Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 1998;31:1002-1006

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moreno, G.
Right arrow Articles by Gamba, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moreno, G.
Right arrow Articles by Gamba, G.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*SODIUM CHLORIDE

(Hypertension. 1998;31:1002-1006.)
© 1998 American Heart Association, Inc.


Scientific Contributions

Electroneutral Na-Coupled Cotransporter Expression in the Kidney During Variations of NaCl and Water Metabolism

Gabriela Moreno; Alejandra Merino; Adriana Mercado; Juan Pablo Herrera; Jorge González-Salazar; Ricardo Correa-Rotter; Steven C. Hebert; ; Gerardo Gamba

From the Molecular Physiology Unit, Department of Nephrology and Mineral Metabolism, Instituto Nacional de la Nutrición Salvador Zubirán and Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México (G.M., A. Merino, A. Mercado, J.P.H., J.G.-S., R.C.-R., G.G.); and the Division of Nephrology, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tenn (S.C.H.).

Correspondence to Gerardo Gamba, MD, PhD, Molecular Physiology Unit, Department of Nephrology and Mineral Metabolism, Instituto Nacional de la Nutrición Salvador Zubirán, Instituto de Investigaciones Biomédicas, UNAM, Vasco de Quiroga No. 15, Tlalpan 14000, Mexico City, México. E-mail gamba{at}mailer.main.conacyt.mx


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—The purpose of the present study was to analyze the long-term regulation of renal bumetanide-sensitive Na+-K+-2Cl- cotransporter and thiazide-sensitive Na+-Cl- cotransporter gene expression during changes in NaCl and water metabolism. Male Wistar rats exposed to high or low NaCl intake, saline loading, dehydration, water loading, and furosemide administration during 7 days were studied. Control groups had access to regular food and tap water. Rats were kept in metabolic cages for 4 days before and during the experiment to determine daily urinary electrolyte excretion and osmolarity. At the end of the experiment, creatinine clearance and serum electrolyte levels were also measured. Kidneys were excised and macroscopically subdivided into cortex and outer and inner medulla. Total RNA was extracted from each individual cortex or outer medulla by use of the guanidine/cesium chloride method. The Na+-K+-2Cl- cotransporter expression in outer medulla total RNA was assessed by nonradioactive Northern blot analysis and the Na+-Cl- cotransporter expression in renal cortex total RNA was assessed by semiquantitative polymerase chain reaction. Experimental maneuvers were adequately tolerated, and all groups developed the appropriate renal response to each challenge. However, the level of expression of both cotransporters did not change in any model, except for a 2.8-fold increase in the Na+-Cl- cotransporter expression during dehydration. We conclude that nephron adaptation to 7-day modifications in NaCl and water metabolism does not include changes in the amount of electroneutral sodium-coupled cotransporter gene expression at the mRNA level.


Key Words: bumetanide • thiazide • gene expression • ion transport


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The loop of Henle reabsorbs {approx}20% of the glomerular filtrate and plays a key role in the production and maintenance of renal medullary hypertonicity, providing the kidney with the ability to form urine that can be more diluted or concentrated than plasma, a functional capacity that is essential for survival of mammals that live on land, including human beings. The distal nephron, the segments beyond macula densa, reabsorbs {approx}10% of the filtrate and secretes potassium under the modulating influence of hormones, including aldosterone and vasopressin. Therefore, the loop of Henle and the distal nephron together are responsible for the fine control of renal sodium and water excretion and urine osmolarity.

Several studies have shown that changes in electrolyte and water metabolism during periods from 5 to 14 days induce functional and structural adaptation of the thick ascending limb and distal tubule in order to keep the internal milieu unchanged. The adaptation goes from increased reabsorption capacity to structural changes such as tubular hypertrophy, increase in basolateral membrane area and in size and number of mitochondria, and an increase in basolateral Na+-K+-ATPase activity.1 2 3 4 To date, however, little is known about molecular mechanisms of adaptation in these nephron segments.

