Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 1998;31:1118-1124

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Melander, O.
Right arrow Articles by Hulthén, U. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Melander, O.
Right arrow Articles by Hulthén, U. L.
Right arrowPubmed/NCBI databases
Medline Plus Health Information
*High Blood Pressure

(Hypertension. 1998;31:1118-1124.)
© 1998 American Heart Association, Inc.


Scientific Contributions

Mutations and Variants of the Epithelial Sodium Channel Gene in Liddle's Syndrome and Primary Hypertension

Olle Melander; Marju Orho; Johan Fagerudd; Kristina Bengtsson; Per-Henrik Groop; Ingrid Mattiasson; Leif Groop; ; U. Lennart Hulthén

From the Departments of Endocrinology (O.M., M.O., L.G., U.L.H.) and Medicine (I.M.), Lund University, Malmö, Sweden; Helsinki University Hospital (J.F., P.-H.G.), Helsinki, Finland; and Primary Health Care Centre in Skara (K.B.), Skara, Sweden.

Correspondence to Dr Olle Melander, Department of Endocrinology, Malmö University Hospital MAS, S-205 02 Malmö, Sweden. E-mail olle.melander{at}endo.mas.lu.se


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—Liddle's syndrome is a rare monogenic form of hypertension caused by truncating or missense mutations in the C termini of the epithelial sodium channel ß- or {gamma}-subunits. These mutations delete or alter a conserved proline-rich amino acid sequence referred to as the PY-motif. We report here a Liddle's syndrome family with a ßArg564X mutation with a premature stop codon deleting the PY-motif of the ß-subunit. This family shows marked phenotypic variation in blood pressure, serum potassium levels, and age of onset of hypertension. Given the similarity with primary hypertension, changes in the C termini of the ß- or {gamma}-subunits may contribute to the development of primary hypertension or to hypertension associated with diabetic nephropathy. Accordingly, the coding sequences for the cytoplasmic C termini of the ß- and {gamma}-subunits were screened for mutations with the use of polymerase chain reaction, single-strand conformation polymorphism, and direct DNA sequencing in 105 subjects with primary hypertension and 70 subjects with diabetic nephropathy. One frequent polymorphism was identified, but its frequency did not differ among subjects with primary hypertension, subjects with diabetic nephropathy, or control subjects. Two of the 175 subjects with primary hypertension or diabetic nephropathy showed variants that were not present in 186 control subjects. None of the variants changed the PY-motif sequence. In conclusion, a ßArg564X mutation is the likely cause of Liddle's syndrome in this Swedish family, but it is unlikely that mutations in the ß- and {gamma}-subunit genes of the epithelial sodium channel play a significant role in the pathogenesis of primary hypertension or diabetic nephropathy.


Key Words: Liddle's syndrome • sodium channels • genetics • hypertension, primary • nephropathy


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Although PHT is considered to be a multifactorial and polygenic disease,1 three rare forms of monogenic hypertension have been described at the molecular genetic level during the past years.2 3 4 5 6 7 They are all coupled to salt handling in the distal tubules of the kidney. Liddle's syndrome is characterized by autosomal dominant inheritance and early onset of hypokalemic hypertension with low PRA and low aldosterone levels.8 The use of triamterene and amiloride in combination with a low salt diet corrects the disorder, whereas antagonists of the mineralocorticoid receptor have no effect.8 9 Liddle's syndrome has been shown to be caused by mutations in the amiloride-sensitive ENaC in eight kindreds.4 5 6 7 The channel is composed of three subunits: {alpha} ({alpha}ENaC), ß (ßENaC), and {gamma} ({gamma}ENaC).10 11 Each subunit has a similar structure: the N- and C-terminal parts are located in the cytoplasm with two transmembrane spanning domains and a large extracellular loop.12 13 14 In most kindreds, the disease-causing mutations introduce premature stop codons or frameshift mutations in the C-terminal parts of the ßENaC or {gamma}ENaC genes and thereby delete the last 45 to 76 amino acids.5 6 However, single amino acid mutations in the cytoplasmic C terminus of the ßENaC gene were identified in two kindreds.4 7 All mutations reported in Liddle's syndrome delete or alter a conserved proline-rich amino acid sequence4 5 6 7 referred to as the PY-motif.15 16 Expression studies of the mutations in Xenopus laevis oocytes have shown that these mutations increase transmembranic sodium transport.4 5 7 15 16 17 18

