This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Makaritsis, K. P. Articles by Gavras, H. Search for Related Content PubMed PubMed Citation Articles by Makaritsis, K. P. Articles by Gavras, H. Pubmed/NCBI databases Gene GEO Profiles HomoloGene UniGene Compound via MeSH Substance via MeSH Medline Plus Health Information Dietary Sodium High Blood Pressure Related Collections Nutrition Other hypertension Gene expression

(Hypertension. 1999;33:14-17.)
© 1999 American Heart Association, Inc.

Scientific Contributions

Role of the _2B-Adrenergic Receptor in the Development of Salt-Induced Hypertension

Konstantinos P. Makaritsis; Diane E. Handy; Conrado Johns; Brian Kobilka; Irene Gavras; Haralambos Gavras

From the Hypertension and Atherosclerosis Section of the Department of Medicine, Boston University School of Medicine, Boston, Mass; and Stanford University (B.K.), Stanford, Calif.

Correspondence to Dr Haralambos Gavras, Hypertension & Atherosclerosis Section, Boston University School of Medicine, 715 Albany Street, Boston, MA 02118. E-mail hgavras{at}bu.edu

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Abstract—Salt sensitivity is a common trait in patients with essential hypertension and seems to have both an inherited and an acquired component (eg, is influenced by aging and renal insufficiency). Experimental evidence suggests that salt loading induces hypertension via a neurogenic mechanism mediated by the ₂-adrenergic receptors (₂-AR). To explore the ₂-AR subtype involved in this mechanism, we studied 2 groups of mice genetically engineered to be deficient in one of the 3 ₂-AR subtype genes (either _2B-AR +/- or _2C-AR -/- knockout mice) compared with their wild-type counterparts. The mice (n=10 to 14 in each group) were submitted to subtotal nephrectomy and given 1% saline as drinking water for up to 35 days. Blood pressure (BP) was monitored by tail-cuff readings and confirmed at the end point by direct intra-arterial BP recording. The _2B-AR–deficient mice had an attenuated BP response in this protocol (baseline 101.8±2.7 versus end point 109.9±2.8 mm Hg), whereas the BP of their wild-type counterparts went from a baseline 101.9±2.3 to an end point 141.4±7.1 mm Hg. The other 2 groups had BP increases of 44.6±5.17 and 46.7±7.01 mm Hg, with no difference between the mice deficient in the _2C-AR gene subtype versus their wild-type counterparts. Body weight, renal remnant weight, and residual renal function were no different among groups. These data suggest that a full complement of _2B-AR genes is necessary to raise BP in response to dietary salt loading, whereas complete absence of the _2C-AR subtype does not preclude salt-induced BP elevation. It is unclear whether the mechanism(s) involved in this process are of central origin (inability to increase sympathetic outflow), vascular origin (inability to vasoconstrict), or renal origin (inability to retain excess salt and fluid).

Key Words: receptors, adrenergic, alpha • mice • hypertension, sodium-dependent

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Acommon characteristic among essential hypertensive patients is excessive sensitivity to salt, with a prevalence estimated to be >50%.¹ Although factors such as aging and diminished renal function enhance salt sensitivity, there is also evidence that this is a heritable trait that is genetically determined.² In support of this notion is the familial aggregation and the higher prevalence of salt sensitivity in certain ethnic groups, eg, African Americans.

The mechanisms by which salt loading raises blood pressure (BP) are still incompletely understood. Increasing evidence in recent literature suggests that the prevailing mechanism is a neurogenic one involving an early interaction between vasopressinergic and adrenergic neurons in the central nervous system (CNS), leading to a later persistent hyperadrenergic state.³ A large body of experimental data^{4 5 6 7} suggests that the sympathetic component that plays a pivotal role in this interaction is the ₂-adrenergic receptor (₂-AR). Notably, in vitro⁸ and in vivo⁹ studies in the past have also indicated that the sodium ion can affect the ₂-AR function by altering the sensitivity and responsiveness of these receptors to agonist neurotransmitters.

