkville, Victoria 3052, Australia. E-mail s.harrap{at}physiology.unimelb.edu.au
Treatment with the ACE inhibitor perindopril is followed by
a long-term reduction in BP.1 8 Surgical ablation
of the renal sympathetic nerves has also been shown to prevent the
development of hypertension in young SHR.9 ACE
inhibition may have both functional and structural effects on the
sympathetic nerves. For example, angiotensin can enhance
sympathetic nerve transmission and ACE inhibitors have
sympatholytic effects.10 In addition,
angiotensin may modulate sympathetic innervation by effects
on NGF in key tissues. Angiotensin increases the secretion
of NGF from vascular smooth muscle cells in
vitro,11 12 and Ang II receptor blockade reduces
tissue levels of NGF.13
In most tissues, including the kidney, the density of sympathetic
innervation correlates closely with tissues levels of NGF
peptide14 and mRNA,15 both
of which are intercorrelated in target tissues.16
It seems likely that the increased renal sympathetic innervation in
SHR17 is related to the increased levels of NGF
peptide and NGF mRNA that have been described in young
SHR.18 19 20 21
Our hypothesis was that ACE inhibition, by reducing NGF in key tissues
(ie, the kidneys) at a critical time (ie, in youth), would reduce renal
sympathetic innervation in a long-term manner. In effect, early ACE
inhibition would produce a partial pharmacological
sympathectomy. To test this hypothesis, we measured
renal NGF mRNA levels during and after treatment of young SHR with the
ACE inhibitor perindopril. Renal levels of NGF mRNA have
been shown to correlate with altered sympathetic innervation in
SHR,22 and perindopril treatment causes a
significant reduction in renal angiotensin peptide
levels.23 Because the persistent reduction in BP
after ACE inhibition may also be explained in part by the accumulation
of bradykinin during treatment,24 the effect of
bradykinin antagonism on renal NGF mRNA was also studied.
Treatments and BP Measurement
Long-term Studies to 20 Weeks of Age
Tail BP (BP) was measured twice per week in conscious animals using a
photoelectric tail-cuff pulse-detection system (IITC Inc). The sizes of
the restrainer cylinders and cuffs were matched to those of the growing
animals. Before the experimental period, the rats were conditioned to
the restraining cylinders and the BP measurement. Body weight was
measured weekly.
GFR
Isolation of RNA and Reverse Transcription
PCR Amplification
Controls included the omission of the reverse transcription step before
PCR amplification and the inclusion of water blanks as negative
controls for the detection of contamination. In parallel with each PCR
amplification, a standard curve was constructed using increasing
amounts of kidney cDNA to ensure that the amplification process was in
linear relationship to the amount of input cDNA. The reproducibility of
the quantitative amplifications was evaluated in replicate (n=10) PCR
amplifications. The specificity of the PCR products was verified by
Southern blot hybridization performed with end-labeled
oligonucleotide probes internal to the primers.
Analysis of the cDNA-PCR–Amplified Products
Statistical Analyses
NGF mRNA Levels
There were no significant differences between replicates for each
animal as analyzed by repeated measures ANOVA
(P=.39). The NGF mRNA levels were highest in the Ang
II–treated rats (P<.01) and lowest for the
perindopril-treated rats (P<.01) at 10 weeks of age
compared with untreated SHR. Hoe 140 treatment had no significant
effect on NGF mRNA levels. However, treatment with both Hoe 140 and
perindopril resulted in an intermediate level of NGF mRNA significantly
different from both control (P<.05) and perindopril-treated
(P<.05) animals (Table 1
Renal Function
Long-term Study
Between 13 and 20 weeks of age, the control SHR and Hoe 140–treated
groups showed a steady rise in BP, although at a slower rate compared
with that at 6 to 10 weeks of age. SHR treated with perindopril alone
showed a very slow rise in BP between 13 and 20 weeks of age and at 20
weeks of age had a BP (average, 165±1.1 mm Hg) significantly
lower than all other groups (P<.0001, ANOVA). At 20 weeks
of age, the tail BP of rats that had been treated with perindopril plus
Hoe 140 (average, 189±1.5 mm Hg) was significantly higher than
that of the rats treated with perindopril alone but also significantly
lower than that of the controls (average, 209±3.0 mm Hg) and SHR that
received Hoe 140 alone (average, 208±1.6 mm Hg) (P<.0001,
ANOVA).
