This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Handy, D. E. Articles by Gavras, H. Search for Related Content PubMed PubMed Citation Articles by Handy, D. E. Articles by Gavras, H.

(Hypertension. 1998;32:311-317.)
© 1998 American Heart Association, Inc.

Scientific Contributions

Expression of ₂-Adrenergic Receptors in Normal and Atherosclerotic Rabbit Aorta

Diane E. Handy; Conrado Johns; Margaret R. Bresnahan; Agostinho Tavares; Michael Bursztyn; ; Haralambos Gavras

From the Hypertension and Atherosclerosis Section, Department of Medicine, Boston University School of Medicine (Mass).

Correspondence to Diane E. Handy, PhD, Boston University Medical Center, W508, 715 Albany St, Boston, MA 02118. E-mail dhandy{at}bu.edu

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Abstract—₂-Adrenergic receptors (₂-ARs) in vascular smooth muscle cells are known to mediate vasoconstriction; however, it is unknown which of the 3 subtypes of ₂-AR (_2A, _2B, or _2C) is expressed in vascular tissue. We have used subtype-specific probes in in situ hybridization and RNase protection assays to analyze the expression of ₂-AR in the thoracic aorta of New Zealand White (NZW) and Watanabe heritable hyperlipidemic (WHHL) rabbits, a model for atherosclerosis. We found that the _2A-AR mRNA was in endothelial and smooth muscle cells in both NZW and WHHL aorta. In addition, the shoulders and subendothelial regions of the atherosclerotic lesions in WHHL aorta showed abundant expression of _2A-AR mRNA. Antibodies to macrophage (RAM-11) and smooth muscle cell (HHF-35) antigens were used to localize macrophage and smooth muscle cells in aortic sections from WHHL rabbits. The expression of _2A-AR mRNA within the lesions of WHHL rabbits correlated with the presence of infiltrating macrophages. We discuss the potential role of _2A-ARs in macrophage function and in promoting atherosclerosis.

Key Words: receptors, adrenergic • aorta • atherosclerosis • rabbits

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Catecholamines mediate vasoconstriction through stimulation of -ARs. In vitro experiments on isolated vessels in the presence and absence of the endothelium have linked stimulation of ₂-AR in endothelial cells with the release of endothelium-derived relaxing factor.¹ In contrast, ₂-ARs in vascular SMCs from coronary, arterial, or venous sources mediate vasoconstriction.^{2 3} ₂-ARs can be divided into 3 subtypes (_2A-, _2B-, and _2C-AR), and it is unknown which subtype(s) of ₂-AR is expressed in normal and atherosclerotic vascular tissue.

Atherosclerotic human coronary arteries show increased vascular reactivity in vivo that has been attributed to altered sensitivity to catecholamines or defects related to ₂-AR functions.^{4 5} Other studies also suggest that ₂-AR–mediated functions differ in normal and atherosclerotic arteries.^{6 7 8}

The earliest visible change in atherosclerosis is the fatty streak, which in experimental models such as the WHHL or cholesterol-fed rabbit involves the accumulation of macrophages in the subendothelial space.^{9 10} Later lesions include macrophages as well as proliferating SMCs that are phenotypically distinct from the SMCs in the media.¹¹ In this report, we analyze the expression of ₂-AR mRNA in aortas from NZW rabbits and WHHL rabbits, a model of atherosclerosis, by in situ hybridization with ₂-AR probes.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Subtype-Specific Probes for In Situ Hybridization
Specific _2A-AR and _2B-AR probes for in situ hybridization have been described.¹² To produce a probe specific for _2C-AR transcripts, a 369-bp XmnI/NaeI fragment was subcloned from the RB_2C cDNA¹³ into the SmaI site of psP65 (Promega).

Tissue Preparation and In Situ Hybridization
Homozygous male WHHL rabbits were obtained from the Boston University Medical Center Colony.¹⁴ Six NZW rabbits weighing 3 to 4 kg were obtained from Millbrook Farm, Amherst, Mass. All rabbits were housed in separate cages on a 12-hour light/dark cycle, fed Agway Prolab normal-fiber laboratory rabbit diet, and provided unlimited access to water. After overnight fasting, blood was collected from the ear vein in EDTA tubes for measuring total cholesterol with a kit (Sigma Chemical Co) or in EGTA/reduced glutathione tubes for measuring catecholamines with the Catecholamine Biotrak Research Assay System (Amersham). Additional rabbits were bled (3 mL) for catecholamine measurement. After blood collection, animals were killed by injection of 150 mg/kg sodium pentobarbital in the marginal ear vein. The thoracic aorta was rapidly removed, rinsed in cold (4°C) PBS, and fixed for at least 24 hours in freshly prepared 4% paraformaldehyde in PBS. Tissues were embedded in paraffin, sectioned (5 µm), and mounted on silanized slides.

In situ hybridization experiments were performed as previously described¹² based on the methods of Sassoon et al.¹⁵ RNA probes were synthesized from linearized psP65 plasmids containing sense or antisense ₂-AR subtype-specific inserts by using Sp6 polymerase in the presence of ³⁵S-dUTP. Sections were hybridized with 35 000 cpm/µL ³⁵S-labeled RNA probes. NTB2 autoradiography emulsion was used to detect hybridization signal. Slides were developed in Kodak D19 at 14°C and fixed in Kodak Rapid Fix A after a 10-day exposure at 4°C. All sections were examined under bright- and dark-field illumination. Photomicrographs were taken with a Nikon microscope and Kodak Ektachrome 64T film.

Immunocytochemical Analysis of Lesions
Aortic sections were treated with xylenes to remove paraffin and then rehydrated; endogenous peroxidase activity was blocked with 0.6% H₂O₂ for 20 minutes. Slides were then pretreated with 0.1% protease type XXIV and 1.5% normal horse serum in PBS. Antibodies against macrophage cells (RAM-11) and SMC actin (HHF-35) were used at 1:100 dilutions for 1 hour at room temperature. After primary antibody incubation, slides were washed in PBS and incubated with 1:1000 biotinylated horse anti-mouse antibody for 30 minutes, followed by avidin-biotin amplification with the Vectastain Elite ABC kit (Vector Laboratories Inc). Slides were washed in water and counterstained in diluted hematoxylin.

PCR of Rabbit _2A-AR Gene Fragment
Rabbit genomic DNA was isolated from NZW liver. PCR was used to isolate a rabbit _2A-AR gene fragment for use in RNase protection assays. The forward (GGGAATTCGCGCCCCAAAACCTCTTCCTGGTG) and reverse (GGGAATTCTGGCGTGCGCTTCAGGTTGTACTC) primer sequences were chosen from a region of high homology among known _2A-ARs from various species. EcoRI sites (underlined) were added for cloning of the PCR fragment into psP65 at the EcoRI site. The _2A-AR gene fragment was amplified from 0.5-µg genomic DNA using the GeneAmp PCR core reagents kit (Perkin-Elmer), optimized with 0.5 µmol/L each primer, 20 µmol/L each dNTP, and 4 mmol/L magnesium. After 4 minutes at 96°C, 2.5 U of Taq DNA polymerase was added, and the amplification profile was run in a PE-9600 thermal cycler for 30 cycles: 15 seconds at 96°C, 10 seconds at 65°C, and 1 minute at 72°C, with a final elongation for 10 minutes at 75°C. The DNA sequence was determined with Sequenase.

RNA Preparation and RNase Protection Assay
Total RNA was prepared from the tissue of two retired breeder WHHL rabbits over 24 months of age and two 12-month-old NZW rabbits using Trizol (Gibco/BRL). Unlabeled sense RNA and ³² P-labeled antisense probe RNA were prepared using the MAXIscript in vitro transcription kit (Ambion). RNase protection was performed with the RPA II kit (Ambion). Protected bands were separated on a denaturing 6% polyacrylamide gel and visualized by autoradiography.

Quantitative Analysis of In Situ Hybridization
Slides were viewed under x600 magnification with a Nikon motor microscope and camera for analysis with the computerized BioQuant system (R&M Biometrics Inc). After the threshold function was adjusted to distinguish silver grains, the number of pixels within a sampled area was automatically counted. Pixel counts were converted to grain counts using empiric data to determine the average number of pixels in silver grains. Multiple areas were sampled in either lesions or media of each aortic ring, and average grain counts were determined per area (in square millimeters).

	Results

Top Abstract Introduction Methods Results Discussion References

 
Expression of ₂-AR Subtypes in Aorta of NZW Rabbits
To investigate the expression of ₂-AR in normal rabbit aortic samples, aorta from NZW rabbits were used in in situ hybridization using antisense and sense probes specific for _2A-AR, _2B-AR, and _2C-AR transcripts. In the bright-field micrographs shown in Figure 1, clusters of silver grains indicative of positive hybridization signal were detected throughout the aorta, over both endothelial and SMC layers, when the _2A-AR antisense probe (Figure 1A) was used. The _2A-AR sense probe (Figure 1B) shows the background level of hybridization with a probe that does not hybridize to the RNA. The signals obtained with the _2B-AR (Figure 1C) and _2C-AR (Figure 1D) antisense probes were similar to that obtained with the _2A-AR sense probe. The _2B-AR and _2C-AR sense probes also appeared identical to the _2A-AR sense probe (data not shown). Similar patterns of hybridization were found in aortic sections from 5 other NZW rabbits ranging in age from 6 to 14 months.

View larger version (81K): [in this window] [in a new window]   Figure 1. In situ hybridization to detect of 2-AR mRNA in NZW aorta. Bright-field micrographs are shown at x400 magnification. Sections of aorta are hybridized to the various 2-AR probes as follows: A, 2A-AR antisense; B, 2A-AR sense; C, 2B-AR antisense; and D, 2C-AR antisense. The conditions used for each of these probes are known to result in positive hybridization signals in brain, a tissue that expresses all 3 subtypes of 2-AR (D.E.H., C.J., H.G., unpublished observations, 1997).12 Examples of endothelial cells (EC) and SMCs are labeled in each panel.

Expression of _2A-AR in Aorta of WHHL Rabbits
To confirm the presence of _2A-AR mRNA in the aorta, a genomic fragment of the rabbit _2A-AR was cloned by PCR to use in RNase protection assays. The rabbit sequence was highly similar to the corresponding _2A-AR sequences from mouse,¹⁶ rat,¹⁷ pig,¹⁸ and humans¹⁹ (Figure 2, top). RNase protection showed a strong positive band with rabbit spleen RNA and a weak band with rabbit aortic RNA, consistent with high levels of expression in spleen and low levels of expression in aorta (Figure 2, bottom).

View larger version (89K): [in this window] [in a new window]   Figure 2. Detection of 2-AR subtype mRNA in NZW and WHHL aorta by RNase protection assays using rabbit probes. Top, Sequence alignment of a partial rabbit 2A-AR genomic clone with human,19 mouse,16 rat,17 and porcine18 2A-AR sequences. The 245-bp clone corresponds to nucleotides 2273 to 2518 of the human 2A-AR sequence, gene bank accession number M23533. Bottom, RNase protection assay: lane 1, pBR322 HinfI markers of 344, 298, and 221/220 nucleotides are shown; lane 2, 10 µg yeast tRNA; lanes 3 to 5, 10 µg WHHL aorta RNA; lanes 6 to 9, 10 µg NZW aorta RNA; lanes 10 and 11, 10 µg spleen RNA; and lanes 12 and 13, 5 pg sense RNA. Protected bands in sense RNA lanes are a higher molecular weight than those obtained with tissue RNA because the sense RNA shares sequences with the probe (ie, cloning sites) that are not found in the 2A-AR mRNA.

To determine whether the pattern of ₂-AR mRNA expression was altered in atherosclerosis, aortic sections from WHHL rabbits were hybridized to the _2A-AR probe (Figure 3). In addition to the presence of _2A-AR mRNA in the medial and endothelial cells, there appeared to be abundant _2A-AR mRNA in atherosclerotic lesions in each of the 6 WHHL rabbits analyzed. To correlate _2A-AR expression with the presence of macrophages or SMCs in the lesions, parallel sections were analyzed with in situ hybridization and immunohistochemistry using RAM-11 (macrophage) or HHF-35 (SMC actin–specific) antibodies. Figure 4 shows a representative comparison of in situ hybridization (panels A, C, E, and G) with immunodetection of macrophage (panels B, D, and F) from 2 different 16-month-old WHHL rabbits. Macrophage staining was strongest in the subendothelial space and along the shoulders of the lesions (Figure 4B and 4F). These are the same areas of the lesion that showed abundant expression of _2A-AR mRNA by in situ hybridization (Figure 3A and 3C, Figure 4A, 4E, and 4G). In comparison, in regions of the aortic section that showed no apparent lesion (Figure 4C and 4D), there was no macrophage staining (Figure 4D), and there appeared to be less _2A-AR mRNA than in the lesion areas (compare Figure 4C with Figure 4A). SMCs were rarely found in the lesions, which consisted mostly of rounded macrophage cells. Figure 4H shows an example of an SMC within a lesion.

View larger version (128K): [in this window] [in a new window]   Figure 3. In situ hybridization of WHHL aorta shows abundant 2A-AR mRNA within lesions. Sections from the aorta of an 8-month-old WHHL rabbit at x200 magnification. A, In situ hybridization with the 2A-AR antisense probe, bright field. B, In situ hybridization with 2A-AR sense probe, bright field. C, In situ hybridization with 2A-AR antisense probe, dark field. Examples of endothelial cells (EC), SMCs, and macrophages (M) are labeled. indicates internal elastic lamina (IEL).

View larger version (120K): [in this window] [in a new window]   Figure 4. In situ hybridization of WHHL aorta colocalizes abundant 2A-AR mRNA with macrophages. A through D are sections from one 16-month-old WHHL aorta. A and C, In situ hybridization with 2A-AR antisense probe from the same slide and aortic ring; A shows a lesion area and C shows a region with no apparent lesion. B and D, Corresponding immunodetection of macrophages with RAM-11 in the lesion (B) and nonlesion areas (D). E through H are from a different 16-month-old WHHL aorta. E and G, In situ hybridization with 2A-AR antisense probe in dark and bright fields, respectively. F, Immunodetection of macrophages with RAM-11. Note the abundant presence of rounded macrophage cells within the subendothelial space where abundant 2A-AR mRNA can be found. H, Immunodetection of SMCs with HHF-35.

Quantitative Analysis of In Situ Hybridization Signal
To determine whether the lesions of the WHHL rabbits had increased expression of _2A-AR mRNA over that found in the media, silver grains were counted over areas of the lesion and media using the BioQuant system. In each of the 6 WHHL samples, there was a significant increase in silver grains over the lesion area compared with the media within the same aortic section (Table). On average, there was a 3.39±1.17-fold (P<.01) increase in silver grains in the lesion versus the media.

View this table: [in this window] [in a new window]   Table 1. Analysis of Silver Grains in Lesions and Media of WHHL Rabbits

Measurements of Plasma Catecholamines and Cholesterol
To determine whether catecholamine levels differ in the WHHL and NZW rabbits, plasma norepinephrine and epinephrine levels were measured from 5 WHHL (average age, 23 months) and 5 NZW (average age, 11 months) rabbits. Norepinephrine levels were nearly 3-fold higher in WHHL than in NZW rabbits (4.28±1.05 versus 1.50±0.027 nmol/L, P<.001), whereas the difference in mean epinephrine levels was not statistically significant (0.475±0.196 versus 0.328±0.115 nmol/L). As expected, the total cholesterol level in WHHL rabbits was about 18-fold higher than the levels in NZW rabbits (12.42±1.36 versus 0.678±0.206 mmol/L, P<.001).

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
The purpose of this study was to examine the vascular expression of ₂-AR. Recent studies in mice suggest that both the _2A-AR and _2B-AR may play a role in vasoconstriction,^{20 21} since the immediate vasoconstrictive effect of ₂-AR agonists was absent in both the _2B-AR²¹ knockout mice and the mice with a mutant _2A-AR substituted for the wild-type receptor.²⁰ Our results suggest that only _2A-AR mRNA is expressed in SMCs from rabbit aorta. It is possible that in mice, both _2A-AR and _2B-AR are expressed in vascular tissue, whereas in rabbits only the _2A-AR is found in vascular tissue. Another possibility is that the aortic expression of _2A-AR does not reflect the expression patterns of other vascular beds.

In the WHHL rabbits, the levels of norepinephrine were nearly triple the levels of norepinephrine in NZW rabbits, whereas the epinephrine levels were similar in both groups. However, given that the WHHL were much older than the NZW rabbits, the effects of age on norepinephrine levels cannot be discounted. It has been established that atherosclerosis in WHHL rabbits is a result of an absence of functional LDL receptors, which leads to hypercholesterolemia and hypertriglyceridemia.^{22 23} Further studies are necessary to determine the relationship (if any) between atherosclerosis and the elevation of norepinephrine in WHHL rabbits.

The contractile responses to norepinephrine and ₂-AR agonists have been shown to be blunted in aortic or carotid arteries taken from rabbits made hypercholesterolemic by diet, whereas the responses to phenylephrine, an ₁-AR agonist, are not impaired.^{8 24} Although the effect of ₂-AR agonists on WHHL arteries has not been tested, norepinephrine-induced vasoconstriction was found to be diminished in WHHL compared with NZW controls.²⁵ It is possible that excess catecholamines, as we found in WHHL rabbits, could promote receptor desensitization; however, several studies have shown a lack of agonist-induced downregulation of ₂-AR.²⁶

It has been proposed that increases in sympathetic activation can enhance atherosclerosis.²⁷ Administration of norepinephrine or epinephrine to rabbits or monkeys correlates with increased progression of atherogenic changes in these animal models.^{28 29} Sympatholytic agents, such as ß-blockers and ₁-blockers, have been shown to reduce atherosclerosis in some animal models of atherosclerosis; however, neither ß- nor ₁-blockers reduced atherosclerosis in WHHL rabbits (reviewed in Reference 30³⁰ ).

Many factors can affect the density of silver grains in in situ hybridization, including hybridization and wash conditions, specific activity of the probe, and the time of exposure to emulsion. These conditions can be controlled within an experiment, but it is difficult to control for all factors that can contribute to tissue-to-tissue variation. Thus, in situ hybridization is usually used for qualitative comparisons and to localize mRNA transcripts within distinct anatomic structures. However, some comparisons can be made on any given slide where all of the above factors are controlled. Although the intensity of silver grains varies in the different samples, our results clearly show that the concentration of signal is significantly greater over areas of the lesion than over the media of the same vessel in each of the 6 WHHL rabbits analyzed (Table). This apparent abundance of _2A-AR mRNA correlates with the presence of macrophages. In addition, we found no evidence for significant expression of _2B-AR or _2C-AR mRNA in the macrophages (data not shown).

The presence of _2A-AR in macrophages is a novel and potentially important finding. Macrophages accumulate early in the atherogenic process and may promote vascular damage through the release of cytokines that stimulate SMC chemotaxis and proliferation, as well as migration of other monocyte/macrophage cells.^{10 11} Furthermore, in vitro studies suggest that catecholamines act through the ₂-AR to activate macrophage function and augment the lipopolysaccharide-induced cytokine production.^{31 32} The presence of _2A-AR mRNA within macrophages suggests the need for further study of the role of _2A-AR stimulation on macrophage function.

	Selected Abbreviations and Acronyms

 

-AR = -adrenergic receptor NZW = New Zealand White PCR = polymerase chain reaction SMC = smooth muscle cell WHHL = Watanabe heritable hyperlipidemic

	Acknowledgments

 
These studies were supported by National Institutes of Health grants HL48181 and P50 HL55001. We thank Susan Hope for her assistance with the Watanabe rabbits.

Received February 2, 1998; first decision February 26, 1998; accepted March 26, 1998.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Cocks TM, Angus JA. Endothelium-dependent relaxation of coronary arteries by noradrenaline and serotonin. Nature. 1983;305:627–630.[Medline] [Order article via Infotrieve]

2. Aburto T, Jinsi A, Zhu Q, Deth RC. Involvement of protein kinase C activation in alpha 2-adrenoceptor-mediated contractions of rabbit saphenous vein. Eur J Pharmacol. 1995;277:35–44.[Medline] [Order article via Infotrieve]

3. Chen DG, Dai XZ, Bache RJ. Postsynaptic adrenoceptor-mediated vasoconstriction in coronary and femoral vascular beds. Am J Physiol. 1988;254:H984–H992.[Abstract/Free Full Text]

4. Nabel EG, Ganz P, Gordon JB, Alexander RW, Selwyn AP. Dilation of normal and constriction of atherosclerotic coronary arteries caused by the cold pressor test. Circulation. 1988;77:43–52.[Abstract/Free Full Text]

5. Vita JA, Treasure CB, Yeung AC, Vekshtein VI, Fantasia GM, Fish RD, Ganz P, Selwyn AP. Patients with evidence of coronary endothelial dysfunction as assessed by acetylcholine infusion demonstrate marked increase in sensitivity to constrictor effects of catecholamines. Circulation. 1992;85:1390–1397.[Abstract/Free Full Text]

6. Indolfi C, Piscione F, Villari B, Russolillo E, Rendina V, Golino P, Condorelli M, Chiariello M. Role of ₂-adrenoceptors in normal and atherosclerotic human coronary circulation. Circulation. 1992;86:1116–1124.[Abstract/Free Full Text]

7. Shimokawa H, Flavahan NA, Vanhoutte PM. Loss of endothelial pertussis toxin–sensitive G-protein function in atherosclerotic porcine coronary arteries. Circulation. 1991;83:652–660.[Abstract/Free Full Text]

8. Du ZY, Woodman OL. The effect of hypercholesterolaemia and atherosclerosis on alpha-adrenoceptor-mediated vasoconstriction in conscious rabbits and rabbit aorta. Eur J Pharmacol. 1992;211:149–156.[Medline] [Order article via Infotrieve]

9. Shiomi M, Ito T, Tsukada T, Yata T, Ueda M. Cell compositions of coronary and aortic atherosclerotic lesions in WHHL rabbits differ. Arterioscler Thromb. 1994;14:931–937.[Abstract/Free Full Text]

10. Rosenfeld ME, Tsukada T, Gown AM, Ross R. Fatty streak initiation in Watanabe heritable hyperlipidemic and comparably hypercholesterolemic fat-fed rabbits. Arteriosclerosis. 1987;7:9–23.[Abstract]

11. Giuriato L, Scatena M, Chiavegato A, Zanellato AMC, Guidolin D, Pauletto P, Sartore S. Localization and smooth muscle cell composition of atherosclerotic lesions in Watanabe heritable hyperlipidemic rabbits. Arterioscler Thromb. 1993;13:347–359.[Abstract/Free Full Text]

12. Tavares A, Handy DE, Bogdanova NN, Rosene DL, Gavras H. Localization of _2A- and _2B-adrenergic receptor subtypes in brain. Hypertension. 1996;27:449–455.[Abstract/Free Full Text]

13. Flordellis CS, Handy DE, Bresnahan MR, Zannis VI, Gavras H. Cloning and expression of a rat brain _2B-adrenergic receptor. Proc Natl Acad Sci U S A. 1991;88:1019–1023.[Abstract/Free Full Text]

14. Chobanian AV, Lichtenstein AH, Nilakhe V, Haudenschild CC, Drago R, Nickerson C. Influence of hypertension on aortic atherosclerosis in the Watanabe rabbit. Hypertension. 1989;14:203–209.[Abstract/Free Full Text]

15. Sassoon D, Lyons G, Wright WE, Lin V, Lassar A, Weintraub H, Buckingham M. Expression of two myogenic regulatory factors myogenin and myoD1 during mouse embryogenesis. Nature. 1989;341:303–307.[Medline] [Order article via Infotrieve]

16. Link R, Daunt D, Barsh GS, Chruscinski AJ, Kobilka B. Cloning of two mouse genes encoding alpha-2 adrenergic receptor subtypes and identification of a single amino acid in the mouse alpha-2-C10 homolog responsible for an interspecies variation in antagonist binding. Mol Pharmacol. 1992;42:16–27.[Abstract]

17. Lanier SM, Downing S, Duzic E, Homcy CJ. Isolation of rat genomic clones encoding subtypes of the alpha-2-adrenergic receptor: identification of a unique receptor subtype. J Biol Chem. 1991;266:10470–10478.[Abstract/Free Full Text]

18. Guyer CA, Horstman DA, Wilson AL, Clark JD, Cragoe EJ Jr, Limbird LE. Cloning sequencing and expression of the gene encoding the porcine alpha-2-adrenergic receptor: allosteric modulation by Na⁺, H⁺ and amiloride analogs. J Biol Chem. 1990;265:17307–17317.[Abstract/Free Full Text]

19. Fraser CM, Arakawa S, McCombie WR, Venter JC. Cloning, sequence analysis and permanent expression of a human alpha 2-adrenergic receptor in Chinese hamster ovary cells. J Biol Chem. 1989;264:11754–11761.[Abstract/Free Full Text]

20. MacMillan LB, Hein L, Smith MS, Piascik MT, Limbird LE. Central hypotensive effects of the _2A-adrenergic receptor subtype. Science. 1996;273:801–803.[Abstract]

21. Link RE, Desai K, Hein L, Stevens ME, Chruscinski A, Bernstein D, Barsh GS, Kobilka BK. Cardiovascular regulation in mice lacking ₂-adrenergic receptor subtypes b and c. Science. 1996;273:803–805.[Abstract]

22. Kita T, Brown MS, Watanabe Y, Goldstein JL. Deficiency of low density lipoprotein receptors in liver and adrenal gland of the WHHL rabbit, an animal model of familial hypercholesterolemia. Proc Natl Acad Sci U S A. 1981;78:2268–2272.[Abstract/Free Full Text]

23. Bilheimer DW, Watanabe Y, Kita T. Impaired receptor-mediated catabolism of low density lipoprotein in the WHHL rabbit, an animal model of familial hypercholesterolemia. Proc Natl Acad Sci U S A. 1982;79:3305–3309.[Abstract/Free Full Text]

24. Fujiwara T, Chiba S. Alterations of vascular alpha 1-adrenergic contractile responses in hypercholesterolemic rabbit common carotid arteries. J Cardiovasc Pharmacol. 1993;22:58–64.[Medline] [Order article via Infotrieve]

25. Wines PA, Schmitz JM, Pfister SL, Clubb FJ Jr, Buja LM, Willerson JT, Campbell WB. Augmented vasoconstrictor responses to serotonin precede development of atherosclerosis in aorta of WHHL rabbit. Arteriosclerosis. 1989;9:195–202.[Abstract/Free Full Text]

26. Liggett SB, Ostrowski J, Chesnut LC, Kurose H, Raymond JR, Caron MG, Lefkowitz RJ. Sites in the third intracellular loop of the _2A-adrenergic receptor confer short-term agonist desensitization. J Biol Chem. 1992;267:4740–4746.[Abstract/Free Full Text]

27. Pauletto P, Scannopieco G, Pessina AC. Sympathetic drive and vascular damage in hypertension and atherosclerosis. Hypertension. 1991;17(suppl III):III-75–III-81.

28. Helin P, Lorenzen I, Garbarsch C, Matthiessen E. Arteriosclerosis in rabbit aorta induced by noradrenaline. Atherosclerosis. 1970;12:125–132.[Medline] [Order article via Infotrieve]

29. Kukreja RS, Datta BN, Chakravarti RN. Catecholamine-induced aggravation of aortic and coronary atherosclerosis in monkeys. Atherosclerosis. 1981;40:291–298.[Medline] [Order article via Infotrieve]

30. Chobanian AV. Can antihypertensive drugs reduce atherosclerosis and its clinical complications? Am J Hypertens. 1994;7:119S–125S.[Medline] [Order article via Infotrieve]

31. Spengler RN, Allen RM, Renick DG, Strieter RM, Kunkel SL. Stimulation of alpha-adrenergic receptor augments the production of macrophage-derived tumor necrosis factor. J Immunol. 1990;145:1430–1434.[Abstract]

32. Miles BA, Lafuse WP, Zwilling BS. Binding of -adrenergic receptors stimulates the anti-mycobacterial activity of murine peritoneal macrophages. J Neuroimmunol. 1996;71:19–24.[Medline] [Order article via Infotrieve]

This article has been cited by other articles:

				E. Kintsurashvili, I. Gavras, C. Johns, and H. Gavras Effects of Antisense Oligodeoxynucleotide Targeting of the {alpha}2B-Adrenergic Receptor Messenger RNA in the Central Nervous System Hypertension, November 1, 2001; 38(5): 1075 - 1080. [Abstract] [Full Text] [PDF]

				J. E. Faber, N. Yang, and X. Xin Expression of alpha -Adrenoceptor Subtypes by Smooth Muscle Cells and Adventitial Fibroblasts in Rat Aorta and in Cell Culture J. Pharmacol. Exp. Ther., August 1, 2001; 298(2): 441 - 452. [Abstract] [Full Text] [PDF]

				A. Snapir, P. Heinonen, T.-P. Tuomainen, P. Alhopuro, M. K. Karvonen, T. A. Lakka, K. Nyyssonen, R. Salonen, J. Kauhanen, V.-P. Valkonen, et al. An insertion/deletion polymorphism in the {alpha}2b-adrenergic receptor gene is a novel genetic risk factor for acute coronary events J. Am. Coll. Cardiol., May 1, 2001; 37(6): 1516 - 1522. [Abstract] [Full Text] [PDF]

				S. Yang, D. J. Koo, M. Zhou, I. H. Chaudry, and P. Wang Gut-derived norepinephrine plays a critical role in producing hepatocellular dysfunction during early sepsis Am J Physiol Gastrointest Liver Physiol, December 1, 2000; 279(6): G1274 - G1281. [Abstract] [Full Text] [PDF]

				K. P. Makaritsis, C. Johns, I. Gavras, and H. Gavras Role of {alpha}2-Adrenergic Receptor Subtypes in the Acute Hypertensive Response to Hypertonic Saline Infusion in Anephric Mice Hypertension, February 1, 2000; 35(2): 609 - 613. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Handy, D. E. Articles by Gavras, H. Search for Related Content PubMed PubMed Citation Articles by Handy, D. E. Articles by Gavras, H.