Because radioligands cannot discriminate between ₂-AR subtypes, the subtype involved in these salt-mediated effects could not be further dissected by pharmacological techniques. Recently, however, genetically engineered mice in which either the _2B-AR or the _2C-AR gene has been selectively deleted became available.^{10 11} The following experiments were designed to explore the role of each one of these _2-AR subtypes in salt sensitivity by use of genetically altered mice lacking one or both copies of each of the ₂-AR subtypes in a subtotal nephrectomy and dietary salt-loading study.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Animals
Four groups of male mice aged 7 to 9 weeks and weighing 20.2 to 27.2 g were used in the present study. One group of homozygous (-/-) knockout mice for the _2C-AR subtype and 1 group of heterozygous (+/-) _2B-AR subtype gene knockout mice were used, along with their wild-type controls (+/+). Homozygous _2B -/- gene knockout mice were not available in sufficient numbers, as they do not breed well. Heterozygous _2B-AR gene knockout mice were deemed acceptable as they have been shown to have a lower level of expression of the _2B-AR protein.¹¹ All mice were housed in the animal quarters with a 12-hour light/dark cycle and were provided food (Purina, Certified Rodent Chow 5002) and distilled water ad libitum. After subtotal nephrectomy, drinking water was replaced with 1% saline. All experiments were conducted in accordance with guidelines for the care and use of animals approved by the Boston University Medical Center.

Animal Genotyping
Inactivation of each of the ₂-AR genes involved insertion of the pGK.Neo.Bpa cassette.^{10 11} For each ₂ gene, specific primers that flank the site of the pGK.Neo cassette insertion and a compatible primer specific for the pGK promoter were synthesized. Genotypes were determined from DNA isolated from tail or spleen by use of these primers in 1 polymerase chain reaction (PCR) to detect the intact gene (₂-primer pair) and the interrupted gene (₂-primer/pGK-primer pair).

To screen the _2B-AR lines, MB.GF2 (ATCCTCACCGTGTGGCTCATTG), MB.GB2 (TGGAGGCTTGGGGTGTCCATTAG), and PGK0.1 (CAGAAAGCGAAGGAGCAA-AGC) primers were used to detect the intact (365 bp) or interrupted (750 bp) _2B-AR gene. To screen the _2C-AR lines, MC.GF1 (CACCTGTGTGCCATTAGTCTGGAC), MC.GB1 (TTGCCCAGCCCATTCTCTG), and PGK0.3 (CATTTGTCACGTCCTGCACGAC) were used to detect the intact (377 bp) or interrupted (540 bp) _2C-AR gene. Presence of the PGK.neo.Bpa insert was confirmed by use of the neo.F1(TGGAGAGGCTATTCGGCTATGAC) and neo.B3 (CACCATGATATTCGGCAAGCAG) primers to produce a 548-bp band by PCR. Each 25-µL PCR contained 0.2 µmol/L each primer, 0.2 mmol/L each dNTP, 2 mmol/L Mg²⁺, 10 mmol/L Tris-HCl, pH 8.3, 50 mmol/L KCl, and 0.025 U AmpliTaq Gold (Perkin Elmer) and was incubated as follows: 95°C for 12 minutes followed by 30 cycles of 94°C for 30 seconds, 55^o for 30 seconds, 75^o for 1 minute 30 seconds followed by 75^o for 5 minutes. Bands were separated on 3% to 4% NuSieve agarose (FMC) gels.

Subtotal Nephrectomy and BP Monitoring
Mice were submitted to subtotal nephrectomy and handled as described elsewhere.¹² In short, under anesthesia with intraperitoneal sodium pentobarbital, both poles of the left kidney were excised, leaving a small amount of residual renal tissue around the hilum and preserving the ureter and hilar vessels. After a 7- to 10-day recovery period, the right kidney was removed, leaving 20% to 25% of the total renal mass. Twenty-four hours after the second operation, the animals were placed and maintained on 1% NaCl as drinking water for a maximal period of 35 days.