NGF mRNA Levels
Renal Function
Previous studies have emphasized the potential importance of NGF in the
development and maintenance of high BP in the SHR. Both NGF
mRNA and peptide levels are significantly higher in SHR than in
normotensive strains in key tissues, including the kidneys and
resistance vessels.18 19 20 21 Because NGF levels have
been shown to correlate closely with the degree of sympathetic
innervation,14 15 22 it seems likely that NGF in
SHR contributes to the increased sympathetic innervation and activity
that are evident in histological,
electrophysiological, and biochemical
experiments.7 17 28 29 30 31 32 The prevention of
hypertension by administration of anti-NGF antibodies to young SHR is
also consistent with an etiologic role for NGF in this genetic
model of hypertension.33
Our results indicate that angiotensin exerts an important
control over renal NGF expression. The relative abundance of NGF mRNA
in young SHR was increased by angiotensin infusion and
decreased by ACE inhibition. These findings extend previous results in
other studies in which exogenous angiotensin increases NGF
production,11 12 whereas
AT1 angiotensin receptor antagonism
decreases NGF levels.13
The most interesting observation was that brief treatment with
perindopril was followed by a persistent and significant reduction in
renal NGF mRNA. The findings imply that perindopril in some way resets
renal NGF gene expression in young animals and that this effect
continues into adulthood. The consequences of such downregulation are
likely to affect sympathetic innervation in the kidney. NGF plays a
central role as a trophic signal from tissues to the sympathetic
nerves.34 It is important particularly in the
perinatal period, when levels of NGF determine the degree of neuronal
apoptosis34 and thereby set the degree of
sympathetic innervation of the target tissues. NGF is also important in
maintaining sympathetic innervation of target tissues into adult
life.34 Although direct studies of innervation
were not performed in these experiments, the correlation among NGF
mRNA,15 NGF peptide,14 and
sympathetic innervation in target tissues is well
established.34 Therefore, it seems likely that
brief ACE inhibition, by resetting renal NGF gene expression, may
induce partial renal sympathectomy. This may explain
the similarity in the BP effects of surgical renal
denervation9 and brief ACE inhibition in young
SHR.
The timing of ACE inhibitor treatment in relation to NGF
effects may also be important. The results from this experiment show
that the relative abundance of NGF mRNA was highest in young animals
and decreased with age in untreated SHR. Similar findings have been
reported by other investigators.19 20 It seems
also that the increase in NGF occurs only in certain tissues. In young
SHR, the kidneys, spleen, blood vessels, and sympathetic nerves, but
not the heart, show high NGF levels.35 This
tissue-specific and developmental stage–specific increase of NGF in
SHR may not only establish high levels of sympathetic innervation but
also define a window during which ACE inhibitor treatment
has an effect that is perpetuated into later
life.36
Our study raises interesting questions about the control of NGF gene
expression in the kidney. The explanation for developmental
stage–specific changes of NGF in SHR is not known, but altered
transcriptional control of the NGF gene may be the result of genetic
mutation in gene regulatory regions. We have identified linkage between
the NGF gene and the inheritance of high BP in genetic crosses of
SHR,25 although functional mutations have not yet
been identified. It is possible that mutations in other genes have an
impact on NGF gene expression. For example, increased renal renin gene
expression5 may modulate tissue
angiotensin and raise NGF mRNA in young SHR.
In addition to the influence of angiotensin, our findings
also indicate that bradykinin may be important, at least in the
pharmacological actions of perindopril. The accumulation of bradykinin
during treatment23 may contribute to the
reduction of renal NGF mRNA. Blockade of the bradykinin
B2 receptor with Hoe 140 during perindopril
treatment significantly attenuated the reduction of NGF mRNA observed
with perindopril alone. However, the role of bradykinin may not be
relevant to normal physiology because the administration of Hoe 140
alone had no significant effect on basal SHR NGF mRNA levels.
Interestingly, the effects of bradykinin
accumulation23 on NGF mRNA appear relevant only
to the treatment period and not to the long-term resetting of renal NGF
mRNA. This is in contrast with the BP effects, in which bradykinin does
not appear to contribute to lower pressure during perindopril treatment
but is partially responsible for the long-term reduction in pressure
after perindopril.24 Clearly, the mechanisms of
BP reduction differ during and after treatment. Notably, the partial
reduction in long-term BP in rats that had received perindopril and Hoe
140 was not associated with any change in renal NGF mRNA. Presumably,
not all of the long-term effects of ACE inhibitors are
related to changes in renal NGF. However, our findings suggest that the
additional pressure reduction observed in the perindopril-treated rats
is related to the lower NGF mRNA.
