From the Molecular Physiology Unit, Department of Nephrology and Mineral
Metabolism, Instituto Nacional de la Nutrición Salvador Zubirán
and Instituto de Investigaciones Biomédicas, Universidad Nacional
Autónoma de México (G.M., A. Merino, A. Mercado, J.P.H.,
J.G.-S., R.C.-R., G.G.); and the Division of Nephrology, Department of
Medicine, Vanderbilt University Medical Center, Nashville, Tenn (S.C.H.).
Correspondence to Gerardo Gamba, MD, PhD, Molecular Physiology Unit, Department of Nephrology and Mineral Metabolism, Instituto Nacional de la Nutrición Salvador Zubirán, Instituto de Investigaciones Biomédicas, UNAM, Vasco de Quiroga No. 15, Tlalpan 14000, Mexico City, México. E-mail gamba{at}mailer.main.conacyt.mx
Several studies have shown that changes in electrolyte and water
metabolism during periods from 5 to 14 days induce
functional and structural adaptation of the thick ascending limb and
distal tubule in order to keep the internal milieu unchanged. The
adaptation goes from increased reabsorption capacity to structural
changes such as tubular hypertrophy, increase in
basolateral membrane area and in size and number of mitochondria, and
an increase in basolateral
Na+-K+-ATPase
activity.1 2 3 4 To date, however, little is known
about molecular mechanisms of adaptation in these nephron segments.
Electroneutral sodium chloridecoupled cotransporters are good
candidates to be involved in the adaptation of the loop of Henle and
distal tubule to modifications in sodium and water ingestion. BSC1 is
expressed in the apical membrane of the thick ascending limb of
Henle's loop,5 6 where it is one of the targets
of vasopressin and is responsible for Na+
reabsorption,7 whereas TSC is expressed in the
apical membrane of the distal tubule,8 where it
is the major pathway for NaCl transport9 and is
also involved in calcium reabsorption.10 BSC1 and
TSC also serve as the furosemide or thiazide receptors, respectively,
which are among the most common drugs used in the treatment of
hypertension and sodium-retaining states. Their role in the long-term
regulation of salt metabolism and arterial
pressure has recently gained more attention as they have been shown to
be part of the genes working on a common pathway that regulates salt
reabsorption in the kidney. Point mutations of BSC1 or TSC cosegregate
with the development of Bartter's or Gitelman's syndromes,
respectively,11 12 conditions associated with
reduced blood pressure, by diminishing renal salt reabsorption. Major
advances have been made in the past few years in the molecular
identification of the electroneutral sodium chloridecoupled
cotransporters. cDNA encoding BSC1 or TSC has been isolated from
several species,11 12 13 14 15 16 17 18 providing new tools to
investigate their role in the regulation of ion transport and nephron
adaptation to changes in sodium and water ingestion.
The objective of the present work was to study BSC1 and TSC
mRNA expression in rat kidney after modifications of NaCl and water
metabolism by changing the amount of NaCl or water
ingestion or by administering furosemide during a 7-day period.
Experimental Procedures
Northern Blot Analysis
A digoxigenin-UTPlabeled full-length riboprobe (Boehringer)
was generated from the apical isoform of the rat renal BSC1
cDNA15 by in vitro transcription with SP6 RNA
polymerase. As control gene, a digoxigenin-UTPlabeled riboprobe was
constructed from a 196 bp fragment of ß-actin cDNA by in vitro
transcription with T3 RNA polymerase. Membranes were prehybridized at
60°C for 2 hours in 5x SSCP, 50% formamide, 2% SDS, 0.1%
N-lauroylsarcosine, and 5% blocking reagent
(Boehringer). The membranes were then hybridized at 65°C for
12 hours, using the same buffer containing 10 ng/mL of BSC1 and
ß-actin probes. The membranes were washed twice for 15 minutes in 2x
SSCP, 0.1% SDS at room temperature and twice during 20 minutes with
0.1x SSCP, 0.1% SDS at 65°C. Hybridization bands were detected by
chemiluminescence (CDP-Star, Boehringer). Autoradiographs were
scanned and the hybridization bands measured by densitometric
analysis.