Electroneutral sodium chloride–coupled cotransporters are good candidates to be involved in the adaptation of the loop of Henle and distal tubule to modifications in sodium and water ingestion. BSC1 is expressed in the apical membrane of the thick ascending limb of Henle's loop,5 6 where it is one of the targets of vasopressin and is responsible for Na+ reabsorption,7 whereas TSC is expressed in the apical membrane of the distal tubule,8 where it is the major pathway for NaCl transport9 and is also involved in calcium reabsorption.10 BSC1 and TSC also serve as the furosemide or thiazide receptors, respectively, which are among the most common drugs used in the treatment of hypertension and sodium-retaining states. Their role in the long-term regulation of salt metabolism and arterial pressure has recently gained more attention as they have been shown to be part of the genes working on a common pathway that regulates salt reabsorption in the kidney. Point mutations of BSC1 or TSC cosegregate with the development of Bartter's or Gitelman's syndromes, respectively,11 12 conditions associated with reduced blood pressure, by diminishing renal salt reabsorption. Major advances have been made in the past few years in the molecular identification of the electroneutral sodium chloride–coupled cotransporters. cDNA encoding BSC1 or TSC has been isolated from several species,11 12 13 14 15 16 17 18 providing new tools to investigate their role in the regulation of ion transport and nephron adaptation to changes in sodium and water ingestion.

The objective of the present work was to study BSC1 and TSC mRNA expression in rat kidney after modifications of NaCl and water metabolism by changing the amount of NaCl or water ingestion or by administering furosemide during a 7-day period.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Rats
Male Wistar rats weighing 200 to 300 g, inbred in our animal facility, were used for the study. All rats were kept in metabolic cages (Nalgene) at the animal facility with light/dark cycles of 12/12 hours at constant temperature and humidity of 20°C and 65%, respectively, during 4 days before and during the experimental period. Urine that was spontaneously voided during every 24 hours was collected in the metabolic cage, with light mineral oil in the urine collector to determine daily urinary electrolyte excretion and osmolarity. At the end of the experiment, serum and urine electrolytes were measured with a NOVA4 electrolyte analyzer (NOVA Biomedical), serum and urine creatinine with an autoanalyzer (Beckman Instruments), and osmolarity with a digimatic osmometer model 3D2 (Advanced Instruments Inc). Renal creatinine clearances were calculated by the standard formula C=U · V/P, were U is the concentration in urine, V is urine flow rate, and P is plasma concentration. Our institutional animal care committee approved the experimental protocol.

Experimental Procedures
Six groups of animals were studied over a 7-day period. Group 1 was given high NaCl intake. Animals were allowed to 20 g/d of high NaCl chow (2.92% NaCl chow, AIN-76-modified, ICN Biochemicals) with free access to tap water. Group 2 was given low NaCl intake. Animals in this group received 20 g/d of low NaCl chow (0.029% NaCl chow, AIN-76-modified, ICN Biochemicals) and had ad libitum access to tap water. Group 3 was given saline loading. Rats were fed with 20 g/d of regular rat chow but they drank exclusively NaCl water (0.16 mol/L). Group 4 was the dehydration group. Rats had free access to food with limited access to 10 mL of tap water per day. This group was studied for only 4 days. Group 5 was given water loading. Animals had no access to food and drank exclusively 10% glucose water. Group 6 was given furosemide. Rats received a daily intraperitoneal injection of furosemide (10 mg/100 g of body wt in saline solution, pH 8.0) and were allowed 20 g/d of regular chow with free access to a high salt drinking fluid (8 g/L of NaCl and 1 g/L of KCl). The control animals for groups 1 to 5 consisted of rats that were simultaneously carried through all procedures and allowed to eat 20 g/d of regular chow diet and ad libitum access to tap water. As a control for the furosemide group, we used rats that were treated with intraperitoneal injection of saline solution at pH 8.0 and were allowed to eat 20 g/d of regular chow with free access to tap water.

Northern Blot Analysis
At the end of each experiment, rats were killed and the kidneys were macroscopically subdivided into cortex and outer and inner medulla. Total RNA was extracted from each renal cortex or outer medulla by use of the guanidine/cesium chloride method.19 The RNA was dissolved in sterile DEPC-treated water, and RNA concentration was determined by absorbance reading at 260 nm (DU 640, Beckman). Because BSC is a highly abundant gene in the renal outer medulla, the analysis was performed by Northern blot, with a nonradioactive method. Aliquots of 2.0 µg of total RNA from each outer medulla sample were separated by 1% agarose/formaldehyde gel electrophoresis and transferred to a nylon membrane (Duralon UV, Stratagene). RNA was fixed to the nylon membrane by UV cross-linking (Stratalinker, Stratagene).