Given that Ang II increases and perindopril decreases both BP and NGF
mRNA, it could be argued that changes in NGF mRNA are simply the result
of changes in BP. However, our results argue against such a generality.
First, at 10 weeks of age, SHR receiving perindopril plus Hoe 140 had
the same BPs but significantly higher NGF mRNA levels than rats treated
with perindopril alone. Second, at 20 weeks of age, SHR that had been
treated with both perindopril and Hoe 140 had the same NGF mRNA levels
but significantly lower BPs than control SHR. Third, there was no
significant correlation in any individual group between renal NGF mRNA
and BP. Finally, the increase in BP observed in untreated SHR was
accompanied by a fall in renal NGF mRNA.
We have described previously1 that perindopril
treatment is associated with an increase in GFR in young SHR. The
present study demonstrated significantly elevated GFR at 10 weeks
but no significant change in the long term, possibly because of a
shorter ACE inhibitor treatment period. Although we
observed opposite changes in NGF mRNA and GFR in SHR treated with
perindopril and Ang II, there was no correlation between renal NGF mRNA
and GFR. The significant changes in NGF mRNA levels in the absence of
GFR alteration in the SHR receiving perindopril plus Hoe 140 also
indicates that the link between these renal molecular and functional
characteristics is not absolute.
In summary, these studies raise some interesting questions regarding
ACE inhibition and the expression of the NGF gene in SHR. They also
indicate the importance of treatment at an early age and its long-term
effect on adult renal NGF gene expression and BP.
Received August 6, 1997;
first decision September 4, 1997;
accepted September 18, 1997.
2.
Folkow B. Physiological aspects of
primary hypertension. Physiol Rev. 1982;62:347–504.
3.
Judy WV, Watanabe AM, Murphy WR, Aprison BS, Yu PL.
Sympathetic nerve activity and blood pressure in normotensive backcross
rats genetically related to the spontaneously hypertensive rat.
Hypertension. 1979;1:598–604.
4.
Saxena PR. Interaction between the
renin-angiotensin-aldosterone and sympathetic
nervous systems. J Cardiovasc Pharmacol. 1992;19:S80–S88.
5.
Samani NJ, Brammar WJ, Swales JD. Renal and
extra-renal levels of renin mRNA in experimental hypertension.
Clin Sci. 1991;80:339–344.[Medline]
[Order article via Infotrieve]
6.
Wyss JM, Oparil S, Sripairojthikoon W. Neuronal
control of the kidney: contribution to hypertension. Can J
Physiol Pharmacol. 1992;70:759–770.[Medline]
[Order article via Infotrieve]
7.
Lundin S, Ricksten SE, Thoren P. Renal sympathetic
activity in spontaneously hypertensive rats and normotensive controls,
as studied by three different methods. Acta Physiol Scand. 1984;120:265–272.[Medline]
[Order article via Infotrieve]
8.
Harrap SB, Van der Merwe WM, Griffin SA, Macpherson F,
Lever AF. Brief ACE inhibitor treatment in young
spontaneously hypertensive rats reduces blood pressure in the
long-term. Hypertension. 1990;16:603–614.
9.
Winterwitz SR, Katholi RE, Oparil S. Role of the renal
sympathetic nerves in the development and maintenance of
hypertension in the spontaneously hypertensive rat. J Clin
Invest. 1980;66:971–978.
10.
Crozier IG, Teoh R, Kay R, Nicholls MG. Sympathetic
nervous system during converting enzyme inhibition. Am J
Med. 1989;87:29S–32S.
11.
Creedon D, Tuttle JB. Nerve growth factor synthesis in
vascular smooth muscle. Hypertension. 1991;18:730–741.
12.
Tuttle JB, Etheridge R, Creedon DJ. Receptor mediated
stimulation and inhibition of nerve growth factor secretion by vascular
smooth muscle. Exp Cell Res. 1993;538:350–361.
13.