Semiquantitative PCR
RT was carried out with the use of 5 µg of total RNA from each renal
cortex. Before the RT reaction, RNA was heated at 65°C for 10
minutes. RT was performed at 37°C for 60 minutes in a total volume of
20 µL, with 200 U of the Moloney murine leukemia virus RT (Life
Technologies), 100 pmol/L of random hexamers (Life Technologies),
0.5 mmol/L of each dNTP (Sigma), and 1x RT buffer (75 mmol/L
KCl; 50 mmol/L Tris-HCl; 3 mmol/L
MgCl2; 10 mmol/L DTT, pH 8.3). Samples were
heated at 95°C for 5 minutes to inactivate the RT and
diluted to 40 µL with PCR grade water. One tenth of the RT samples
was used for PCR in 20 µL final volume reactions containing 1x PCR
buffer (10 mmol/L Tris-HCl; 1.5 mmol/L
MgCl2; 50 mmol/L KCl, pH 8.3); 0.1
mmol/L of each dNTP, 0.2 µCi of [
Statistical Analysis
Fig 2
Because BSC1 and ß-actin are 4.6 kb and 1.8 kb in size, respectively,
membranes were exposed to both probes at the same time, under high
stringency conditions. Thus, hybridization bands for both BSC1 and
ß-actin were obtained in the same membrane.
Representative examples for each studied group with
their respective controls are shown in Fig 3
TSC expression was analyzed by semiquantitative RT-PCR
performed in the presence of [
We analyzed six different challenges to the kidney. We used two
forms of sodium loading that induce an increase in renal salt
excretion, one of these by giving a high sodium diet and allowing the
rats to drink tap water to counterbalance salt ingestion and the other
by giving NaCl in the drinking water, which prevents osmolarity
compensation of the ingested sodium. The low salt diet induced a
maximal sodium retaining state, with decrease in both water ingestion
and urinary volume and thus with no effect in urinary osmolarity. Water
loading without salt administration also induced maximal sodium
retention but with an increased urinary volume, therefore producing
maximal water diuresis. Dehydration activates maximal
sodium and water retention, increasing urinary osmolarity and finally,
furosemide treatment, which inhibit BSC1 function, resulting in
increased natriuresis and diuresis. As Fig 3
Ecelbarger et al6 observed a shift in size
and increased amount of BSC1 protein in furosemide-treated rats, which
occurred with similar changes in Tamm-Horsfall and aquaporin-2 water
channel proteins, which suggests that these observations were secondary
to nonspecific effects of the diuretic on apical membrane
proteins. Our finding of no change in BSC1 mRNA levels in the outer
medulla of furosemide-treated rats for 7 days argues in favor of this
possibility, indicating that furosemide itself has no effect on BSC1
gene expression. On the other hand, Ecelbarger et
al6 also showed an increase in BSC1 protein
abundance in the renal medulla of saline-loaded rats, without similar
change in Tamm-Horsfall protein, which suggests that the increased
amount of BSC1 protein was due to upregulation. Because we observed no
change in mRNA level of BSC1 in the outer medulla from saline-loaded
rats, it is likely that the increase in BSC1 protein in this model is
due to posttranscriptional modifications.
Experimental maneuvers studied by changing water and salt ingestion
also represent a functional challenge to the distal tubule, in
particular the high sodium diet, saline loading, and furosemide
treatment, because it has been shown that increase in sodium delivery
to the distal tubule results in marked hypertrophy of
epithelial cells, with increase in basolateral membrane area, as well
as in NaCl transport capacity and
Na+-K+-ATPase
activity.3 4 26 28 The number of
[3H]metolazone binding sites, as an indirect
assessment of thiazide receptors, has also been analyzed in
these situations. An increase has been observed in furosemide-treated
rats, a decrease in water-loaded rats, and no change during
administration of a low or high sodium diet.23
However, as Fig 4
Obermuller et al27 have recently observed,
by using in situ hybridization analysis, an increase in distal
tubule TSC mRNA expression, together with an increase in maximum
binding affinity for [3H]metolazone in
furosemide-treated rats, a model in which Chen et
al23 also observed an increase in
[3H]metolazone binding sites, which suggests
that TSC expression is upregulated. However, we found no change in BSC1
or TSC mRNA levels after 7 days of treatment. In the studies by
Obermuller et al27 and Chen et
al,23 although rats drank both salt and tap water
ad libitum, they developed a significant decrease of 18% to 30% in
total body weight. In contrast, in the present study, as well as in
those by Kaissling et al26 and Scherzer et
al,29 rats showed signs of furosemide effects,
such as increase in urinary volume and sodium excretion and decrease in
urinary osmolarity (Figs 1
In conclusion, on the basis of our data, we believe that nephron
functional and/or structural adaptation to modification in NaCl and
water metabolism does not induce changes in the level of
gene expression of BSC1 and TSC.