We identified a family in southern Sweden (family S) in which three subjects presented with the clinical and biochemical features of Liddle's syndrome. To confirm the diagnosis of Liddle's syndrome at the molecular genetic level, we performed linkage analysis with a polymorphic marker tightly linked with both the ßENaC and {gamma}ENaC genes on chromosome 165 and carried out mutation screening of the C-terminal parts of the ßENaC and {gamma}ENaC genes using the SSCP technique and direct DNA sequencing. Six individuals of this family had a mutation in the ßENaC gene. These individuals showed heterogeneity regarding hypokalemia and age of onset of hypertension, which is in accordance with previous studies.6 7 19 We therefore postulated that patients with PHT may show genetic defects in the ßENaC or {gamma}ENaC genes. Furthermore, inherited PHT has been proposed to be a strong risk factor for the development of DN in IDDM.20 21 Accordingly, patients with DN may show clustering of genetic defects causing hypertension. To test these hypotheses, the C-terminal parts of the ßENaC and {gamma}ENaC genes were screened for mutations in a cohort of patients with PHT and in a cohort of patients with DN and compared with findings in healthy control subjects.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Subjects
The pedigree with Liddle's syndrome is shown in Fig 1Down. Two sisters (subjects 7 and 9) presented with hypertension, hypokalemia, low PRA, and low levels of urinary aldosterone at the ages of 20 and 30 years, respectively. They both responded well to amiloride and salt restriction. After >20 years of observation, they had not developed any hypertensive complications. The son of subject 7 (subject 12) was recently diagnosed with hypertension and had low serum potassium levels, low PRA, and low levels of urinary aldosterone. These three subjects were considered to have Liddle's syndrome. Subject 1, the father of subjects 7 and 9, was diagnosed with PHT at the age of 46 years and died at the age of 68 years from cancer. Their mother (subject 2) was diagnosed with PHT at the age of 60 years. Her blood pressure has been well controlled with a low dose of bendroflumethiazide. No other members of the family had hypertension. Subjects were evaluated at the Department of Endocrinology, Malmö University Hospital. Patient data from the time of diagnosis of the patients with clinically evident Liddle's syndrome were obtained from their physicians.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 1. Pedigree with Liddle's syndrome showing subjects who carried the Liddle mutation, ßArg564X ({bullet} and {blacksquare}); subjects with PHT ({square} with +); normotensive subjects without the ßArg564X mutation ({circ} and {square}); and subjects with unknown blood pressure status (?). Deceased members of the family are indicated with diagonal lines. The numbers under the symbols indicate (a) study subject number, (b) year of birth, (c) age at diagnosis of hypertension, (d) systolic and diastolic blood pressure (mm Hg), (e) potassium concentration in serum (reference value, 3.5 to 5.0 mmol/L) and tU-Aldo (reference value, 5.0 to 16 nmol/24 h) ({dagger}) or 5.0 to 20 µg/24 h ({ddagger}), (f) PRA (reference value, 0.34 to 1.7 µg/L per hour) (§) or 50 to 200 ng/100 mL per 3 hours (||), and (g) genotypes of marker ßENaCGT-1. -, Unavailable or nonexistent data. *Patient data are from the time of diagnosis of Liddle's syndrome.

Mutation screening of the C-terminal parts of the ßENaC and {gamma}ENaC genes and an association study with a common new polymorphism in the {gamma}ENaC gene were performed in 105 unrelated subjects with PHT from Sweden and in 70 subjects with DN (20 subjects with IDDM and manifest DN and 50 subjects with NIDDM and manifest or incipient DN) from Finland. In addition, 106 unrelated healthy control subjects from Sweden with blood pressure of <160/85 mm Hg and no medication and 80 unrelated healthy control subjects from Finland with blood pressure of <160/85 mm Hg, an AER of <10 µg/min, and no medication were studied as control subjects. All the subjects classified as having PHT were on antihypertensive medication and had three or more blood pressure measurements at different times of >160/90 mm Hg before the onset of treatment. Secondary hypertension was excluded. Manifest DN was defined as diabetes (NIDDM or IDDM) in combination with an AER of >200 µg/min in overnight urine collections or with dialysis or transplantation. Incipient DN was defined as diabetes and an AER of 20 to 200 µg/min. Of the DN subjects, 81% were taking antihypertensive medication. Two of the DN subjects were treated with dialysis and had high serum potassium levels (5.8 and 6.0 mmol/L). The clinical characteristics of the study subjects are shown in Table 1Down.


View this table:
[in this window]
[in a new window]
 
Table 1. Clinical Features of Study Subjects

Subjects with PHT and DN who were discovered to have variants in ßENaC or {gamma}ENaC genes leading to amino acid substitutions were asked to contact their family members regarding screening for the particular variant.

Venous blood samples were collected, and total genomic DNA was prepared according to standard methods.22 The study was reviewed and approved by the Ethics Committee of the Medical Faculty of Lund University, and all study participants gave written informed consent. Procedures were followed in accordance with institutional guidelines.

Linkage Analysis
A polymorphic marker, ßENaCGT-16, which is tightly linked with both the ßENaC and {gamma}ENaC genes,5 was used to test linkage in family S. For PCR, 100 ng genomic DNA was amplified in a total volume of 15 µL containing 3 pmol 5'-end {gamma}-32P-ATP–labeled (Amersham Sweden AB) primer ßENaCGT-A6, 3 pmol unlabeled ßENaCGT-B6, 2 nmol dNTPs, and 0.7 U Taq polymerase (Perkin-Elmer) in 1x (NH4)2SO4 buffer consisting of 16 mmol/L (NH4)2SO4, 67 mmol/L Tris, pH 8.8, and 0.01% Tween; 1.5 mmol/L MgCl2; and 1.5% formamide. PCR was performed with an initial denaturation at 94°C for 5 minutes followed by 30 cycles of denaturation (94°C for 30 seconds), annealing (61°C for 30 seconds), and extension (72°C for 30 seconds), with the final extension at 72°C for 10 minutes. Genotypes were analyzed through electrophoresis on a 5% denaturing polyacrylamide gel followed by autoradiography.