Jefferson S, Rush R, Zettler C, Frewin DB, Head RJ. The
influence of the renin angiotensin system on abnormal
expression of nerve growth factor in the spontaneously hypertensive
rat. Clin Exp Pharmacol Physiol. 1995;22:478–480.[Medline]
[Order article via Infotrieve]
14.
Korsching S, Thoenen H. Nerve growth factor in
sympathetic ganglia and corresponding target organs of the rat:
correlation with density of sympathetic innervation. Proc Natl
Acad Sci U S A.. 1983;80:3513–3516.
15.
Shelton DL, Reichardt LF. Expression of the nerve
growth factor correlates with the density of sympathetic innervation in
effector organs. Proc Natl Acad Sci U S A.. 1984;81:7951–7955.
16.
Heumann R, Korsching S, Scott J, Thoenen H.
Relationship between levels of nerve growth factor (NGF) and its
messenger RNA in sympathetic ganglia and peripheral target
tissue. EMBO J. 1984;3:3183–3189.[Medline]
[Order article via Infotrieve]
17.
De Michele M, Amenta F. Increase in perivascular
noradrenergic nerve density and decrease in
acetylcholinesterase-positive sympathetic nerve density in the kidneys
of spontaneously hypertensive rats. Clin Exp Hypertens.
1988;A10:1031–1049.
18.
Zettler C, Rush RA. Elevated concentrations of nerve
growth factor in heart and mesenteric arteries of spontaneously
hypertensive rats. Brain Res. 1993;614:15–20.[Medline]
[Order article via Infotrieve]
19.
Ueyama T, Hamada M, Hano T, Nishio I, Masuyama Y,
Furukawa S. Increased nerve growth factor levels in spontaneously
hypertensive rats. J Hypertens. 1992;10:215–219.[Medline]
[Order article via Infotrieve]
20.
Donohue SJ, Head RJ, Stitzel RE. Elevated nerve growth
factor levels in young spontaneously hypertensive rats.
Hypertension. 1989;14:421–426.
21.
Falckh PH, Harkin LA, Head RJ. Resistance vessel gene
expression of nerve growth factor is elevated in young spontaneously
hypertensive rats. J Hypertens. 1992;10:913–918.[Medline]
[Order article via Infotrieve]
22.
Falckh P, Harkin LA, Head RJ. Nerve growth factor
mRNA content parallels altered sympathetic innervation in the
spontaneously hypertensive rat. Clin Exp Pharmacol Physiol. 1992;19:541–545.[Medline]
[Order article via Infotrieve]
23.
Duncan AM, Kladis A, Campbell DJ. Effects of
converting enzyme inhibitors on angiotensin and
bradykinin peptides. Hypertension. 1994;23:439–449.
24.
O'Sullivan JB, Harrap SB. Resetting blood pressure in
spontaneously hypertensive rats: the role of bradykinin.
Hypertension. 1995;25:162–165.
25.
Kapuscinski M, Charchar FJ, Mitchell GA, Innes B,
Norman TL, Harrap SB. Nerve growth factor gene and hypertension in
spontaneously hypertensive rats. J Hypertens. 1996;14:191–197.[Medline]
[Order article via Infotrieve]
26.
O'Brien RC, Allen TJ, Cooper ME, Bach L, Jerums
G. Glomerular filtration rate in early experimental
diabetes. Diabetes Comp. 1988;2:8–11.
27.
Chomczynski CN, Sacchi N. Single-step method of RNA
isolation by acid guanidinim thiocyanate-phenol-chloroform extraction.
Anal Biochem. 1987;162:156–159.[Medline]
[Order article via Infotrieve]
28.
Head RJ. Hypernoradrenergic
innervation: its relationship to functional and hyperplastic changes in
the vasculature of the spontaneously hypertensive rat. Blood
Vessels. 1989;26:1–20.[Medline]
[Order article via Infotrieve]
29.
van Helden DF, Woolridge S. Role of nerves in
hypertension. Nature. 1990;348:118–119.[Medline]
[Order article via Infotrieve]
30.
Tarver J, Berkowoitz B, Spector S. Alterations in
tyrosine hydroxylase and monoamine oxidase activity in blood vessels.
Nature. 1971;231:252–253.
31.
Nagatsu T, Ikuta K, Numata Y, Kato T, Sano M, Nagatsu
I, Umezawa H, Matsuzaki M, Takeuchi T. Vascular and brain dopamine
ß-hydroxylase activity in young spontaneously hypertensive rats.