Received October 10, 1997;
first decision October 20, 1997;
accepted November 4, 1997.
2.
Kaissling B. Structural aspects of adaptive changes in
renal electrolyte excretion. Am J Physiol. 1982;243:F211F226.
3.
Ellison DH, Velazquez H, Wright FS. Adaptation of the
distal convoluted tubule of the rat: structural and functional effects
of dietary salt intake and chronic diuretic infusion.
J Clin Invest. 1989; 83:113126.
4.
Stanton BA, Kaissling B. Adaptation of distal tubule
and collecting duct to increased Na delivery, II: Na+ and K+ transport.
Am J Physiol. 1988;255:F1269F1275.
5.
Kaplan MR, Plotkin MD, Lee W-S, Xu Z-C, Lytton J,
Hebert SC. Apical localization of the Na-K-Cl cotransporter, rBSC1, on
rat thick ascending limbs. Kidney Int. 1996;49:4047.[Medline]
[Order article via Infotrieve]
6.
Ecelbarger CA, Terris J, Hoyer JR, Nielsen A, Wade JB,
Knepper MA. Localization and regulation of the rat renal
Na+-K+-2Cl-
cotransporter, BSC1. Am J Physiol. 1996;271:F619F628.
7.
Greger R, Schlatter E, Lang F. Evidence for
electroneutral sodium chloride cotransport in the cortical thick
ascending limb of Henle's loop of rabbit kidney. Pflugers
Arch. 1983;396:308314.[Medline]
[Order article via Infotrieve]
8.
Plotkin MD, Kaplan MR, Verlander JM, Lee W-S, Brown D,
Poch E, Gullans SR, Hebert SC. Localization of the thiazide sensitive
Na-Cl cotransporter, rTSC1, in the rat kidney. Kidney Int. 1996;50:174183.[Medline]
[Order article via Infotrieve]
9.
Ellison DH, Velazquez H, Wright FS. Thiazide-sensitive
sodium chloride cotransport in early distal tubule. Am J
Physiol. 1987;253:F546F554.
10.
Gesek FA, Friedman PA. Mechanism of calcium transport
stimulated by chlorothiazide in mouse distal convoluted
tubule cells. J Clin Invest. 1992; 90:429438.
11.
Simon DB, Karet FE, Hamdan JM, Di Pietro A, Sanjad SA,
Lifton RP. Bartter's syndrome, hypokalaemic alkalosis with
hypercalciuria, is caused by mutations in the Na-K-2Cl cotransporter
NKCC2. Nat Genet. 1996;13:183188.[Medline]
[Order article via Infotrieve]
12.
Simon DB, Nelson-Williams C, Johnson-Bia M, Ellison D,
Karet FE, Morey-Molina A, Vaara I, Iwata F, Cushner HM, Koolen M,
Gainza FJ, Gitelman HJ, Lifton RP. Gitelman's variant of Bartter's
syndrome, inherited hypokalaemic alkalosis, is caused by mutations in
the thiazide-sensitive Na-Cl cotransporter. Nat Genet. 1996;12:2430.[Medline]
[Order article via Infotrieve]
13.
Gamba G, Saltzberg SN, Lombardi M, Miyanoshita A,
Lytton J, Hediger MA, Brenner BM, Hebert SC. Primary structure and
functional expression of a cDNA encoding the thiazide-sensitive,
electroneutral sodium-chloride cotransporter. Proc Natl Acad Sci
U S A. 1993;90:27492753.
14.
Xu J-C, Lytle C, Zhu TT, Payne JA, Benz E Jr, Forbush B
III. Molecular cloning and functional expression of the
bumetanide-sensitive Na-K-Cl cotransporter. Proc Natl Acad Sci
U S A. 1994;91:22012205.
15.
Gamba G, Miyanoshita A, Lombardi M, Lytton J, Lee
W-S, Hediger MA, Hebert SC. Molecular cloning, primary structure and
characterization of two members of the mammalian electroneutral
sodium-(potassium)-chloride cotransporter family expressed in kidney.
J Biol Chem. 1994;296:1771317722.