Mutation Screening
Gene segments coding for the C termini of the ßENaC and {gamma}ENaC subunits were amplified using primer pair ßENaC1746/ßENaC19406 for the ßENaC segment and primer pairs {gamma}ENaC-1/{gamma}ENaC-2 and {gamma}ENaC-3/{gamma}ENaC-45 for the {gamma}ENaC segment. PCR was performed with 100 ng genomic DNA in a total volume of 20 µL containing 10 pmol of each primer, 2 nmol dNTPs, and 0.5 U Taq polymerase (Perkin-Elmer) in 1x (NH4)2SO4 buffer for the ßENaC1746/ßENaC1940 fragment and in 1x PCR buffer for Taq polymerase (10 mmol/L Tris · HCl, pH 8.3, 50 mmol/L KCl, 1.5 mmol/L MgCl2, 0.001% gelatin) (Perkin-Elmer) for the {gamma}ENaC-1/{gamma}ENaC-2 and {gamma}ENaC-3/{gamma}ENaC-4 fragments. Reactions were performed with 1.5% formamide, 0.05 µL [{alpha}-32P]dCTP (3000 Ci/mmol) (Amersham Sweden AB), and 1.5 mmol/L MgCl2 for fragments ßENaC1746/ßENaC1940 and {gamma}ENaC-3/{gamma}ENaC-4 and 3.0 mmol/L MgCl2 for fragment {gamma}ENaC-1/{gamma}ENaC-2. PCR conditions consisted of initial denaturation at 94°C for 5 minutes, followed by 30 cycles of denaturation (94°C for 30 seconds), annealing (67°C for 30 seconds for fragment ßENaC1746/ßENaC1940 and 63°C for 30 seconds for fragments {gamma}ENaC-1/{gamma}ENaC-2 and {gamma}ENaC-3/{gamma}ENaC-4), and extension (72°C for 30 seconds), with the final extension at 72°C for 10 minutes. Reactions were diluted 1:1 with 95% formamide buffer, denatured for 5 minutes at 90°C, cooled, and electrophoresed on glycerol-free (35 W for 3.5 hours at 4°C) and 5% glycerol (8 W for 11 hours at room temperature), nondenaturing 5% polyacrylamide gels (acrylamide/bisacrylamide 49:1). When differences in band pattern were observed, the PCR products were sequenced bidirectionally with the ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer).

RFLP
To confirm the variants ({gamma}Asn531Lys, {gamma}Cys582Arg [substitution of cysteine to arginine at codon 582 in the {gamma}-subunit of ENaC], and ßGly587Ser) and to simplify their detection, RFLP methods were created. For detection of the {gamma}Asn531Lys variant, PCR was performed with primers {gamma}ENaC-2 and {gamma}ENaC-531Lys (5'-TTGCA GATTGAGATGCTTCTGGTCAA), which contains two nucleotide mismatches (underlined) to create a HincII recognition site in case of a nonmutated sequence. A nonradioactive PCR was carried out as described above for the {gamma}ENaC-1/{gamma}ENaC-2 fragment with the exception that the annealing temperature was 61°C. PCR products were digested with 1 U HincII (Promega) for 3 hours in 37°C with the buffer recommended by the manufacturer. For detection of the {gamma}Cys582Arg variant, a nonradioactive PCR was carried out as described above for the {gamma}ENaC-3/{gamma}ENaC-4 fragment. PCR products were digested with 1 U Nla III (New England Biolabs) for 3 hours in 37°C with the buffer recommended by the manufacturer. For detection of the ßGly587Ser variant, a nonradioactive PCR was carried out as described above for the ßENaC1746/ßENaC1940 fragment. PCR products were digested with 2 U Alu I (Amersham Sweden AB) for 3 hours in 37°C with the buffer recommended by the manufacturer. The fragments were separated on 3% agarose gel with ethidium bromide and visualized under ultraviolet light.

Association Study
Because only parts of the ßENaC and {gamma}ENaC genes were screened for mutations, an association study was performed to investigate whether other genetic defects in these genes might contribute to the development of PHT or DN.

The study subjects were genotyped for the {gamma}650 polymorphism (see "Results") with radioactive PCR SSCP using primers {gamma}ENaC-3 and {gamma}ENaC-45. The frequency distribution of the different genotypes, CC contra CG/GG (the CG and GG genotypes were pooled because the GG genotype was rare), were compared between the Swedish PHT subjects and the Swedish control subjects and between the Finnish DN subjects and the Finnish control subjects. Furthermore, systolic and diastolic blood pressures, potassium levels in serum, and AER (AER only in the Finnish DN subjects and control subjects) were related to the CC and CG/GG genotypes in the Swedish PHT subjects and control subjects and in the Finnish DN subjects and control subjects.