Science. 1976;191:290–291.
32.
Haebara HJ, Ichijima K, Motoyoshi T, Okamoto K.
Fluorescence microscopical studies on noradrenaline
in the peripheral blood vessels of spontaneously
hypertensive rats. Jpn Circ J. 1968;32:1391–1400.[Medline]
[Order article via Infotrieve]
33.
Lee R, Triggle GR, Cheung DWT, Coughlin MD. Structural
and functional consequences of neonatal sympathectomy
on blood vessels in SHR. Hypertension. 1987;10:328–338.
34.
Levi-Montalcini R, Dal Toso R, della Valle F, Skaper
SD, Leon A. Update on the NGF saga. J Neurol Sci. 1995;130:119–127.[Medline]
[Order article via Infotrieve]
35.
Zettler C, Rush RA. Elevated concentrations of nerve
growth factor in heart and mesenteric arteries of spontaneously
hypertensive rats. Brain Res. 1993;614:15–20.
36.
Harrap SB. A developmental mechanism involving
angiotensin in spontaneously hypertensive rats. Clin
Exp Pharmacol Physiol. 1992;19:19–22. \
© 1998 American Heart Association, Inc.
Scientific Contributions
Persistent Reduction in Renal Nerve Growth Factor mRNA After Perindopril Treatment of Young Spontaneously Hypertensive Rats
Abstract
Top
Abstract
Introduction
Methods
Results
Discussion
References
Abstract—Nerve growth factor (NGF)
determines sympathetic innervation of target tissues, and NGF levels
are increased in young spontaneously hypertensive rats (SHR).
Angiotensin can affect NGF levels, and the persistent
reduction in blood pressure after brief
angiotensin-converting enzyme inhibition in young SHR may
involve long-term changes in NGF and sympathetic innervation. We
measured the relative abundance of renal NGF mRNA by reverse
transcription–polymerase chain reaction in SHR during and after
treatment from 6 to 10 weeks of age with vehicle, perindopril (3 mg/kg
per day), the bradykinin B2 antagonist Hoe 140
(0.5 mg/kg per day), both perindopril and Hoe 140, or
angiotensin II (Ang II; 200 ng/kg per minute).
Glomerular filtration rates were estimated at 10 and 20
weeks of age. At 10 weeks of age, Ang II caused a significant
(P<.01) increase and perindopril caused a significant
(P<.01) decrease in renal NGF mRNA levels. Blockade of
the bradykinin B2 receptor during perindopril treatment
attenuated (P<.05) the reduction in NGF mRNA levels.
Renal NGF mRNA (P=.005) and blood pressure
(P<.001) remained significantly lower than control 10
weeks after perindopril treatment was stopped. The partial reduction in
blood pressure at 20 weeks of age in rats that had received perindopril
and Hoe 140 was not associated with any difference in renal NGF mRNA.
Perindopril-induced long-term reduction in renal NGF mRNA levels may
decrease sympathetic innervation and thereby contribute to the
long-term posttreatment blood pressure reduction.
Key Words: nerve growth factor • angiotensin-converting enzyme • sympathetic nervous system • bradykinin • genetics
Introduction
Top
Abstract
Introduction
Methods
Results
Discussion
References
The
renin-angiotensin1 and sympathetic
nervous2 3 systems contribute to the development
of hypertension in the SHR. These two control systems also show
significant interaction4 that may be relevant,
particularly in the kidneys of young SHR, in which increased renin gene
expression5 and heightened renal sympathetic
nerve activity have been demonstrated.6 7
Methods
Top
Abstract
Introduction
Methods
Results
Discussion
References
Animals
Four-week-old male SHR originally derived from National
Institutes of Health stock were obtained from an inbred colony in the
Biological Research Laboratories, Austin Hospital, Melbourne,
Australia. The SHR colony was subjected to regular tests with
biochemical polymorphic markers to ensure its inbred status, which
was confirmed recently using DNA minisatellite fingerprint markers and
isozyme analysis.25 All animals were
housed in groups of 3 to 4 per box and fed standard laboratory rat chow
containing 0.1 mmol/g NaCl (Norco Rat and Mouse Cubes) and had
unlimited access to drinking water. A 12-hour light/dark regimen was
maintained throughout in a temperature-controlled room (22°C to
25°C). All experimental protocols were approved by the Austin
Hospital Animal Ethics Committee and the University of Melbourne Animal
Experimentation Ethics Committee.