16.
Igarashi P, Vanden Heuver GB, Payne JA, Forbush B III.
Cloning, embryonic expression, and alternative splicing of a murine
kidney-specific Na-K-Cl cotransporter. Am J Physiol. 1995;269:F406F418.
17.
Payne JA, Forbush B III. Alternatively spliced isoforms
of the putative renal Na-K-Cl cotransporter are differentially
distributed within the rabbit kidney. Proc Natl Acad Sci
U S A. 1994;91:45444548.
18.
Mastroianni N, DeFusco M, Zollo M, Arrigo G, Zuffardi
O, Bettinelli A, Ballabio A, Casari G. Molecular cloning, expression
pattern, and chromosomal localization of the human Na-Cl
thiazide-sensitive cotransporter (SLC12A3). Genomics. 1996;35:486493.[Medline]
[Order article via Infotrieve]
19.
Sambrook J, Fritsch EF, Maniatis T. Extraction,
purification, and analysis of messenger RNA from
eukaryotic cells. In: Sambrook J, Fritsch EF, Maniatis T,
eds. Molecular Cloning: A Laboratory Manual. New York, NY:
Cold Spring Harbor Laboratory Press; 1989;1:7.37.6.
20.
Bobadilla NA, Herrera JP, Merino A, Gamba G.
Semi-quantitative PCR: a tool to study low abundance messages in the
kidney. Arch Med Res. 1997;28:5560.[Medline]
[Order article via Infotrieve]
21.
Kaplan MR, Mount DB, Delpire E, Gamba G, Hebert SC.
Molecular mechanisms of NaCl cotransport. Annu Rev Physiol. 1996;58:649668.[Medline]
[Order article via Infotrieve]
22.
Rocco-Neilson E, Hoyer J, Ziyadeh F. Attenuated
expression of epithelial cell adhesion molecules in murine polycystic
kidney disease. Am J Physiol. 1992;262:F679F686.
23.
Chen Z, Vaughn DA, Beaumont K, Fanestil DD. Effects of
diuretic treatment and of dietary sodium on renal binding of
3H-metolazone. J Am Soc Nephrol. 1990;1:9198.
24.
Morsing P, Velazquez H, Wright FS, Ellison DH.
Adaptation of distal convoluted tubule of rats, II: effects of chronic
thiazide infusion. Am J Physiol. 1991;261:F137F143.
25.
Kaissling B, Stanton BA. Adaptation of distal tubule
and collecting duct to increased sodium delivery, I: ultrastructure.
Am J Physiol. 1988;255:F1256F1268.
26.
Kaissling B, Bachmann S, Kriz W. Structural adaptation
of the distal convoluted tubule to prolonged furosemide treatment.
Am J Physiol. 1985;248:F374F381.
27.
Obermuller N, Bernstein P, Velázquez H, Reilly R,
Moser D, Ellison DH, Bachman S. Expression of the thiazide-sensitive
Na-Cl cotransporter in rat and human kidney. Am J
Physiol. 1995;269:F900F910.
28.
Kaissling B, Hir ML. Distal tubular segments of the
rabbit kidney after adaptation to altered Na- and K-intake, I:
structural changes. Cell Tissue Res. 1982;224:469492.[Medline]
[Order article via Infotrieve]
29.
Scherzer P, Wald H, Popovtzer MM. Enhanced
glomerular filtration and Na+-K+-ATPase with furosemide
administration. Am J Physiol. 1987;252:F910F915.
© 1998 American Heart Association, Inc.
Scientific Contributions
Electroneutral Na-Coupled Cotransporter Expression in the Kidney During Variations of NaCl and Water Metabolism
![]()
Abstract
Top
Abstract
Introduction
Methods
Results
Discussion
References
AbstractThe purpose of the
present study was to analyze the long-term regulation of
renal bumetanide-sensitive
Na+-K+-2Cl- cotransporter and
thiazide-sensitive Na+-Cl- cotransporter gene
expression during changes in NaCl and water metabolism.
Male Wistar rats exposed to high or low NaCl intake, saline loading,
dehydration, water loading, and furosemide administration during 7 days
were studied. Control groups had access to regular food and tap water.