Laboratory Chemistry
Potassium concentration in serum and the AER were measured according to standard chemical methods. The tU-Aldo was measured for subjects 7 and 9 with the Double Isotope Derivative Assay of Aldosterone23 and for subjects 12, 13, and 15 with an Aldosterone II RIA Diagnostic Kit (Abbott Laboratories). PRA was measured with subjects in the supine position according to Boucher's biological method24 in subjects 7 and 9, whereas it was measured with an RIA Diagnostic Kit25 (Abbott Laboratories) in subjects 12, 13, and 15. Earlier methods of measuring tU-Aldo and PRA were used when subjects 7 and 9 were diagnosed (in 1969 and 1972, respectively).

Statistical Analysis
Clinical data are expressed as mean±SD. Differences in noncontinuous variables were tested with the use of {chi}2 analysis, and differences in continuous variables were tested with the use of Student's t test, with a BMDP statistical package (Biomedical Data Processing, Version 1.1). Because the AER was not normally distributed, a logarithmic transformation was used when calculating the P value for differences between groups for AER. A value of P<.05 was considered statistically significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Linkage Analysis and Mutation Screening of Family S
Genotypes of the marker ßENaCGT-1 in family S are shown in Fig 1Up. The three subjects with the clinical characteristics of Liddle's syndrome (subjects 7, 9, and 12) inherited allele 4. In addition, allele 4 was inherited by subject 2, who had hypertension, and by subjects 13 and 15, who were relatively young. These findings were compatible with linkage of allele 4 of marker ßENaCGT-1 to Liddle's syndrome. In all the subjects with allele 4, a different SSCP variant was identified in the ßENaC fragment. DNA sequencing revealed a CGA->TGA mutation in codon 564 (ßArg564X [substitution of arginine to a stop codon at codon 564 in the ß-subunit of ENaC]) of the ßENaC gene (Figs 2Down and 3Down). This mutation introduces a stop codon instead of an arginine and thereby deletes the last 75 amino acids of the ßENaC subunit, so only 10 amino acids of the cytoplasmic C terminus remain. The same mutation has been described earlier in two related kindreds, one of which was Liddle's original kindred.6 The fact that subject 2, who transmitted the mutation to the offspring, had a rather mild form of normokalemic hypertension demonstrates large phenotypic variation among subjects with the ßArg564X mutation.



View larger version (54K):
[in this window]
[in a new window]
 
Figure 2. Sequence of the Liddle's syndrome mutation, ßArg564X, and variants in subjects with PHT and DN. Sequence of the sense strand is shown. *Mutated nucleotide. 1, Control sequence (A) and ßArg564X (CGA->TGA) nonsense mutation (B). 2, Control sequence (A) and ßGly587Ser (GGC->AGC) variant (B). 3, Control sequence (A) and {gamma}Asn531Lys (AAC->AAA) variant (B). 4, Control sequence (A) and {gamma}Cys582Arg (TGT->CGT) variant (B). 5, Control sequence (A) and {gamma}594–595 proline insertion (CCT) (B). 6, Control sequence (A) and {gamma}650 polymorphism (C/G) (B).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 3. Human genomic DNA sequence of the C-terminal parts of the ßENaC and {gamma}ENaC genes5 6 and location of the PY-motifs15 16 and the sequence variations. The intron-exon borders are indicated by arrows. Nucleotides identical in the corresponding position of the rat ßENaC/{gamma}ENaC cDNA are indicated with capital letters, whereas those differing are indicated with lowercase letters.5 6 The predicted amino acid sequence is shown below the DNA sequence. Amino acids that are different in the rat ßENaC/{gamma}ENaC5 6 subunits are shown below the human sequence. The parts corresponding to the second transmembrane spanning domains are underlined. Codon numbers are indicated at the end of each line. The PY-motifs (codons 614 to 621 in the ßENaC gene and codons 624 to 631 in the {gamma}ENaC gene); ßArg564X, ßGly587Ser, {gamma}Asn531Lys, {gamma}Cys582Arg, and {gamma}594–595 proline insertion variants; and {gamma}650 polymorphisms are framed.

Mutation Screening in Patients With PHT and DN
In the mutation screening of the C-terminal parts of the ßENaC- and {gamma}ENaC genes in 105 subjects with PHT and 70 subjects with DN, a total of five variant forms were detected. Three of them were rare variants leading to amino acid substitutions, one was a rare 3-bp insertion, and one was a common polymorphism. No new typical Liddle's syndrome mutations, such as mutations deleting or altering the PY-motif, were found.