Short-term Studies to 10 Weeks of Age
Five groups of male SHR were treated from 6 to 10 weeks of age
with one of the following: (1) water by gavage once per day (n=6), (2)
perindopril dissolved in water (3 mg/kg per day) by gavage once per day
(n=6), (3) Ang II (200 ng/kg per minute) dissolved in 150 mmol/L
NaCl delivered subcutaneously by osmotic minipumps (Alzet) (n=6), (4)
Hoe 140 (0.5 mg/kg per day; n=6) dissolved in saline delivered
subcutaneously by osmotic minipumps, or (5) perindopril (3 mg/kg per
day) in combination with Hoe 140 (0.5 mg/kg per day; n=6). The maximum
volume of gavage was 0.5 mL. The efficacy, dose, and route of
administration of perindopril, Ang II, and Hoe 140 were based on
previously published experiments.8 24
In the long-term experiment, four groups of male SHR were also
treated from 6 to 10 weeks of age with one of the following: (1) water
by gavage once per day (n=6), (2) perindopril (3 mg/kg per day) by
gavage once per day (n=6), (3) Hoe 140 (0.5 mg/kg per day; n=6), or (4)
perindopril (3 mg/kg per day) in combination with Hoe 140 (0.5 mg/kg
per day; n=6).
GFR was measured in all animals using the single-shot
radiolabeled DTPA method.26 A calibrated dose of
technetium reduced with stannous chloride complexed to DTPA
(Sigma Chemical Co) was injected into the tail vein of conscious rats.
After 43 minutes, a blood sample was taken from a different tail vein
and centrifuged in a heparinized tube. Plasma radioactivity was
counted in a gamma counter and compared with a reference prepared at
the time of injection. GFR was calculated according to the following
equation:
Clearance=Vxln(Po/Pt)/t,
where V is volume of distribution, Pt is
theoretical plasma concentration at injection (ie, injected
amount/volume of distribution), and Po is
observed plasma concentration at t minutes after
injection.26 GFR was measured at 10 weeks of age
in short-term studies and at 20 weeks of age in long-term
studies.
GFR and BP measurements were followed by an overdose of
barbiturate (100 mg/kg Nembutal IP, Boehringer) and removal of
both kidneys, which were weighed and then immediately frozen in liquid
nitrogen and stored at -70°C until further use. Total RNA was
isolated from 100 to 200 mg of kidney tissue using the acid phenol
method of Chomczynski and Sacchi.27 Total RNA was
quantified spectrophotometrically, and purity was assessed from the
A260/A280 ratio (minimum
1.7). First-strand cDNA was synthesized from 5 µg of total RNA using
a cDNA synthesis kit (Gibco BRL) by the random-primed avian
myeloblastosis virus reverse transcriptase method.
Oligonucleotide primers were synthesized and
purified (Gibco BRL), having been designed according to the
nucleotide sequences encoding rat NGF and GAPDH. GAPDH
amplification was carried out to provide internal standards for
relative quantification of NGF transcripts in the isolated total RNA.
The base sequences (5' to 3') of oligonucleotides used
for amplification of NGF (primer 1: AAGGATCCTGGACCCAAGCTCACCTCA;
primer 2: GAGTGACGTGGATGAGCGCTTGCTCCT) and GAPDH (primer 1:
ATCACTGCCACTCAGAAGACT; primer 2: CATGCCAGTGAGCTTCCCGTT) were chosen
to amplify products that crossed exon-intron boundaries and thus
preclude the amplification of potentially contaminating genomic DNA.
cDNA equivalent to 0.25 µg of total RNA was amplified in a 25-µL
reaction volume containing 1.5 mmol/L MgCl2,
50 µmol/L dNTP, 5 U of Taq (Gibco BRL), and primers
(0.5 µmol/L each) (Ultra Pure, Pharmacia). Taqstart antibody
(Clonetech) was included to reduce nonspecific amplification. The
cycling protocol (PE 480 thermal cycler, Perkin-Elmer) consisted of an
initial denaturation (95°C, 5 minutes) followed by sequential cycles
of denaturation (95°C, 1 minute), annealing (60°C, 1 minute), and
extension (72°C, 1 minute) followed by a final extension stage
(72°C, 7 minutes). The cycle numbers for NGF (30) and GAPDH (23) were
chosen to ensure that both reactions were in the exponential phase. The
two gene amplifications were carried out in separate reactions and
repeated four times for each cDNA sample to limit the tube-to-tube
variation of PCR amplification.