Rats were kept in metabolic cages for 4 days before and
during the experiment to determine daily urinary electrolyte excretion
and osmolarity. At the end of the experiment, creatinine
clearance and serum electrolyte levels were also measured. Kidneys were
excised and macroscopically subdivided into cortex and outer and inner
medulla. Total RNA was extracted from each individual cortex or outer
medulla by use of the guanidine/cesium chloride method. The
Na+-K+-2Cl- cotransporter
expression in outer medulla total RNA was assessed by nonradioactive
Northern blot analysis and the Na+-Cl-
cotransporter expression in renal cortex total RNA was assessed by
semiquantitative polymerase chain reaction. Experimental maneuvers were
adequately tolerated, and all groups developed the appropriate renal
response to each challenge. However, the level of expression of both
cotransporters did not change in any model, except for a 2.8-fold
increase in the Na+-Cl- cotransporter
expression during dehydration. We conclude that nephron adaptation to
7-day modifications in NaCl and water metabolism does not
include changes in the amount of electroneutral sodium-coupled
cotransporter gene expression at the mRNA level.
Key Words: bumetanide thiazide gene expression ion transport
![]()
Introduction
Top
Abstract
Introduction
Methods
Results
Discussion
References
The loop of
Henle reabsorbs
20% of the glomerular filtrate and
plays a key role in the production and maintenance of
renal medullary hypertonicity, providing the kidney with the ability to
form urine that can be more diluted or concentrated than plasma, a
functional capacity that is essential for survival of mammals that live
on land, including human beings. The distal nephron, the segments
beyond macula densa, reabsorbs
10% of the filtrate and secretes
potassium under the modulating influence of hormones, including
aldosterone and vasopressin. Therefore, the loop of Henle
and the distal nephron together are responsible for the fine control of
renal sodium and water excretion and urine osmolarity.
![]()
Methods
Top
Abstract
Introduction
Methods
Results
Discussion
References
Rats
Male Wistar rats weighing 200 to 300 g, inbred in our
animal facility, were used for the study. All rats were kept in
metabolic cages (Nalgene) at the animal facility with
light/dark cycles of 12/12 hours at constant temperature and humidity
of 20°C and 65%, respectively, during 4 days before and during the
experimental period. Urine that was spontaneously voided during every
24 hours was collected in the metabolic cage, with light
mineral oil in the urine collector to determine daily urinary
electrolyte excretion and osmolarity. At the end of the experiment,
serum and urine electrolytes were measured with a NOVA4 electrolyte
analyzer (NOVA Biomedical), serum and urine
creatinine with an autoanalyzer (Beckman
Instruments), and osmolarity with a digimatic osmometer model 3D2
(Advanced Instruments Inc). Renal creatinine clearances
were calculated by the standard formula C=U · V/P, were U is the
concentration in urine, V is urine flow rate, and P is plasma
concentration. Our institutional animal care committee approved the
experimental protocol.
Six groups of animals were studied over a 7-day period. Group 1
was given high NaCl intake. Animals were allowed to 20 g/d of high NaCl
chow (2.92% NaCl chow, AIN-76-modified, ICN Biochemicals) with free
access to tap water. Group 2 was given low NaCl intake. Animals in this
group received 20 g/d of low NaCl chow (0.029% NaCl chow,
AIN-76-modified, ICN Biochemicals) and had ad libitum access to tap
water. Group 3 was given saline loading. Rats were fed with 20 g/d of
regular rat chow but they drank exclusively NaCl water (0.16 mol/L).
Group 4 was the dehydration group. Rats had free access to food with
limited access to 10 mL of tap water per day. This group was studied
for only 4 days. Group 5 was given water loading. Animals had no access
to food and drank exclusively 10% glucose water. Group 6 was given
furosemide. Rats received a daily intraperitoneal
injection of furosemide (10 mg/100 g of body wt in saline solution, pH
8.0) and were allowed 20 g/d of regular chow with free access to a high
salt drinking fluid (8 g/L of NaCl and 1 g/L of KCl). The control
animals for groups 1 to 5 consisted of rats that were
simultaneously carried through all procedures and allowed
to eat 20 g/d of regular chow diet and ad libitum access to tap water.
As a control for the furosemide group, we used rats that were treated
with intraperitoneal injection of saline solution
at pH 8.0 and were allowed to eat 20 g/d of regular chow with free
access to tap water.