Patients With PHT
One subject with PHT had a GGC->AGC variant in codon 587 of the ßENaC gene leading to a substitution of glycine for serine (ßGly587Ser) (Figs 2Up and 3Up). None of the 186 control subjects had this variant. The subject with the ßGly587Ser variant was diagnosed with PHT at the age of 30 years, and his serum potassium level was normal. Both his mother and father have hypertension. We were able to obtain DNA only from the mother, who did not carry the variant.

Patients With DN
One subject with DN had two variants in the {gamma}ENaC gene. An AAC->AAA variant in codon 531 of the {gamma}ENaC gene changed asparagine to lysine ({gamma}Asn531Lys), and a TGT->CGT variant in codon 582 changed cysteine to arginine ({gamma}Cys582Arg) (Figs 2Up and 3Up). None of the 186 control subjects had either of these two variants. The carrier of the two variants was diagnosed with DN at the age of 31 years after having had diabetes for 17 years, and she is presently receiving antihypertensive treatment. Her serum potassium level was normal. DNA was obtained from her hypertensive father and from her normotensive older brother, neither of whom carried the variants. Her mother died from cancer at the age of 64 years, and it is not known whether she had hypertension. In addition, a 3-bp insertion (CCT) leading to the addition of an extra proline between codons 594 and 595 ({gamma}594–595 proline insertion) (Figs 2Up and 3Up) was found in one subject with DN. This insertion was also found in one of the control subjects.

Association Study
A CTC->CTG polymorphism in codon 650 ({gamma}650 polymorphism) was detected, located just before the stop codon of the {gamma}ENaC gene (Figs 2Up and 3Up). The {gamma}650 polymorphism was found to be common in the population and was tested for association with PHT and DN. The GG genotype was rare (one in the Swedish cohort and three in the Finnish cohort) and therefore was pooled with the CG genotype. There were no differences in the genotype frequencies between genders in the Swedish or Finnish cohort. The genotype frequencies did not differ between the Swedish subjects with PHT (CC, 65.7%; CG/GG, 34.3%) and the Swedish control subjects (CC, 66.0%; CG/GG, 34.0%; P=.96) or between the Finnish subjects with DN (CC, 62.9%; CG/GG, 37.1%) and the Finnish control subjects (CC, 63.8%; CG/GG, 36.3%; P=.91). There were no significant differences between the CC and CG/GG genotypes with respect to systolic and diastolic blood pressures, potassium levels in serum, or AER (AER only in the Finnish DN and control groups) in the PHT, DN, and control groups (Tables 2Down and 3Down). Adjustment of systolic and diastolic blood pressures for BMI did not change the result.


View this table:
[in this window]
[in a new window]
 
Table 2. Clinical Features of Swedish Patients With PHT and Control Subjects With Different Genotypes of the {gamma}650 Polymorphism


View this table:
[in this window]
[in a new window]
 
Table 3. Clinical Features of Finnish Patients With DN and Control Subjects With Different Genotypes of the {gamma}650 Polymorphism


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
We report a Swedish family with Liddle's syndrome in whom the affected members have a CGA->TGA mutation in codon 564 of the ßENaC gene (ßArg564X). This mutation introduces a stop codon and truncates most of the cytoplasmic C terminus of the ßENaC subunit. We also identified one variant in a subject with PHT (ßGly587Ser) and two simultaneous variants in a subject with DN ({gamma}Asn531Lys/{gamma}Cys582Arg), none of which were present in 186 control subjects. Furthermore, we found one variant in a subject with DN ({gamma}594–595 proline insertion), which was also present in a control subject. Finally, we identified a new polymorphism in the {gamma}ENaC gene ({gamma}650 polymorphism), which was not associated with PHT or DN.