Tail-cuff systolic BP (SBP) and heart rate (HR) measurements were obtained by use of a computerized tail-cuff system (BP 2000 Visitech Systems) described elsewhere.¹²

Mice were followed up for a maximal period of 35 days or until they became hypertensive, ie, their tail-cuff SBP reached 150 mm Hg or an increase by 40 mm Hg from baseline was recorded and sustained for 3 consecutive days. BP measurements of the last 3 days were averaged and the mean was considered the end point tail-cuff BP for the animal. In animals that failed to develop hypertension as defined above during the 35-day period, the end point tail-cuff BP was calculated by averaging measurements of the last 3 days. The end point tail-cuff BP was confirmed by direct measurement via arterial catheterization at the end of the study, as described elsewhere.¹² Plasma creatinine was measured on blood samples drawn into heparinized tubes from the arterial line by use of a commercially available colorimetric kit from Sigma Diagnostics.

Statistical Analysis
All data are presented as mean±SEM. Student's t tests for paired and unpaired data were used as appropriate. The Mann-Whitney rank sum test was used for nonparametric data. Differences at P<0.05 were considered significant.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Tail-Cuff Measurements
Figure 1 summarizes mean tail-cuff BP measurements in all 4 groups of mice at end point. Panel A shows that there was no difference in baseline BP (ie, before surgery) between the heterozygous _2B +/- (n=10) and their control _2B +/+ (n=12) mice. However, an attenuated hypertensive response to subtotal nephrectomy and salt loading was observed in the heterozygous _2B +/- group, resulting in a significantly lower end point BP compared with their wild-type controls and a significantly lower BP (8.1±2.44 versus 39.4±6.83 mm Hg, respectively; P=0.001). Panel B shows that _2C -/- mice (n=12) and their _2C +/+ controls (n=12) were no different in either baseline BP, end point BP, or BP.

View larger version (15K): [in this window] [in a new window]   Figure 1. Tail-cuff BP at baseline and end point for each group of mice. Open bars denote wild-type mice; closed bars, the genetically altered mice. Panel A depicts the 2B-AR–deficient and panel B the 2C-AR knockout mice, each with their wild-type counterparts. *P<0.01 between genetically altered mice and their wild-type counterparts.

Figure 2 presents mean tail-cuff HR measurements in all groups. No difference was found at baseline or end point HR between the _2B +/+ versus _2B +/- or the _2C +/+ versus _2C -/- mice. A small but significant increase in HR from baseline was observed in all groups except the _2B +/- group after subtotal nephrectomy and 1% saline (paired t test).

View larger version (16K): [in this window] [in a new window]   Figure 2. HR at baseline and end point for each group of mice. Bar symbols as in Figure 1.

Intra-arterial BP Measurements
The end point direct mean arterial pressure (MAP) measurements for each group are shown in Figure 3. MAP was comparable in _2C +/+ (n=10) versus _2C -/- (n=8) mice. Consistent with the end point tail-cuff BP measurements, direct MAP was significantly lower in the _2B +/- (n=8) group compared with the _2B +/+ (n=10) group (104.3±2.71 versus 135.0±7.03 mm Hg, respectively; P=0.002). Comparison of end point tail-cuff SBP measurements with direct MAPs by regression analysis showed a close correlation between the 2 readings for all mice studied (r=0.746, P<0.001, n=36).

View larger version (12K): [in this window] [in a new window]   Figure 3. Direct intra-arterial BP at end point for each group of mice. Bar symbols as in Figures 1 and 2. *P<0.01 between genetically altered mice and their wild-type counterparts.

Other Parameters
Table 1 shows no differences between genetically altered mice and their controls in regard to body weight at baseline and end point or ratio of remnant kidney weight to body weight at end point and no differences in plasma creatinine levels, indicating that the residual renal function after subtotal nephrectomy was similar in all groups. Mean plasma creatinine levels were within the normal range in all 4 groups. Hypertension, as defined in the Methods section, developed within 2 weeks on average in the _2C +/+ and _2C -/- mice and in 4 weeks in the _2B +/+. All _2B +/- mice were maintained for 35 days, except 2 mice that died a few days earlier without appreciable change in BP.

View this table: [in this window] [in a new window]   Table 1. Changes in Body Weight, Ratio of Remnant Kidney Weight to Body Weight, Days on 1% NaCl, and Plasma Creatinine Levels in Subtotally Nephrectomized Mice

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
Subtotal nephrectomy is a long-accepted experimental procedure¹³ used over the years to accentuate salt-induced hypertension equivalent to that accompanying human chronic renal failure. Previous studies from our laboratory and others have established that this hypertension is associated with indices of sympathetic overactivity^{14 15} that seems to be mediated by altered ₂-AR function in CNS structures.^{4 5 6 7} The present experiments suggest that the _2B-AR subtype plays a crucial role in this situation, because mice lacking a full complement of the _2B-AR gene were unable to raise their BP in response to chronic salt loading aided by subtotal nephrectomy. Although missing only 1 copy of the _2B-AR gene, these animals have been shown in the past to be deficient in _2B-AR protein levels.¹¹ The data do not permit conclusions as to the mechanism(s) by which NaCl may affect _2B-AR, ie, whether it causes the gene itself or some regulatory protein to respond by altering the numbers of generated _2B-AR or whether it alters the functional status of the _2B-AR in terms of its affinity to neurotransmitters. They do indicate, however, that adequate expression of normally functioning _2B-AR is a prerequisite for development of salt-induced hypertension. In contrast, subtotally nephrectomized mice with complete lack of the _2C-AR gene developed salt-induced hypertension to the same extent as their wild-type counterparts.

In a number of recent publications, it was suggested that the _2A-AR subtype, which is abundantly distributed throughout the CNS and highly concentrated in the brain stem, is directly involved in regulating sympathetic outflow¹⁶ ; on the contrary, the _2B-AR is restricted only in a limited area of the CNS, namely the thalamus and the nucleus tractus solitarii area of the brain stem,¹⁷ but is abundant in the vascular smooth muscle cells of the arterial wall and mostly responsible for a peripheral vasoconstrictive action,¹¹ whereas the _2C-AR have an "elusive, mysterious character"¹⁸ with no clearly defined function so far. A separate study of _2A-AR knockout mice versus their wild counterparts will be reported elsewhere (B.K. Kobilka, unpublished data).

The fact that mice lacking 1 copy of the _2B-AR gene are unable to develop salt-induced hypertension could have several potential interpretations: An obvious one is that lack of functional peripheral ₂-AR on the vascular wall diminishes the capacity of resistance arteries to constrict in response to adrenergic stimuli. This is unlikely, however, because catecholamines induce vasoconstriction mainly via stimulation of the ₁-AR, which constitute the majority of the vascular wall -AR.¹⁹ For this reason, selective ₁-AR antagonists like prazosin, terazosin, etc have a major and consistent hypotensive effect, whereas ₂-AR antagonists (eg, yohimbine) cause minimal vasodilation overshadowed by a centrally mediated hypertensive action.

A second possibility is that lack of adequately functional renal _2B-AR precluded reabsorption of sodium. The ₂-AR are the numerically predominant AR type in the kidney,²⁰ and in rats they belong mostly to the _2B-AR subtype.²¹ Several investigators have proposed that increased sodium reabsorption leading to salt-induced hypertension is a function of renal _2-AR.^{22 23 24} Therefore, it is possible that the _2B-AR–deficient animals were unable to retain sodium and, hence, never did attain a salt-loaded state. This possibility cannot be excluded without metabolic studies to calculate salt intake and output of each subgroup.

A third potential explanation is that lack of functional central _2B-AR may be responsible for inability to respond to salt loading with the expected increase in sympathetic outflow. Even though this is reported to be mainly an _2A-AR–mediated effect,¹⁶ it is possible that the strategically located _2B-AR in the thalamus and brain stem¹⁷ may play a modulating role on the _2A-AR responses. In the absence of some physiological indicator of sympathetic activity, such as circulating catecholamine levels or nerve conduction studies, this possibility cannot be confirmed or refuted. Nevertheless, the lack of ₁-AR–mediated vasoconstriction would suggest absence of excessive catecholaminergic stimulation of CNS origin.