A 10-µL aliquot from each PCR reaction was electrophoresed in
1.5% agarose gels at 10 V/cm and stained with ethidium bromide (0.25
µg/mL TBE buffer) for 20 minutes and destained for another 10
minutes. Control and treatment samples were run concomitantly and in
different positions on the gel to reduce potential variation caused by
electrophoretic and staining artifacts. Therefore, each sample was
divided into four replicates that were measured on the same gel.
Measurement of fluorescence was performed using a laser scanner
(FluorImager 575, Molecular Dynamics) and was followed by
quantification using the Genequant software. All results were expressed
as ratios of the intensity of the band of the NGF product to the
intensity of the band representing GAPDH after subtraction
of background fluorescence. To account for intra-assay
variation, each of the four replicates was included in the
analysis of individual rats and treatment groups.
Descriptive statistics are mean±SEM unless stated otherwise.
ANOVA was used to test differences in tail BP, body weight, and GFR
between the different treatment groups in the short-term and long-term
studies separately. Between-group differences were tested using the
Student-Newman-Keuls range test. NGF mRNA levels were analyzed
initially by repeated measures ANOVA using each the four replicates for
each rat in this analysis so that within-subject variation (ie,
intra-assay variation) was taken into account. Group average values of
NGF mRNA were compared by ANOVA, and between-group differences were
tested using the Student-Newman-Keuls range test. Repeated measures
ANOVA was also used to assess the effects of treatment in the
longitudinal body weight and tail BP. Differences were regarded as
statistically significant at P<.05.
Results
Top
Abstract
Introduction
Methods
Results
Discussion
References
Short-term Study
The average weekly body weights for each of the five groups in the
short-term study revealed that before and during treatment all animals
grew normally and there were no significant differences
(P=.243). Average tail BP values are shown in Fig 1
for the short-term study. Control SHR
showed a steady rise in BP, characteristic of the developmental phase
of hypertension. Their average tail BP at 10 weeks of age was
193±5 mm Hg. Ang II–treated rats showed a significant increase
in BP (P<.001, ANOVA) at 10 weeks of age with an average of
240±3 mm Hg. Hoe 140 treatment alone produced no significant
change in BP compared with the control rats (182±4 mm Hg).
Perindopril treatment decreased BP significantly below that of control
rats (145±2 mm Hg). The combination of Hoe 140 and perindopril
treatment resulted in average BPs similar to those of the
perindopril-treated rats (148±2 mm Hg).
View larger version (62K):
[in a new window]
Figure 1. Average biweekly tail blood pressures of five
groups of male SHR between 6 and 10 weeks of age. Data are mean±SEM.
Treatment between 6 and 10 weeks of age consisted of vehicle controls
( 
), perindopril (
), Hoe 140 (
), perindopril plus Hoe 140
(
), or Ang II (
).
Fig 2 shows
representative images of NGF and GAPDH PCR products
from kidney cDNA as scanned by the FluorImager. The sizes of PCR
products were 440 bp for NGF and 220 bp for the GAPDH product.
Southern blot analysis using oligonucleotide
probe internal to the PCR primers (data not shown) confirmed the
identity of these products. Relative abundance of renal NGF mRNA in
the five treatment groups after correction for GAPDH is given in Table 1.
View larger version (15K):
[in a new window]
Figure 2. Representative images of the PCR
products after gel electrophoresis and quantitative scanning by the
Fluroimager for the five treatment groups at 10 weeks of age. The first
row shows the amplified NGF product at 
440 bp, the second row
represents the GAPDH PCR product at 220 bp. Treatment
between 6 and 10 weeks of age consisted of Ang II (lane 1), Hoe 140
(lane 2), perindopril plus Hoe (lane 3), perindopril (lane 4), or
vehicle controls (lane 5).
View this table:
[in a new window]
Table 1. Average Abundance of Renal NGF mRNA at 10 and 20
Weeks of Age 
). No correlation was observed
between NGF mRNA levels and BP at 10 weeks of age in any group.