Because the ßArg564X mutation truncates most of the cytoplasmic C terminus of the ßENaC subunit, the important amino acid sequence PPPXYXXL (codon 614 to 621), the so-called PY-motif,15 16 is absent (Figs 2Up and 3Up). It is believed that the PY-motif is essential for interaction with cytoskeletal proteins, endocytosis of the channel, or both.15 16 26 All the mutations described in patients with Liddle's syndrome either delete or disrupt the PY-motif or change certain amino acids in it.4 5 6 7 The mutated subunits, ßENaC or {gamma}ENaC, expressed together with the wild-type {alpha}ENaC and ßENaC or {gamma}ENaC subunits in X laevis oocytes, lead to increased sodium transport across the plasma membrane compared with expression of the wild-type {alpha}ß{gamma}ENaC.4 5 7 15 16 17 18 The increased sodium transport was shown to result from increased open probability and increased surface expression of the channel,15 17 18 which therefore is the likely cause of the increased renal sodium reabsorption in subjects with Liddle's syndrome.4 5 6 7 15 16 17 18 Family S is the first reported Scandinavian family with Liddle's syndrome with an identified molecular defect in the ENaC gene. The ßArg564X mutation has earlier been described in two US kindreds, one of which was the original Liddle kindred.6 The mutation in those two kindreds most likely derived from the same ancestor.6 This raises the question of whether the ßArg564X mutation in family S has arisen de novo or is the consequence of an ancestral mutation. Another important finding was that the penetrance of the phenotype can vary markedly within the same family, which has also been observed in other Liddle kindreds.6 7 19 Subject 2, who introduced the ßArg564X mutation into family S, did not become hypertensive until the age of 60 years, and she has never been hypokalemic. In contrast, subjects 7, 9, and 12 were diagnosed with hypokalemic hypertension at the ages of 20, 30, and 18 years, respectively. Subjects 13 and 15 were normotensive and normokalemic at the ages of 14 and 25 years, respectively (Fig 1Up). This phenotypic heterogeneity prompted us to test the hypothesis that mutations in the ßENaC or {gamma}ENaC isoforms contribute to the development of PHT or DN. We chose to screen patients with DN because inherited hypertension has been ascribed as having an important role in the development of the disease.20 21 No new mutations deleting, disrupting, or altering the PY-motif sequence were found in the 105 subjects with PHT or the 70 subjects with DN. This argues against the hypothesis that a large subset of patients diagnosed with PHT or DN have typical Liddle's syndrome mutations in the ENaC gene. However, four new rare variants (three amino acid substitutions and one 3-bp insertion) and one common polymorphism were detected (ßGly587Ser, {gamma}Asn531Lys, {gamma}Cys582Arg, {gamma}594–595 proline insertion, and {gamma}650 polymorphism) (Figs 2Up and 3Up). The ßGly587Ser variant (occurring in one subject with PHT) and the {gamma}Asn531Lys/{gamma}Cys582Arg variants (occurring simultaneously in one subject with DN) were not found in 186 healthy control subjects. The {gamma}594–595 proline insertion variant was found in one subject with DN but also in one of the control subjects. Unfortunately, we could not obtain sufficient family information to define whether these variants segregated with the disease in these families. However, a role of minor functional importance for the ßGly587Ser and the {gamma}Asn531Lys/{gamma}Cys582Arg variants cannot be excluded because these amino acid substitutions theoretically could influence regulatory mechanisms other than the PY-motif or influence the PY-motif indirectly (Fig 3Up).

Because only parts of the ßENaC and {gamma}ENaC genes were screened for mutations, an association study was performed to investigate whether these genes are associated with PHT or DN. The {gamma}650 polymorphism is located just before the stop codon in the last exon of the {gamma}ENaC gene (Figs 2Up and 3Up). Because the ßENaC and {gamma}ENaC genes are completely linked,5 a disease causing mutation in either of the two genes could show an association between the disease and the {gamma}650 polymorphism. However, no association was found between PHT or DN and the {gamma}650 polymorphism in our Scandinavian study populations. There also were no significant differences detected in blood pressure, potassium levels, or AER between the different genotype carriers in any of the groups (Tables 2Up and 3Up). This argues against a role for the ßENaC and {gamma}ENaC genes in the development of these two disorders. In accordance with our findings, no association or linkage of hypertension to the ßENaC/{gamma}ENaC locus has been found in humans or in rat models of PHT.27 28 29 30

We conclude that the ßArg564X mutation, which deletes the PY-motif of the ßENaC gene, causes Liddle's syndrome with large phenotypic variation in this Swedish family. Although Liddle's syndrome can clinically mimic PHT, our findings indicate that it is a rare disease and that it is unlikely that mutations in the ßENaC or {gamma}ENaC genes play any significant role in the pathogenesis of PHT or DN.


*    Selected Abbreviations and Acronyms
 
AER = albumin excretion rate
BMI = body mass index
DN = diabetic nephropathy
ENaC = epithelial sodium channel
IDDM = insulin-dependent diabetes mellitus
NIDDM = non–insulin-dependent diabetes mellitus
PCR = polymerase chain reaction
PHT = primary hypertension
PRA = plasma renin activity
RFLP = restriction fragment length polymorphism
SSCP = single-strand conformation polymorphism
tU-Aldo = 24-hour urinary excretion of aldosterone


*    Acknowledgments
 
This study was supported by grants from the Swedish Medical Research Council, Swedish Heart and Lung Foundation, Medical Faculty of Lund University, Malmö University Hospital, Påhlsson Research Foundation, Skaraborg Institute, Skaraborg County Council, Finnish Medical Society, and Perklén Foundation.

Received July 21, 1997; first decision September 29, 1997; accepted December 18, 1997.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 