A digoxigenin-UTP–labeled full-length riboprobe (Boehringer) was generated from the apical isoform of the rat renal BSC1 cDNA15 by in vitro transcription with SP6 RNA polymerase. As control gene, a digoxigenin-UTP–labeled riboprobe was constructed from a 196 bp fragment of ß-actin cDNA by in vitro transcription with T3 RNA polymerase. Membranes were prehybridized at 60°C for 2 hours in 5x SSCP, 50% formamide, 2% SDS, 0.1% N-lauroylsarcosine, and 5% blocking reagent (Boehringer). The membranes were then hybridized at 65°C for 12 hours, using the same buffer containing 10 ng/mL of BSC1 and ß-actin probes. The membranes were washed twice for 15 minutes in 2x SSCP, 0.1% SDS at room temperature and twice during 20 minutes with 0.1x SSCP, 0.1% SDS at 65°C. Hybridization bands were detected by chemiluminescence (CDP-Star, Boehringer). Autoradiographs were scanned and the hybridization bands measured by densitometric analysis.

Semiquantitative PCR
Because TSC is not a highly abundant gene in the renal cortex, expression analysis was performed with the use of a semiquantitative PCR approach, as previously described.20 Briefly, TSC primers were custom designed (Genosys) to amplify a region that exhibits the lowest degree of identity among members of the electroneutral cotransporter family,21 corresponding to the bases 589 to 792 of the cloned rat TSC cDNA,15 yielding a 204 bp product. Oligonucleotide primer sequences were 5'AATGGCAAGGTCAAGTCGG3' and 5'GATCGGGATGTCATTGATGG3'. The primer's specificity was demonstrated by sequencing the PCR product in both directions (Sequenase Version 2.0, USB). To monitor the nonspecific effects of experimental treatment and to semiquantitate TSC expression, we coamplified a fragment of GAPDH by using primers that have been previously described22 and yield a PCR product of 515 bp. Genomic DNA contamination was checked by carrying samples through the PCR procedure without adding RT.

RT was carried out with the use of 5 µg of total RNA from each renal cortex. Before the RT reaction, RNA was heated at 65°C for 10 minutes. RT was performed at 37°C for 60 minutes in a total volume of 20 µL, with 200 U of the Moloney murine leukemia virus RT (Life Technologies), 100 pmol/L of random hexamers (Life Technologies), 0.5 mmol/L of each dNTP (Sigma), and 1x RT buffer (75 mmol/L KCl; 50 mmol/L Tris-HCl; 3 mmol/L MgCl2; 10 mmol/L DTT, pH 8.3). Samples were heated at 95°C for 5 minutes to inactivate the RT and diluted to 40 µL with PCR grade water. One tenth of the RT samples was used for PCR in 20 µL final volume reactions containing 1x PCR buffer (10 mmol/L Tris-HCl; 1.5 mmol/L MgCl2; 50 mmol/L KCl, pH 8.3); 0.1 mmol/L of each dNTP, 0.2 µCi of [{alpha}32P]-dCTP ({approx}3000 Ci/mmol, 9.25 MBq, 250 µCi, Amersham); 10 µmol/L of each primer, and 1 unit of Taq DNA polymerase (Biotecnologías Universitarias). The samples were overlaid with 30 µL of mineral oil, and PCR cycles were performed in a DNA thermal cycler (M.J. Research), with the following profile: denaturation, 1 minute at 94°C; annealing, 1 minute at 60°C; and extension, 1 minute at 72°C. The last cycle was followed by a final extension step of 5 minutes at 72°C. All reactions were performed in duplicate and within the exponential phase of the curve. Preliminary studies were performed to determine the optimum number of cycles for quantitation. From the kinetic curves we determined 18 cycles as the optimal number for both TSC and GAPDH primer pairs.20 To analyze the products, one half of each reaction was electrophoresed on a 3% low melting point agarose gel. Bands were ethidium bromide stained and visualized under UV light, cut out, and melted at 95°C in 500 µL of double-distilled water. Relative amount of amplified cDNA was then determined by liquid scintillation counting (Beckman LS6500). The amount of radioactivity recovered from the excised bands was plotted in a log scale against the number of cycles.

Statistical Analysis
Statistical significance is defined as the two-tailed value of P<.05, and the results are presented as mean±SEM. The significance of the differences was tested by one-way ANOVA with Bonferroni correction.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Rats from the six groups tolerated all treatments well. No significant differences occurred in plasma sodium, potassium, and chloride concentration as compared with the control groups (data not shown). At the end of the experiments, body weight of the control groups was similar to saline loading (300±19 g), dehydration (258±19 g), and furosemide groups (317±36 g) but lower than in high salt diet (328±25 g, P<.05) or low salt diet groups (347±24, P<.05) and higher than in the water-loaded group (228±16, P<.05). Water intake, diuresis, urinary sodium, and potassium excretion are depicted in Fig 1Down. Rats exposed to high salt diet, saline, water loading, or intraperitoneal injection of furosemide showed higher water intake and diuresis than the control group (Fig 1ADown and 1BDown). As expected, urinary sodium excretion increased in high salt diet, saline-loaded, and furosemide-treated rats and decreased markedly in low salt diet, dehydrated, and water-loaded rats (Fig 1CDown). Thus, each group showed the appropriate renal response to the modification in salt or water intake. Potassium urinary excretion increased in furosemide-treated rats (Fig 1DDown).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 1. A, Fluid intake; B, urinary volume; C, urinary sodium excretion; and D, urinary potassium excretion in control (C), high salt diet (HS), low salt diet (LS), saline-loaded (SL), dehydrated (DH), water-loaded (WL), and furosemide-treated (F) rats. Values were obtained from the 24-hour urine collection the day the animals were killed. All groups, n=6. *P<.05 vs control.

Fig 2Down shows urinary osmolarity and creatinine clearance in the studied groups. Urinary osmolarity decreased in high salt diet, saline-loaded, water-loaded, and furosemide-treated rats and increased in dehydrated rats. Because the group exposed to the low salt diet showed decreased urinary volume and sodium excretion, the urinary osmolarity of this group remained unchanged (Fig 2ADown). Thus, urinary osmolarity changes agreed with the expected response for each group. In addition, there was no significant difference in creatinine clearance in any experimental group (Fig 2BDown), demonstrating that the adaptation of each group to the experimental maneuver was due to changes in tubular sodium and/or water reabsorption and not in glomerular filtration rate.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 2. A, Urinary osmolarity and B, creatinine clearance in control (C), high salt diet (HS), low salt diet (LS), saline-loaded (SL), dehydrated (DH), water-loaded (WL), and furosemide-treated (F) rats. All groups, n=6. *P<.05 vs control.

Because BSC1 and ß-actin are 4.6 kb and 1.8 kb in size, respectively, membranes were exposed to both probes at the same time, under high stringency conditions. Thus, hybridization bands for both BSC1 and ß-actin were obtained in the same membrane. Representative examples for each studied group with their respective controls are shown in Fig 3Down. In all cases, the membranes were exposed to autoradiography for 2 to 5 minutes. It is quite apparent that in all cases hybridization bands for BSC1 and ß-actin are very similar between control and experimental groups. The ratio of BSC1 expression over the control gene ß-actin in experimental versus control animals for each group was as follows: high salt diet, 1.12±0.18 versus 1.74±0.49 (NS); low salt diet, 1.79±0.36 versus 1.75±0.48 (NS); saline loading, 1.28±0.23 versus 1.02±0.06 (NS); dehydration, 0.87±0.21 versus 0.75±0.10 (NS); water loading, 1.01±0.14 versus 1.30±0.10 (NS); and furosemide, 1.96±0.47 versus 1.52±0.31 (NS). Therefore, there was no change in BSC1 expression in any model.



View larger version (60K):
[in this window]
[in a new window]
 
Figure 3. Representative examples of Northern blot analysis of outer medulla total RNA showing hybridization bands for BSC1 and ß-actin in individual rats from control (open bars) and experimental (filled bars) groups. Each lane contains 2 µg of total RNA. Membranes were hybridized simultaneously with nonradioactive BSC1 and ß-actin probes as described in "Methods." The ratios BSC1/actin are shown in the text.

TSC expression was analyzed by semiquantitative RT-PCR performed in the presence of [{alpha}-32P]-dCTP. Products were resolved in agarose gels, and bands were cut out and counted by liquid scintillation. The ratio of TSC/GAPDH cpm for each group is shown in Fig 4Down. There was no significant change in the TSC/GAPDH ratio of the rats exposed to high salt diet, low salt diet, saline or water loading, or furosemide administration. However, in the dehydration group, a significant increase was observed that was 2.8-fold higher that its control group.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 4. Ratio of TSC/GAPDH by semiquantitative PCR analysis from renal cortex total RNA in experimental models and their respective control group. *P<.05 vs control.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The main finding of the present study is that gene expression at the mRNA level of BSC1 and TSC, present in the apical membrane of the thick ascending limb of Henle's loop and distal tubule, respectively, does not change during modification of salt and water ingestion and during 7-day administration of the loop diuretic furosemide. Only dehydrated rats exhibited an increased expression of TSC. Although 7 days is a relatively short period of time, it has been shown in most of these models that it is enough time for the kidney to develop functional and structural adaptations.3 4 6 23 24 25 26 27 In addition, Figs 1Up and 2Up show that after the 7-day period, rats from all groups were fully adapted to each maneuver, which suggests that functional and structural changes did occur.

We analyzed six different challenges to the kidney. We used two forms of sodium loading that induce an increase in renal salt excretion, one of these by giving a high sodium diet and allowing the rats to drink tap water to counterbalance salt ingestion and the other by giving NaCl in the drinking water, which prevents osmolarity compensation of the ingested sodium. The low salt diet induced a maximal sodium retaining state, with decrease in both water ingestion and urinary volume and thus with no effect in urinary osmolarity. Water loading without salt administration also induced maximal sodium retention but with an increased urinary volume, therefore producing maximal water diuresis. Dehydration activates maximal sodium and water retention, increasing urinary osmolarity and finally, furosemide treatment, which inhibit BSC1 function, resulting in increased natriuresis and diuresis. As Fig 3Up shows, although in all groups the kidneys were able to compensate the modification in water or salt ingestion, there was no change in the level of BSC1 mRNA expression compared with control rats. Therefore, variation in the amount of BSC1 gene expression at the mRNA level is not involved in long-term adaptation of the thick ascending limb of Henle's loop to changes in water or NaCl metabolism. These results are in agreement with Ecelbarger et al,6 who, using polyclonal antibodies, observed no change in the amount of BSC1 at the protein level in Sprague-Dawley dehydrated or water-loaded rats and in vasopressin-treated Brattelboro rats.

Ecelbarger et al6 observed a shift in size and increased amount of BSC1 protein in furosemide-treated rats, which occurred with similar changes in Tamm-Horsfall and aquaporin-2 water channel proteins, which suggests that these observations were secondary to nonspecific effects of the diuretic on apical membrane proteins. Our finding of no change in BSC1 mRNA levels in the outer medulla of furosemide-treated rats for 7 days argues in favor of this possibility, indicating that furosemide itself has no effect on BSC1 gene expression. On the other hand, Ecelbarger et al6 also showed an increase in BSC1 protein abundance in the renal medulla of saline-loaded rats, without similar change in Tamm-Horsfall protein, which suggests that the increased amount of BSC1 protein was due to upregulation. Because we observed no change in mRNA level of BSC1 in the outer medulla from saline-loaded rats, it is likely that the increase in BSC1 protein in this model is due to posttranscriptional modifications.

Experimental maneuvers studied by changing water and salt ingestion also represent a functional challenge to the distal tubule, in particular the high sodium diet, saline loading, and furosemide treatment, because it has been shown that increase in sodium delivery to the distal tubule results in marked hypertrophy of epithelial cells, with increase in basolateral membrane area, as well as in NaCl transport capacity and Na+-K+-ATPase activity.3 4 26 28 The number of [3H]metolazone binding sites, as an indirect assessment of thiazide receptors, has also been analyzed in these situations. An increase has been observed in furosemide-treated rats, a decrease in water-loaded rats, and no change during administration of a low or high sodium diet.23 However, as Fig 4Up shows, TSC expression at the mRNA level was not modified in any model, with the exception of dehydrated rats, which suggests that TSC is upregulated only in extreme conditions in which the distal tubular fluid is highly concentrated.