Table 2 shows the average GFR
values, which were significantly different (P<.0001, ANOVA)
between the treatment groups at 10 weeks of age. Perindopril-treated
SHR showed significantly higher GFR values than any other group. The
GFRs of animals receiving both Hoe 140 and perindopril, Hoe 140 alone,
or Ang II were significantly lower than those of controls. No
correlation was observed between NGF mRNA levels and GFR at 10 weeks of
age in any group.
View this table:
[in a new window]
Table 2. Average GFR Values of Different Treatment Groups at
10 and 20 Weeks of Age
The average weekly body weights of the four groups in the
long-term study were not significantly different before, during, or
after treatment. During treatment, the tail BPs showed changes similar
to those seen in the short-term experiment (Fig 3). All rats showed an increase in BP in
the 2 weeks after treatment was stopped, but the magnitude of increase
varied between groups. Between 11 and 12 weeks of age, the tail BP of
control animals rose on average by 7.5 mm Hg compared with an
average rise of 39 mm Hg in the rats that had been treated with
both Hoe 140 and perindopril. The pressure increases in the SHR treated
with either perindopril or Hoe 140 were of a magnitude similar to that
of the control group.
View larger version (38K):
[in a new window]
Figure 3. Average biweekly tail blood pressures of four
groups of male SHR between 6 and 20 weeks of age. Data are mean±SEM.
Treatment between 6 and 20 weeks of age consisted of vehicle controls
( ), perindopril (), Hoe 140 (), or perindopril plus Hoe 140
().
Compared with the levels seen at 10 weeks of age, the relative
abundance of renal NGF mRNA in control SHR was significantly lower
(P<.05 by independent t test) in the 20-week-old
control SHR. At 20 weeks of age, the SHR that received perindopril
between 6 and 10 weeks of age showed significantly lower levels of NGF
mRNA expression (P=.005, ANOVA) than the other three
treatment groups (Table 1). Hoe 140 and perindopril plus Hoe 140
treatments showed no significant difference in NGF mRNA compared with
the control group. No correlation was observed between NGF mRNA levels
and BP at 20 weeks of age in any group.
At 20 weeks of age, the perindopril-treated rats showed the
highest average GFR, but ANOVA revealed marginal statistical
significance for this result (P=.055, ANOVA). Renal NGF mRNA
levels did not correlate with GFR at 20 weeks of age.
Discussion
Top
Abstract
Introduction
Methods
Results
Discussion
References
This study reveals that the reduction in BP that occurs during and
after perindopril treatment in young SHR is associated with a
significant reduction in the relative abundance of renal NGF mRNA. The
decrease in NGF gene expression may be an important component in the
short-term and long-term effects of ACE inhibition in this strain.
Selected Abbreviations and Acronyms
ACE
=
angiotensin-converting enzyme
Ang II
=
angiotensin II
BP
=
blood pressure
GFR
=
glomerular filtration rate
NGF
=
nerve growth factor
PCR
=
polymerase chain reaction
SHR
=
spontaneously hypertensive rat(s)
TBE
=
Tris-boric acid and EDTA
Acknowledgments
This work was supported by a grant from Institut de Recherches
Internationales Servier, Courbevoir, France.
References
Top
Abstract
Introduction
Methods
Results
Discussion
References
1.
Harrap SB, Nicolaci J, Doyle AE. Persistent
effects on blood pressure and renal hemodynamics
following chronic converting enzyme inhibition with perindopril.
Clin Exp Pharmacol Physiol. 1986;13:753–765.[Medline]
[Order article via Infotrieve]
This article has been cited by other articles:
 |
|
 |
|
  K. Skov, S. Mogensen, and M. J Mulvany Persistent effect of treatment with candesartan cilexetil on blood pressure in spontaneously hypertensive rats Journal of Renin-Angiotensin-Aldosterone System, March 1, 2001; 2(1_suppl): S91 - S94. [Abstract] [PDF]
|
|
|
|
 |
|
 J. Zicha and J. Kunes Ontogenetic Aspects of Hypertension Development: Analysis in the Rat Physiol Rev, October 1, 1999; 79(4): 1227 - 1282. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. J. Charchar, M. K. Kapuscinski, and S. B. Harrap Nerve Growth Factor Gene Locus Explains Elevated Renal Nerve Growth Factor mRNA in Young Spontaneously Hypertensive Rats Hypertension, October 1, 1998; 32(4): 705 - 709. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||