At the end of each experiment, rats were killed and the kidneys
were macroscopically subdivided into cortex and outer and inner
medulla. Total RNA was extracted from each renal cortex or outer
medulla by use of the guanidine/cesium chloride
method.19 The RNA was dissolved in sterile
DEPC-treated water, and RNA concentration was determined by absorbance
reading at 260 nm (DU 640, Beckman). Because BSC is a highly abundant
gene in the renal outer medulla, the analysis was performed by
Northern blot, with a nonradioactive method. Aliquots of 2.0 µg of
total RNA from each outer medulla sample were separated by 1%
agarose/formaldehyde gel electrophoresis and transferred to a nylon
membrane (Duralon UV, Stratagene). RNA was fixed to the nylon membrane
by UV cross-linking (Stratalinker, Stratagene).
Because TSC is not a highly abundant gene in the renal cortex,
expression analysis was performed with the use of a
semiquantitative PCR approach, as previously
described.20 Briefly, TSC primers were custom
designed (Genosys) to amplify a region that exhibits the lowest degree
of identity among members of the electroneutral cotransporter
family,21 corresponding to the bases 589 to 792
of the cloned rat TSC cDNA,15 yielding a 204 bp
product. Oligonucleotide primer sequences were
5'AATGGCAAGGTCAAGTCGG3' and 5'GATCGGGATGTCATTGATGG3'. The primer's
specificity was demonstrated by sequencing the PCR product in both
directions (Sequenase Version 2.0, USB). To monitor the nonspecific
effects of experimental treatment and to semiquantitate TSC expression,
we coamplified a fragment of GAPDH by using primers that have been
previously described22 and yield a PCR
product of 515 bp. Genomic DNA contamination was checked by
carrying samples through the PCR procedure without adding RT.
32P]-dCTP
(
3000 Ci/mmol, 9.25 MBq, 250 µCi, Amersham); 10 µmol/L of
each primer, and 1 unit of Taq DNA polymerase
(Biotecnologías Universitarias). The samples were overlaid with
30 µL of mineral oil, and PCR cycles were performed in a DNA thermal
cycler (M.J. Research), with the following profile: denaturation, 1
minute at 94°C; annealing, 1 minute at 60°C; and extension, 1
minute at 72°C. The last cycle was followed by a final extension step
of 5 minutes at 72°C. All reactions were performed in duplicate and
within the exponential phase of the curve. Preliminary studies
were performed to determine the optimum number of cycles for
quantitation. From the kinetic curves we determined 18 cycles as the
optimal number for both TSC and GAPDH primer
pairs.20 To analyze the products, one
half of each reaction was electrophoresed on a 3% low melting point
agarose gel. Bands were ethidium bromide stained and visualized under
UV light, cut out, and melted at 95°C in 500 µL of double-distilled
water. Relative amount of amplified cDNA was then determined by liquid
scintillation counting (Beckman LS6500). The amount of radioactivity
recovered from the excised bands was plotted in a log scale against the
number of cycles.
Statistical significance is defined as the two-tailed
value of P<.05, and the results are presented as
mean±SEM. The significance of the differences was tested by one-way
ANOVA with Bonferroni correction.
![]()
Results
Top
Abstract
Introduction
Methods
Results
Discussion
References
Rats from the six groups tolerated all treatments well. No
significant differences occurred in plasma sodium, potassium, and
chloride concentration as compared with the control groups (data not
shown). At the end of the experiments, body weight of the control
groups was similar to saline loading (300±19 g), dehydration (258±19
g), and furosemide groups (317±36 g) but lower than in high salt diet
(328±25 g, P<.05) or low salt diet groups (347±24,
P<.05) and higher than in the water-loaded group (228±16,
P<.05). Water intake, diuresis, urinary sodium, and
potassium excretion are depicted in Fig 1
. Rats exposed to high salt diet,
saline, water loading, or intraperitoneal injection
of furosemide showed higher water intake and diuresis than the
control group (Fig 1A
and 1B
). As expected, urinary sodium excretion
increased in high salt diet, saline-loaded, and furosemide-treated rats
and decreased markedly in low salt diet, dehydrated, and water-loaded
rats (Fig 1C
). Thus, each group showed the appropriate renal response
to the modification in salt or water intake. Potassium urinary
excretion increased in furosemide-treated rats (Fig 1D
).