Obermuller et al27 have recently observed, by using in situ hybridization analysis, an increase in distal tubule TSC mRNA expression, together with an increase in maximum binding affinity for [3H]metolazone in furosemide-treated rats, a model in which Chen et al23 also observed an increase in [3H]metolazone binding sites, which suggests that TSC expression is upregulated. However, we found no change in BSC1 or TSC mRNA levels after 7 days of treatment. In the studies by Obermuller et al27 and Chen et al,23 although rats drank both salt and tap water ad libitum, they developed a significant decrease of 18% to 30% in total body weight. In contrast, in the present study, as well as in those by Kaissling et al26 and Scherzer et al,29 rats showed signs of furosemide effects, such as increase in urinary volume and sodium excretion and decrease in urinary osmolarity (Figs 1Up and 2Up), but they exhibited no evidence of weight lost after 7 days of treatment. It is possible that renal water loss in furosemide-treated rats from studies by Obermuller et al27 and Chen et al23 were not fully compensated by drinking water (for example, because of nausea, anorexia, or diarrhea). Thus, although rats exhibited increased urinary sodium excretion, they were actually dehydrated, the condition in which we observed increased expression of TSC at the mRNA level.

In conclusion, on the basis of our data, we believe that nephron functional and/or structural adaptation to modification in NaCl and water metabolism does not induce changes in the level of gene expression of BSC1 and TSC.


*    Selected Abbreviations and Acronyms
 
BSC1 = bumetanide-sensitive Na+-K+-2Cl-
PCR = polymerase chain reaction
RT = reverse transcription/transcriptase
TSC = thiazide-sensitive Na+-Cl- cotransporter


*    Acknowledgments
 
This work was supported by research grants No. 93–2036 (Dr Gamba) and 94–3900 (Dr Correa-Rotter) from the Mexican Council of Science and Technology (CONACYT), by the Fundación Miguel Alemán (Dr Gamba), and by scholarship grants from CONACYT (Dr Moreno) and from the Dirección General de Asuntos del Personal Académico (DGAPA), UNAM (Drs Merino and Mercardo). We are grateful to Dr Octavio Villanueva for his help with animal care and to members of the Molecular Physiology Unit for their suggestions and stimulating discussion.


*    Footnotes
 
Presented in part at the 28th Meeting of the American Society of Nephrology, San Diego, Calif, 1995, and the 12th Scientific Meeting of the Inter-American Society of Hypertension, Mexico City, 1997, and published in abstract form (J Am Soc Nephrol. 1995;6:346.).

Received October 10, 1997; first decision October 20, 1997; accepted November 4, 1997.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Knepper MA, Rector FC Jr. Urine concentration and dilution. In: Brenner BM, ed. The Kidney. Philadelphia, Pa: WB Saunders Co; 1996:532–570.

2. Kaissling B. Structural aspects of adaptive changes in renal electrolyte excretion. Am J Physiol. 1982;243:F211–F226.

3. Ellison DH, Velazquez H, Wright FS. Adaptation of the distal convoluted tubule of the rat: structural and functional effects of dietary salt intake and chronic diuretic infusion. J Clin Invest. 1989; 83:113–126.

4. Stanton BA, Kaissling B. Adaptation of distal tubule and collecting duct to increased Na delivery, II: Na+ and K+ transport. Am J Physiol. 1988;255:F1269–F1275.[Abstract/Free Full Text]

5. Kaplan MR, Plotkin MD, Lee W-S, Xu Z-C, Lytton J, Hebert SC. Apical localization of the Na-K-Cl cotransporter, rBSC1, on rat thick ascending limbs. Kidney Int. 1996;49:40–47.[Medline] [Order article via Infotrieve]

6. Ecelbarger CA, Terris J, Hoyer JR, Nielsen A, Wade JB, Knepper MA. Localization and regulation of the rat renal Na+-K+-2Cl- cotransporter, BSC1. Am J Physiol. 1996;271:F619–F628.[Abstract/Free Full Text]

7. Greger R, Schlatter E, Lang F. Evidence for electroneutral sodium chloride cotransport in the cortical thick ascending limb of Henle's loop of rabbit kidney. Pflugers Arch. 1983;396:308–314.[Medline] [Order article via Infotrieve]

8. Plotkin MD, Kaplan MR, Verlander JM, Lee W-S, Brown D, Poch E, Gullans SR, Hebert SC. Localization of the thiazide sensitive Na-Cl cotransporter, rTSC1, in the rat kidney. Kidney Int. 1996;50:174–183.[Medline] [Order article via Infotrieve]

9. Ellison DH, Velazquez H, Wright FS. Thiazide-sensitive sodium chloride cotransport in early distal tubule. Am J Physiol. 1987;253:F546–F554.[Abstract/Free Full Text]

10. Gesek FA, Friedman PA. Mechanism of calcium transport stimulated by chlorothiazide in mouse distal convoluted tubule cells. J Clin Invest. 1992; 90:429–438.

11. Simon DB, Karet FE, Hamdan JM, Di Pietro A, Sanjad SA, Lifton RP. Bartter's syndrome, hypokalaemic alkalosis with hypercalciuria, is caused by mutations in the Na-K-2Cl cotransporter NKCC2. Nat Genet. 1996;13:183–188.[Medline] [Order article via Infotrieve]

12. Simon DB, Nelson-Williams C, Johnson-Bia M, Ellison D, Karet FE, Morey-Molina A, Vaara I, Iwata F, Cushner HM, Koolen M, Gainza FJ, Gitelman HJ, Lifton RP. Gitelman's variant of Bartter's syndrome, inherited hypokalaemic alkalosis, is caused by mutations in the thiazide-sensitive Na-Cl cotransporter. Nat Genet. 1996;12:24–30.[Medline] [Order article via Infotrieve]

13. Gamba G, Saltzberg SN, Lombardi M, Miyanoshita A, Lytton J, Hediger MA, Brenner BM, Hebert SC. Primary structure and functional expression of a cDNA encoding the thiazide-sensitive, electroneutral sodium-chloride cotransporter. Proc Natl Acad Sci U S A. 1993;90:2749–2753.[Abstract/Free Full Text]

14. Xu J-C, Lytle C, Zhu TT, Payne JA, Benz E Jr, Forbush B III. Molecular cloning and functional expression of the bumetanide-sensitive Na-K-Cl cotransporter. Proc Natl Acad Sci U S A. 1994;91:2201–2205.[Abstract/Free Full Text]

15. Gamba G, Miyanoshita A, Lombardi M, Lytton J, Lee W-S, Hediger MA, Hebert SC. Molecular cloning, primary structure and characterization of two members of the mammalian electroneutral sodium-(potassium)-chloride cotransporter family expressed in kidney. J Biol Chem. 1994;296:17713–17722.

16. Igarashi P, Vanden Heuver GB, Payne JA, Forbush B III. Cloning, embryonic expression, and alternative splicing of a murine kidney-specific Na-K-Cl cotransporter. Am J Physiol. 1995;269:F406–F418.

17. Payne JA, Forbush B III. Alternatively spliced isoforms of the putative renal Na-K-Cl cotransporter are differentially distributed within the rabbit kidney. Proc Natl Acad Sci U S A. 1994;91:4544–4548.[Abstract/Free Full Text]

18. Mastroianni N, DeFusco M, Zollo M, Arrigo G, Zuffardi O, Bettinelli A, Ballabio A, Casari G. Molecular cloning, expression pattern, and chromosomal localization of the human Na-Cl thiazide-sensitive cotransporter (SLC12A3). Genomics. 1996;35:486–493.[Medline] [Order article via Infotrieve]

19. Sambrook J, Fritsch EF, Maniatis T. Extraction, purification, and analysis of messenger RNA from eukaryotic cells. In: Sambrook J, Fritsch EF, Maniatis T, eds. Molecular Cloning: A Laboratory Manual. New York, NY: Cold Spring Harbor Laboratory Press; 1989;1:7.3–7.6.

20. Bobadilla NA, Herrera JP, Merino A, Gamba G. Semi-quantitative PCR: a tool to study low abundance messages in the kidney. Arch Med Res. 1997;28:55–60.[Medline] [Order article via Infotrieve]

21. Kaplan MR, Mount DB, Delpire E, Gamba G, Hebert SC. Molecular mechanisms of NaCl cotransport. Annu Rev Physiol. 1996;58:649–668.[Medline] [Order article via Infotrieve]

22. Rocco-Neilson E, Hoyer J, Ziyadeh F. Attenuated expression of epithelial cell adhesion molecules in murine polycystic kidney disease. Am J Physiol. 1992;262:F679–F686.[Abstract/Free Full Text]

23. Chen Z, Vaughn DA, Beaumont K, Fanestil DD. Effects of diuretic treatment and of dietary sodium on renal binding of 3H-metolazone. J Am Soc Nephrol. 1990;1:91–98.[Abstract/Free Full Text]

24. Morsing P, Velazquez H, Wright FS, Ellison DH. Adaptation of distal convoluted tubule of rats, II: effects of chronic thiazide infusion. Am J Physiol. 1991;261:F137–F143.[Abstract/Free Full Text]

25. Kaissling B, Stanton BA. Adaptation of distal tubule and collecting duct to increased sodium delivery, I: ultrastructure. Am J Physiol. 1988;255:F1256–F1268.[Abstract/Free Full Text]

26. Kaissling B, Bachmann S, Kriz W. Structural adaptation of the distal convoluted tubule to prolonged furosemide treatment. Am J Physiol. 1985;248:F374–F381.[Abstract/Free Full Text]

27. Obermuller N, Bernstein P, Velázquez H, Reilly R, Moser D, Ellison DH, Bachman S. Expression of the thiazide-sensitive Na-Cl cotransporter in rat and human kidney. Am J Physiol. 1995;269:F900–F910.[Abstract/Free Full Text]

28. Kaissling B, Hir ML. Distal tubular segments of the rabbit kidney after adaptation to altered Na- and K-intake, I: structural changes. Cell Tissue Res. 1982;224:469–492.[Medline] [Order article via Infotrieve]

29. Scherzer P, Wald H, Popovtzer MM. Enhanced glomerular filtration and Na+-K+-ATPase with furosemide administration. Am J Physiol. 1987;252:F910–F915.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Physiol. Rev.Home page
G. Gamba
Molecular Physiology and Pathophysiology of Electroneutral Cation-Chloride Cotransporters
Physiol Rev, April 1, 2005; 85(2): 423 - 493.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
L. Wang, R. L. Tiniakov, and D. B. Yeates
Peripheral opioidergic regulation of the tracheobronchial mucociliary transport system
J Appl Physiol, June 1, 2003; 94(6): 2375 - 2383.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Loffing and B. Kaissling
Sodium and calcium transport pathways along the mammalian distal nephron: from rabbit to human
Am J Physiol Renal Physiol, April 1, 2003; 284(4): F628 - F643.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Nielsen, T.-H. Kwon, S. Masilamani, K. Beutler, H. Hager, S. Nielsen, and M. A. Knepper
Sodium transporter abundance profiling in kidney: effect of spironolactone
Am J Physiol Renal Physiol, November 1, 2002; 283(5): F923 - F933.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
J. G. ABDALLAH, R. W. SCHRIER, C. EDELSTEIN, S. D. JENNINGS, B. WYSE, and D. H. ELLISON
Loop Diuretic Infusion Increases Thiazide-Sensitive Na+/Cl--Cotransporter Abundance: Role of Aldosterone
J. Am. Soc. Nephrol., July 1, 2001; 12(7): 1335 - 1341.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
R. F. Reilly and D. H. Ellison
Mammalian Distal Tubule: Physiology, Pathophysiology, and Molecular Anatomy
Physiol Rev, January 1, 2000; 80(1): 277 - 313.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
D. D. Fanestil, D. A. Vaughn, R. H. Hyde, and P. Blakely
Genetic control of renal thiazide receptor response to dietary NaCl and hypertension
Am J Physiol Regulatory Integrative Comp Physiol, March 1, 1999; 276(3): R901 - R904.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moreno, G.
Right arrow Articles by Gamba, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moreno, G.
Right arrow Articles by Gamba, G.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*SODIUM CHLORIDE