It is tempting to speculate on the potential significance of this finding in terms of genetic predisposition to salt sensitivity and essential hypertension. Although results from genetic epidemiological studies have so far been inconsistent, there have been suggestions that hypertensive African Americans may have a higher frequency of ₂-AR gene polymorphisms.^{25 26} Further, aging was associated with diminished affinity status of ₂-AR in elderly black normotensive subjects compared with their white counterparts or to age- and race-matched hypertensive subjects.²⁷ These intriguing bits of information make it worth exploring whether genetic differences in ₂-AR subtype numbers, structure, or function or alterations due to aging and other factors are associated with differences in salt sensitivity in humans.

	Acknowledgments

 
This work was supported by the Hypertension SCOR Grant #1P50HL 55001.

Received August 17, 1998; first decision September 15, 1998; accepted October 9, 1998.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Weinberger MH, Miller JZ, Luft FC, Grim CE, Fineberg NS. Definitions and characteristics of sodium sensitivity and blood pressure resistance. Hypertension. 1986;8(suppl II):II-127–II-134.

2. Oparil S, Meng QC, Chen YF, Yang RH, Jin H, Wyss JM. Genetic basis of NaCl-sensitive hypertension. J Cardiovasc Pharmacol. 1988;12(suppl 3):S56–S69.

3. Gavras H, Gavras I. Salt-induced hypertension: the interactive role of vasopressin and of the sympathetic nervous system. J Hypertens. 1989;7:601–606.[Medline] [Order article via Infotrieve]

4. Bresnahan MR, Gavras I, Hatinoglou S, Muller RE, Gavras H. Central alpha-adrenoceptors during the development of hypertension in rats in high and low salt intake. J Hypertens. 1986;4:719–726.[Medline] [Order article via Infotrieve]

5. Koepke JP, Jones S, DiBona GF. Sodium responsiveness of central ₂-adrenergic receptors in spontaneously hypertensive rats. Hypertension. 1988;11:326–333.[Abstract/Free Full Text]

6. Klangkalya B, Sripairojthikoon W, Oparil S, Wyss JM. High NaCl diet increases anterior hypothalamic ₂-adrenoceptors in SHR. Brain Res. 1988;451:77–84.[Medline] [Order article via Infotrieve]

7. Gavras H. How does salt raise blood pressure? A hypothesis. Hypertension. 1986;8:83–88.[Abstract/Free Full Text]

8. Tsai BS, Lefkowitz J. Agonist-specific effects of monovalent and divalent cations on adenylate cyclase-coupled alpha adrenergic receptors in rabbit platelets. Mol Pharmacol. 1978;14:540.[Abstract/Free Full Text]

9. Kohlmann O Jr, Gavras I, Biollaz J, Biollaz B, Gavras H. Sodium chloride-induced partial inhibition in vivo of alpha2-adrenoceptor agonist function. J Hypertens. 1985;3:269–274.[Medline] [Order article via Infotrieve]

10. Link RE, Stevens MS, Kulatunga M, Scheinin M, Barsh GS, Kobilka BK. Targeted inactivation of the gene encoding the mouse alpha 2c-adrenoceptor homology. Mol Pharmacol. 1995;48:48–55.[Abstract]

11. Link RE, Desai K, Hein L, Stevens ME, Chruscinski A, Bernstein D, Barsh GS, Kobilka BK. Cardiovascular regulation in mice lacking ₂-adrenergic receptor subtypes b and c. Science. 1996;273:803–805.[Abstract]

12. Johns C, Gavras I, Handy DE, Salomao A, Gavras H. Models of experimental hypertension in mice. Hypertension. 1996;28:1064–1069.[Abstract/Free Full Text]

13. Koletsky S, Goodsitt AM. Natural history and pathogenesis of renal ablation hypertension. Arch Pathol. 1960;69:654–662.[Medline] [Order article via Infotrieve]

14. Dipette D, Waeber B, Volicer L, Chao P, Gavras I, Gavras H, Brunner HR. Salt-induced hypertension in chronic renal failure: evidence for a neurogenic mechanism. Life Sci. 1983;32:733–740.[Medline] [Order article via Infotrieve]

15. Oparil S, Chen YF, Meng QC, Yang RH, Jin H, Wyss JM. The neural basis of salt sensitivity in the rat: altered hypothalamic function. Am J Med Sci. 1988;295:360–369.[Medline] [Order article via Infotrieve]

16. MacMillan LB, Hein L, Smith MS, Piascik MT, Limbird LE. Central hypotensive effect of the _2a-adrenergic receptor subtype. Science. 1996;273:801–803.[Abstract]

17. Tavares A, Handy DE, Bogdanova NN, Rosene DL, Gavras H. Localization of _2A- and _2B-adrenergic receptor subtypes in brain. Hypertension. 1996;27:449–455.[Abstract/Free Full Text]

18. MacDonald E, Kobilka BK, Scheinin M. Gene targeting—homing in on alpha 2-adrenoceptor-subtype function. Trends Pharmacol Sci. 1997;18:211–219.[Medline] [Order article via Infotrieve]

19. Gavras H, Handy D, Gavras I. Alpha-adrenergic receptors in hypertension. In: Laragh JH, Brenner BM, eds. Hypertension Pathophysiology, Diagnosis, and Management. 2nd ed. New York: Raven Press; 1995:853–861.

20. Pettinger WA. Renal ₂-adrenergic receptors and hypertension. Hypertension. 1987;9:3–6.[Free Full Text]

21. Bylund DB, Ray-Prenger C, Murphy TJ. Alpha-2A and alpha-2B adrenergic receptor subtypes: antagonist binding in tissues and cell lines containing only one subtype. J Pharmacol Exp Ther. 1988;245:600–607.[Abstract/Free Full Text]

22. Pettinger WA, Gandler T, Sanchez A, Saavedra JM. Dietary sodium and renal alpha 2-adrenergic receptors in Dahl hypertensive rat. Clin Exp Hypertens A. 1982;4:819–828.

23. Dawson R Jr, Oparil S. Renal catecholamines and ₂-adrenergic receptors in salt-related and genetic hypertension. Pharmacology. 1987;34:131–142.[Medline] [Order article via Infotrieve]

24. Sripairojthikoon W, Wyss JM. High NaCl diets increase ₂-adrenoceptors in renal cortex and medulla of NaC1-sensitive spontaneously hypertensive rats. Eur J Pharmacol. 1989;167:355–365.[Medline] [Order article via Infotrieve]

25. Lockette W, Ghosh S, Farrow S, MacKenzie S, Baker S, Miles P, Schork A, Cadaret L. Alpha 2-adrenergic receptor gene polymorphism and hypertension in blacks. Am J Hypertens. 1995;8:390–394.[Medline] [Order article via Infotrieve]

26. Svetkey LP, Timmons PZ, Emovon O, Anderson NB, Preis L, Chen YT. Association of hypertension with ß and _2C10-adrenergic receptor genotype. Hypertension. 1996;27:1210–1215.[Abstract/Free Full Text]

27. Bursztyn M, Bresnahan M, Gavras I, Gavras H. Pressor hormones in elderly hypertensive persons. Racial differences. Hypertension. 1990;5(suppl I):I-88–I-92.

This article has been cited by other articles:

				R. W. Brown Naturally Too Sympathetic to a Bad Diet? J. Am. Soc. Nephrol., March 1, 2008; 19(3): 420 - 422. [Full Text] [PDF]

				D. V. Menon, Z. Wang, P. J. Fadel, D. Arbique, D. Leonard, J.-L. Li, R. G. Victor, and W. Vongpatanasin Central Sympatholysis as a Novel Countermeasure for Cocaine-Induced Sympathetic Activation and Vasoconstriction in Humans J. Am. Coll. Cardiol., August 14, 2007; 50(7): 626 - 633. [Abstract] [Full Text] [PDF]

				L. C. Duling, T. W. Cherng, J. R. Griego, M. F. Perrine, and N. L. Kanagy Loss of {alpha}2B-adrenoceptors increases magnitude of hypertension following nitric oxide synthase inhibition Am J Physiol Heart Circ Physiol, November 1, 2006; 291(5): H2403 - H2408. [Abstract] [Full Text] [PDF]

				L. J. Mullins, M. A. Bailey, and J. J. Mullins Hypertension, Kidney, and Transgenics: A Fresh Perspective Physiol Rev, April 1, 2006; 86(2): 709 - 746. [Abstract] [Full Text] [PDF]

				J. P. Etzel, B. K. Rana, G. Wen, R. J. Parmer, N. J. Schork, D. T. O'Connor, and P. A. Insel Genetic Variation at the Human {alpha}2B-Adrenergic Receptor Locus: Role in Blood Pressure Variation and Yohimbine Response Hypertension, June 1, 2005; 45(6): 1207 - 1213. [Abstract] [Full Text] [PDF]

				C. Hosoda, T.-a. Koshimizu, A. Tanoue, Y. Nasa, R. Oikawa, T. Tomabechi, S. Fukuda, H. Shinoura, S. Oshikawa, S. Takeo, et al. Two {alpha}1-Adrenergic Receptor Subtypes Regulating the Vasopressor Response Have Differential Roles in Blood Pressure Regulation Mol. Pharmacol., March 1, 2005; 67(3): 912 - 922. [Abstract] [Full Text] [PDF]

				F. Schwartz, A. Duka, I. Duka, J. Cui, and H. Gavras Novel targets of ANG II regulation in mouse heart identified by serial analysis of gene expression Am J Physiol Heart Circ Physiol, November 1, 2004; 287(5): H1957 - H1966. [Abstract] [Full Text] [PDF]

				J. Tank, J. Jordan, A. Diedrich, M. Obst, R. Plehm, F. C. Luft, and V. Gross Clonidine Improves Spontaneous Baroreflex Sensitivity in Conscious Mice Through Parasympathetic Activation Hypertension, May 1, 2004; 43(5): 1042 - 1047. [Abstract] [Full Text] [PDF]

				F. von Wowern, K. Bengtsson, U. Lindblad, L. Rastam, and O. Melander Functional Variant in the {alpha}2B Adrenoceptor Gene, a Positional Candidate on Chromosome 2, Associates With Hypertension Hypertension, March 1, 2004; 43(3): 592 - 597. [Abstract] [Full Text] [PDF]

				N. Peng, B. D. Chambless, S. Oparil, and J. M. Wyss {alpha}2A-Adrenergic Receptors Mediate Sympathoinhibitory Responses to Atrial Natriuretic Peptide in the Mouse Anterior Hypothalamic Nucleus Hypertension, March 1, 2003; 41(3): 571 - 575. [Abstract] [Full Text] [PDF]

				C. Plut, C. Ribiere, Y. Giudicelli, and J.-P. Dausse Gender Differences in Hypothalamic Tyrosine Hydroxylase and alpha 2-Adrenoceptor Subtype Gene Expression in Cafeteria Diet-Induced Hypertension and Consequences of Neonatal Androgenization J. Pharmacol. Exp. Ther., August 1, 2002; 302(2): 525 - 531. [Abstract] [Full Text] [PDF]

				M. Philipp, M. Brede, and L. Hein Physiological significance of alpha 2-adrenergic receptor subtype diversity: one receptor is not enough Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2002; 283(2): R287 - R295. [Abstract] [Full Text] [PDF]

				A. Tanoue, M. Koba, S. Miyawaki, T.-a. Koshimizu, C. Hosoda, S. Oshikawa, and G. Tsujimoto Role of the {alpha}1D-Adrenegric Receptor in the Development of Salt-Induced Hypertension Hypertension, July 1, 2002; 40(1): 101 - 106. [Abstract] [Full Text] [PDF]

				B. J. A. Janssen and J. F. M. Smits Autonomic control of blood pressure in mice: basic physiology and effects of genetic modification Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2002; 282(6): R1545 - R1564. [Abstract] [Full Text] [PDF]

				M. Khalid, N. Ilhami, Y. Giudicelli, and J.-P. Dausse Testosterone Dependence of Salt-Induced Hypertension in Sabra Rats and Role of Renal alpha 2-Adrenoceptor Subtypes J. Pharmacol. Exp. Ther., January 1, 2002; 300(1): 43 - 49. [Abstract] [Full Text] [PDF]

				C. A. Fairbanks, L. S. Stone, K. F. Kitto, H. O. Nguyen, I. J. Posthumus, and G. L. Wilcox alpha 2C-Adrenergic Receptors Mediate Spinal Analgesia and Adrenergic-Opioid Synergy J. Pharmacol. Exp. Ther., January 1, 2002; 300(1): 282 - 290. [Abstract] [Full Text] [PDF]

				M. Khalid, Y. Giudicelli, and J.-P. Dausse An Up-Regulation of Renal alpha 2A-Adrenoceptors Is Associated with Resistance to Salt-Induced Hypertension in Sabra Rats J. Pharmacol. Exp. Ther., December 1, 2001; 299(3): 928 - 933. [Abstract] [Full Text] [PDF]

				E. Kintsurashvili, I. Gavras, C. Johns, and H. Gavras Effects of Antisense Oligodeoxynucleotide Targeting of the {alpha}2B-Adrenergic Receptor Messenger RNA in the Central Nervous System Hypertension, November 1, 2001; 38(5): 1075 - 1080. [Abstract] [Full Text] [PDF]

				S. Guimaraes and D. Moura Vascular Adrenoceptors: An Update Pharmacol. Rev., June 1, 2001; 53(2): 319 - 356. [Abstract] [Full Text] [PDF]

				J. W. Kable, L. C. Murrin, and D. B. Bylund In Vivo Gene Modification Elucidates Subtype-Specific Functions of alpha 2-Adrenergic Receptors J. Pharmacol. Exp. Ther., April 1, 2000; 293(1): 1 - 7. [Abstract] [Full Text]

				K. P. Makaritsis, C. Johns, I. Gavras, and H. Gavras Role of {alpha}2-Adrenergic Receptor Subtypes in the Acute Hypertensive Response to Hypertonic Saline Infusion in Anephric Mice Hypertension, February 1, 2000; 35(2): 609 - 613. [Abstract] [Full Text] [PDF]

				C. C. Lim, R. Liao, N. Varma, and C. S. Apstein Impaired lusitropy-frequency in the aging mouse: role of Ca2+-handling proteins and effects of isoproterenol Am J Physiol Heart Circ Physiol, November 1, 1999; 277(5): H2083 - H2090. [Abstract] [Full Text] [PDF]

				K. P. Makaritsis, C. Johns, I. Gavras, J. D. Altman, D. E. Handy, M. R. Bresnahan, and H. Gavras Sympathoinhibitory Function of the {alpha}2A-Adrenergic Receptor Subtype Hypertension, September 1, 1999; 34(3): 403 - 407. [Abstract] [Full Text] [PDF]

				K. M. Small, K. M. Brown, S. L. Forbes, and S. B. Liggett Polymorphic Deletion of Three Intracellular Acidic Residues of the alpha 2B-Adrenergic Receptor Decreases G Protein-coupled Receptor Kinase-mediated Phosphorylation and Desensitization J. Biol. Chem., February 9, 2001; 276(7): 4917 - 4922. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Makaritsis, K. P. Articles by Gavras, H. Search for Related Content PubMed PubMed Citation Articles by Makaritsis, K. P. Articles by Gavras, H. Pubmed/NCBI databases Gene GEO Profiles HomoloGene UniGene Compound via MeSH Substance via MeSH Medline Plus Health Information Dietary Sodium High Blood Pressure Related Collections Nutrition Other hypertension Gene expression