View larger version (32K):
[in a new window]
Figure 1. A, Fluid intake; B, urinary volume; C, urinary
sodium excretion; and D, urinary potassium excretion in control (C),
high salt diet (HS), low salt diet (LS), saline-loaded (SL), dehydrated
(DH), water-loaded (WL), and furosemide-treated (F) rats. Values were
obtained from the 24-hour urine collection the day the animals were
killed. All groups, n=6. *P<.05 vs control.
shows urinary osmolarity and
creatinine clearance in the studied groups. Urinary
osmolarity decreased in high salt diet, saline-loaded, water-loaded,
and furosemide-treated rats and increased in dehydrated rats. Because
the group exposed to the low salt diet showed decreased urinary volume
and sodium excretion, the urinary osmolarity of this group remained
unchanged (Fig 2A
). Thus, urinary osmolarity changes agreed with the
expected response for each group. In addition, there was no significant
difference in creatinine clearance in any experimental
group (Fig 2B
), demonstrating that the adaptation of each group to the
experimental maneuver was due to changes in tubular sodium and/or water
reabsorption and not in glomerular filtration rate.

View larger version (33K):
[in a new window]
Figure 2. A, Urinary osmolarity and B,
creatinine clearance in control (C), high salt diet (HS),
low salt diet (LS), saline-loaded (SL), dehydrated (DH), water-loaded
(WL), and furosemide-treated (F) rats. All groups, n=6.
*P<.05 vs control.
. In all cases, the membranes were
exposed to autoradiography for 2 to 5 minutes. It is
quite apparent that in all cases hybridization bands for BSC1 and
ß-actin are very similar between control and experimental groups. The
ratio of BSC1 expression over the control gene ß-actin in
experimental versus control animals for each group was as follows: high
salt diet, 1.12±0.18 versus 1.74±0.49 (NS); low salt diet, 1.79±0.36
versus 1.75±0.48 (NS); saline loading, 1.28±0.23 versus 1.02±0.06
(NS); dehydration, 0.87±0.21 versus 0.75±0.10 (NS); water loading,
1.01±0.14 versus 1.30±0.10 (NS); and furosemide, 1.96±0.47 versus
1.52±0.31 (NS). Therefore, there was no change in BSC1 expression in
any model.

View larger version (60K):
[in a new window]
Figure 3. Representative examples of
Northern blot analysis of outer medulla total RNA showing
hybridization bands for BSC1 and ß-actin in individual rats from
control (open bars) and experimental (filled bars) groups. Each lane
contains 2 µg of total RNA. Membranes were hybridized
simultaneously with nonradioactive BSC1 and ß-actin
probes as described in "Methods." The ratios BSC1/actin are shown
in the text.
-32P]-dCTP.
Products were resolved in agarose gels, and bands were cut out and
counted by liquid scintillation. The ratio of TSC/GAPDH cpm for each
group is shown in Fig 4
. There was no
significant change in the TSC/GAPDH ratio of the rats exposed to high
salt diet, low salt diet, saline or water loading, or furosemide
administration. However, in the dehydration group, a significant
increase was observed that was 2.8-fold higher that its control
group.

View larger version (31K):
[in a new window]
Figure 4. Ratio of TSC/GAPDH by semiquantitative PCR
analysis from renal cortex total RNA in experimental models and
their respective control group. *P<.05 vs
control.
![]()
Discussion
Top
Abstract
Introduction
Methods
Results
Discussion
References
The main finding of the present study is that gene expression
at the mRNA level of BSC1 and TSC, present in the apical membrane
of the thick ascending limb of Henle's loop and distal tubule,
respectively, does not change during modification of salt and water
ingestion and during 7-day administration of the loop diuretic
furosemide. Only dehydrated rats exhibited an increased expression of
TSC. Although 7 days is a relatively short period of time, it has been
shown in most of these models that it is enough time for the kidney to
develop functional and structural
adaptations.3 4 6 23 24 25 26 27 In addition, Figs 1
and 2
show that after the 7-day period, rats from all groups were fully
adapted to each maneuver, which suggests that functional and structural
changes did occur.
shows, although in
all groups the kidneys were able to compensate the modification in
water or salt ingestion, there was no change in the level of BSC1 mRNA
expression compared with control rats. Therefore, variation in the
amount of BSC1 gene expression at the mRNA level is not involved in
long-term adaptation of the thick ascending limb of Henle's loop to
changes in water or NaCl metabolism. These results are in
agreement with Ecelbarger et al,6 who, using
polyclonal antibodies, observed no change in the amount of BSC1 at the
protein level in Sprague-Dawley dehydrated or water-loaded rats and in
vasopressin-treated Brattelboro rats.