  1. Lifton RP, Jeunemaitre X. Finding genes that cause human hypertension. J Hypertens.. 1993;11:231–236.[Medline] [Order article via Infotrieve]
  2. Lifton RP, Dluhy RG, Powers M, Rich GM, Cook S, Ulick S, Lalouel JM. A chimaeric 11 beta-hydroxylase/aldosterone synthase gene causes glucocorticoid-remediable aldosteronism and human hypertension. Nature.. 1992;355:262–265.[Medline] [Order article via Infotrieve]
  3. Mune T, Rogerson FM, Nikkila H, Agarwal AK, White PC. Human hypertension caused by mutations in the kidney isozyme of 11 beta-hydroxysteroid dehydrogenase. Nat Genet.. 1995;10:394–399.[Medline] [Order article via Infotrieve]
  4. Hansson JH, Schild L, Lu Y, Wilson TA, Gautschi I, Shimkets R, Nelson Williams C, Rossier BC, Lifton RP. A de novo missense mutation of the beta subunit of the epithelial sodium channel causes hypertension and Liddle syndrome, identifying a proline-rich segment critical for regulation of channel activity. Proc Natl Acad Sci U S A.. 1995;92:11495–11499.[Abstract/Free Full Text]
  5. Hansson JH, Nelson Williams C, Suzuki H, Schild L, Shimkets R, Lu Y, Canessa C, Iwasaki T, Rossier B, Lifton RP. Hypertension caused by a truncated epithelial sodium channel gamma subunit: genetic heterogeneity of Liddle syndrome. Nat Genet.. 1995;1:76–82.
  6. Shimkets RA, Warnock DG, Bositi, CM, Nelson Williams C, Hansson JH, Schambelan M, Gill JR Jr, Ulick S, Milora RV, Findling JW, Canessa CN, Rossier BC, Lifton RP. Liddle's syndrome: heritable human hypertension caused by mutations in the beta subunit of the epithelial sodium channel. Cell.. 1994;79:407–414.[Medline] [Order article via Infotrieve]
  7. Tamura H, Schild L, Enomoto N, Matsui N, Marumo F, Rossier BC. Liddle disease caused by a missense mutation of beta subunit of the epithelial sodium channel gene. J Clin Invest.. 1996;97:1780–1784.[Medline] [Order article via Infotrieve]
  8. Liddle GW, Bledsoe T, Coppage WS. A familial renal disorder simulating primary aldosteronism but with negligible aldosterone secretion. Trans Am Assoc Phys.. 1963;76:199–213.
  9. Botero Velez M, Curtis JJ, Warnock DG. Brief report: Liddle's syndrome revisited: a disorder of sodium reabsorption in the distal tubule. N Engl J Med.. 1994;330:178–181.[Free Full Text]
  10. Canessa CM, Horisberger JD, Rossier BC. Epithelial sodium channel related to proteins involved in neurodegeneration. Nature.. 1993;361:467–470.[Medline] [Order article via Infotrieve]
  11. Canessa CM, Schild L, Buell G, Thorens B, Gautschi I, Horisberger JD, Rossier BC. Amiloride-sensitive epithelial Na+ channel is made of three homologous subunits. Nature.. 1994;367:463–467.[Medline] [Order article via Infotrieve]
  12. Snyder PM, McDonald FJ, Stokes JB, Welsh MJ. Membrane topology of the amiloride-sensitive epithelial sodium channel. J Biol Chem.. 1994;269:24379–24383.[Abstract/Free Full Text]
  13. Renard S, Lingueglia E, Voilley N, Lazdunski M, Barbry P. Biochemical analysis of the membrane topology of the amiloride-sensitive Na+ channel. J Biol Chem.. 1994;269:12981–12986.[Abstract/Free Full Text]
  14. Canessa CM, Merillat AM, Rossier BC. Membrane topology of the epithelial sodium channel in intact cells. Am J Physiol.. 1994;267:C1682–C1690.[Abstract/Free Full Text]
  15. Snyder PM, Price MP, McDonald FJ, Adams CM, Volk KA, Zeiher BG, Stokes JB, Welsh MJ. Mechanism by which Liddle's syndrome mutations increase activity of a human epithelial Na+ channel. Cell.. 1995;83:969–978.[Medline] [Order article via Infotrieve]
  16. Schild L, Lu Y, Gautschi I, Schneeberger E, Lifton RP, Rossier BC. Identification of a PY motif in the epithelial Na channel subunits as a target sequence for mutations causing channel activation found in Liddle syndrome. EMBO J.. 1996;15:2381–2387.[Medline] [Order article via Infotrieve]
  17. Schild L, Canessa CM, Shimkets RA, Gautschi I, Lifton RP, Rossier BC. A mutation in the epithelial sodium channel causing Liddle disease increases channel activity in the Xenopus laevis oocyte expression system. Proc Natl Acad Sci U S A.. 1995;92:5699–5703.[Abstract/Free Full Text]
  18. Firsov D, Schild L, Gautschi I, Mérillat AM, Schneeberger E, Rossier BC. Cell surface expression of the epithelial Na channel and a mutant causing Liddle's syndrome: a quantitative approach. Proc Natl Acad Sci U S A.. 1996;93:15370–15375.[Abstract/Free Full Text]
  19. Findling JW, Raff H, Hansson JH, Lifton RP. Liddle's syndrome: prospective genetic screening and suppressed aldosterone secretion in an extended kindred. J Clin Endocrinol Metab. 1997;82:1071–1074.[Abstract/Free Full Text]
  20. Viberti GC, Keen H, Wiseman MJ. Raised arterial pressure in parents of proteinuric insulin dependent diabetics. BMJ.. 1987;295:515–517.
  21. Krolewski AS, Canessa M, Warram JH, Laffel LM, Christlieb AR, Knowler WC, Rand LI. Predisposition to hypertension and susceptibility to renal disease in insulin-dependent diabetes mellitus. N Engl J Med.. 1988;318:140–145.[Abstract]
  22. Vandenplas S, Wiid I, Grobler Rabie A, Brebner K, Ricketts M, Wallis G, Bester A, Boyd C, Mathew C. Blot hybridisation analysis of genomic DNA. J Med Genet.. 1984;21:164–172.[Abstract]
  23. Kliman B, Peterson RE. Double isotope derivative assay of aldosterone in biological extracts. J Biol Chem.. 1960;235:1639–1648.[Free Full Text]
  24. Boucher R, Veyrat R, Champlain J, Genest J. New procedures for measurement of human plasma angiotensin and renin activity levels. Can Med Assoc J.. 1964;90:194–201.
  25. Ikeda I, Iinuma K, Takai M, Yanagawa Y, Kurata K, Ogihara T, Kumahara Y. Measurement of plasma renin activity by a simple solid phase radioimmunoassay. J Clin Endocrinol Metab.. 1982;54:423–428.[Abstract]
  26. Staub O, Dho S, Henry P, Correa J, Ishikawa T, McGlade J, Rotin D. WW domains of Nedd4 bind to the proline-rich PY motifs in the epithelial Na+ channel deleted in Liddle's syndrome. EMBO J.. 1996;15:2371–2380.[Medline] [Order article via Infotrieve]
  27. Su YR, Rutkowski MP, Klanke CA, Wu X, Cui Y, Pun RY, Carter V, Reif M, Menon AG. A novel variant of the beta-subunit of the amiloride-sensitive sodium channel in African Americans. J Am Soc Nephrol.. 1996;7:2543–2549.[Abstract]
  28. Chang H, Fujita T. Lack of mutations in epithelial sodium channel beta-subunit gene in human subjects with hypertension. J Hypertens.. 1996;14:1417–1419.[Medline] [Order article via Infotrieve]
  29. Kreutz R, Struk B, Rubattu S, Hübner N, Szpirer J, Szpirer C, Ganten D, Lindpaintner K. Role of the {alpha}-, ß-, and {gamma}-subunits of epithelial sodium channel in a model of polygenic hypertension. Hypertension.. 1997;29:131–136.[Abstract/Free Full Text]
  30. Grunder S, Zagato L, Yagil C, Yagil Y, Sassard J, Rossier BC. Polymorphisms in the carboxy-terminus of the epithelial sodium channel in rat models for hypertension. J Hypertens.. 1997;15:173–178.[Medline] [Order article via Infotrieve]



This article has been cited by other articles:


Home page
ANN INTERN MEDHome page
S. Oparil, M. A. Zaman, and D. A. Calhoun
Pathogenesis of Hypertension
Ann Intern Med, November 4, 2003; 139(9): 761 - 776.
[Full Text] [PDF]


Home page
Endocr. Rev.Home page
P. M. Snyder
The Epithelial Na+ Channel: Cell Surface Insertion and Retrieval in Na+ Homeostasis and Hypertension
Endocr. Rev., April 1, 2002; 23(2): 258 - 275.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. A. Volk, P. M. Snyder, and J. B. Stokes
Regulation of Epithelial Sodium Channel Activity through a Region of the Carboxyl Terminus of the alpha -Subunit. EVIDENCE FOR INTRACELLULAR KINASE-MEDIATED REACTIONS
J. Biol. Chem., November 16, 2001; 276(47): 43887 - 43893.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
N. Iwai, S. Baba, T. Mannami, T. Katsuya, J. Higaki, T. Ogihara, and J. Ogata
Association of Sodium Channel {gamma}-Subunit Promoter Variant With Blood Pressure
Hypertension, July 1, 2001; 38(1): 86 - 89.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
Z. NAGY, A. BUSJAHN, S. BÄHRING, H.-D. FAULHABER, H.-R. GOHLKE, H. KNOBLAUCH, M. ROSENTHAL, B. MÜLLER-MYHSOK, H. SCHUSTER, and F. C. LUFT
Quantitative Trait Loci for Blood Pressure Exist Near the IGF-1, the Liddle Syndrome, the Angiotensin II-Receptor Gene and the Renin Loci in Man
J. Am. Soc. Nephrol., August 1, 1999; 10(8): 1709 - 1716.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
S. Sheng, J. Li, K. A. McNulty, T. Kieber-Emmons, and T. R. Kleyman
Epithelial Sodium Channel Pore Region. STRUCTURE AND ROLE IN GATING
J. Biol. Chem., January 5, 2001; 276(2): 1326 - 1334.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Melander, O.
Right arrow Articles by Hulthén, U. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Melander, O.
Right arrow Articles by Hulthén, U. L.
Right arrowPubmed/NCBI databases
Medline Plus Health Information
*High Blood Pressure