shows, TSC expression at the mRNA level was not
modified in any model, with the exception of dehydrated rats, which
suggests that TSC is upregulated only in extreme conditions in which
the distal tubular fluid is highly concentrated.
and 2
), but they exhibited no evidence of
weight lost after 7 days of treatment. It is possible that renal water
loss in furosemide-treated rats from studies by Obermuller et
al27 and Chen et al23 were
not fully compensated by drinking water (for example, because of
nausea, anorexia, or diarrhea). Thus, although rats exhibited increased
urinary sodium excretion, they were actually dehydrated, the condition
in which we observed increased expression of TSC at the mRNA level.
![]()
Selected Abbreviations and Acronyms
BSC1
=
bumetanide-sensitive Na+-K+-2Cl-
PCR
=
polymerase chain reaction
RT
=
reverse transcription/transcriptase
TSC
=
thiazide-sensitive Na+-Cl- cotransporter
![]()
Acknowledgments
This work was supported by research grants No. 932036 (Dr
Gamba) and 943900 (Dr Correa-Rotter) from the Mexican Council of
Science and Technology (CONACYT), by the Fundación Miguel
Alemán (Dr Gamba), and by scholarship grants from CONACYT (Dr
Moreno) and from the Dirección General de Asuntos del Personal
Académico (DGAPA), UNAM (Drs Merino and Mercardo). We are
grateful to Dr Octavio Villanueva for his help with animal care and to
members of the Molecular Physiology Unit for their suggestions and
stimulating discussion.
![]()
Footnotes
Presented in part at the 28th Meeting of the American Society of Nephrology, San Diego, Calif, 1995, and the 12th Scientific Meeting of the Inter-American Society of Hypertension, Mexico City, 1997, and published in abstract form (J Am Soc Nephrol. 1995;6:346.).
![]()
References
Top
Abstract
Introduction
Methods
Results
Discussion
References
1.
Knepper MA, Rector FC Jr. Urine concentration and
dilution. In: Brenner BM, ed. The Kidney. Philadelphia, Pa:
WB Saunders Co; 1996:532570.
This article has been cited by other articles:
![]() |
K. Sanchez-Pozos, F. Lee-Montiel, R. Perez-Villalva, N. Uribe, G. Gamba, B. Bazan-Perkins, and N. A. Bobadilla Polymerized type I collagen reduces chronic cyclosporine nephrotoxicity Nephrol. Dial. Transplant., February 5, 2010; (2010) gfq020v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gamba Molecular Physiology and Pathophysiology of Electroneutral Cation-Chloride Cotransporters Physiol Rev, April 1, 2005; 85(2): 423 - 493. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wang, R. L. Tiniakov, and D. B. Yeates Peripheral opioidergic regulation of the tracheobronchial mucociliary transport system J Appl Physiol, June 1, 2003; 94(6): 2375 - 2383. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Loffing and B. Kaissling Sodium and calcium transport pathways along the mammalian distal nephron: from rabbit to human Am J Physiol Renal Physiol, April 1, 2003; 284(4): F628 - F643. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Nielsen, T.-H. Kwon, S. Masilamani, K. Beutler, H. Hager, S. Nielsen, and M. A. Knepper Sodium transporter abundance profiling in kidney: effect of spironolactone Am J Physiol Renal Physiol, November 1, 2002; 283(5): F923 - F933. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. ABDALLAH, R. W. SCHRIER, C. EDELSTEIN, S. D. JENNINGS, B. WYSE, and D. H. ELLISON Loop Diuretic Infusion Increases Thiazide-Sensitive Na+/Cl--Cotransporter Abundance: Role of Aldosterone J. Am. Soc. Nephrol., July 1, 2001; 12(7): 1335 - 1341. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. F. Reilly and D. H. Ellison Mammalian Distal Tubule: Physiology, Pathophysiology, and Molecular Anatomy Physiol Rev, January 1, 2000; 80(1): 277 - 313. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Fanestil, D. A. Vaughn, R. H. Hyde, and P. Blakely Genetic control of renal thiazide receptor response to dietary NaCl and hypertension Am J Physiol Regulatory Integrative Comp Physiol, March 1, 1999; 276(3): R901 - R904. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Hypertension Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1998 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |