Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 1999;33:530-536

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Durgam, V. R.
Right arrow Articles by Mifflin, S. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Durgam, V. R.
Right arrow Articles by Mifflin, S. W.

(Hypertension. 1999;33:530-536.)
© 1999 American Heart Association, Inc.


Scientific Contributions

Enhanced {gamma}-Aminobutyric Acid–B Receptor Agonist Responses and mRNA Within the Nucleus of the Solitary Tract in Hypertension

Vijayender Rao Durgam; Melissa Vitela; Steven W. Mifflin

From the Department of Pharmacology, The University of Texas Health Science Center at San Antonio.

Correspondence to Vijayender R. Durgam, PhD, Department of Pharmacology, The University of Texas Health Science Center, 7703 Floyd Curl Dr, San Antonio, TX 78284-7764. E-mail durgam{at}uthscsa.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract{gamma}-Aminobutyric acid–B (GABAB) receptor function and regulation in the nucleus of the solitary tract (NTS) was examined in Sprague-Dawley rats made chronically (4 to 5 weeks) hypertensive with the one-kidney, figure-8 renal wrap model of hypertension. NTS microinjection of the GABAB agonist baclofen produced a pressor response that was enhanced in hypertensive rats compared with the response observed in sham-operated normotensive rats (36±4 mm Hg increase in mean arterial pressure in 8 hypertensive rats compared with 21±2 mm Hg increase in 7 sham-operated normotensive rats, P=0.03). Responses to microinjection of GABAB antagonists (CGP-55845A and SCH-90511), the GABAA agonist muscimol, the GABAA antagonist bicuculline, and the GABA reuptake inhibitor nipecotic acid were not different comparing normotensive sham-operated and hypertensive rats. Renal sympathetic nerve responses to NTS microinjection of these drugs were not different in hypertensive compared with normotensive rats. Micropunches of the NTS were homogenized and reverse transcriptase–polymerase chain reaction was performed to examine mRNA levels for the GABAB receptor. There was a 3-fold increase in GABAB receptor mRNA levels in the caudal NTS of 7 chronically hypertensive rats compared with levels measured in 8 sham-operated normotensive rats (P=0.01). In conclusion, chronic hypertension is associated with an upregulation of GABAB receptor function; however, the tonic activity of the system does not appear to be different between normotensive and hypertensive rats. The upregulation of GABAB receptor function might be due to an increased number of receptors, as suggested by the elevated levels of GABAB receptor mRNA measured in the NTS of hypertensive rats. All of these alterations suggest that hypertension is associated with dynamic changes in receptor-mediated mechanisms within the NTS, and these alterations could modify baroreflex regulation of cardiovascular function in hypertension.


Key Words: kidney • tractus solitarius • hypertension, renal • receptors, aminobutyric acid • baclofen • reverse transcriptase


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The nucleus of the solitary tract (NTS) is the brain stem nucleus where baroreceptor afferent fibers make their initial synapse within the central nervous system. Therefore, information regarding the physiology and pharmacology of NTS neurons is critical to our understanding of baroreflex regulation of cardiovascular function. The region of the NTS where baroreceptor afferents terminate contains a high density of both {gamma}-aminobutyric acid–A (GABAA) and GABAB receptors.1 2 A number of in vivo microinjection studies3 4 5 6 as well as in vivo7 8 9 and in vitro10 11 single unit electrophysiological experiments have demonstrated that both GABAA and GABAB receptors play an important role in the integration of baroreceptor afferent inputs and baroreflex function. Since activation of GABAA receptors evokes postsynaptic inhibition and activation of GABAB receptors evokes both presynaptic and postsynaptic inhibition of NTS neurons,10 microinjection of either GABAA or GABAB agonists into the NTS inhibits NTS neurons, which results in an inhibition of the baroreflex and an increase in mean arterial pressure (MAP). Conversely, NTS microinjection of GABAA or GABAB antagonists removes tonic GABAergic inhibition of NTS neurons and results in a fall in arterial pressure.

There is little information regarding adaptive changes in the physiology and pharmacology of NTS neurons in pathological states such as chronic hypertension. Of note are a series of studies by Sved and colleagues6 12 13 14 that demonstrated an enhanced pressor response to activation of GABAB receptors within the NTS in spontaneously hypertensive rat (SHR)6 12 13 14 and deoxycorticosterone acetate (DOCA)–salt14 models of hypertension. Conversely, blockade of GABAB receptors evoked a greater fall in arterial pressure in both models of hypertension compared with normotensive Wistar-Kyoto rats.14 NTS microinjections of the excitatory amino acid glutamate or drugs that activate or antagonize GABAA receptors produce similar changes in arterial pressure in normotensive and hypertensive rats. All of these data suggest that within the NTS of SHR and DOCA-salt hypertensive rats, there is a tonically enhanced GABAB receptor system. Since microinjection of GABAB agonists into the NTS of normotensive rats shifts the baroreflex to higher pressures,13 a tonically enhanced GABAB input to the NTS of hypertensive animals could reset the baroreflex to higher pressures and contribute to the maintenance of hypertension.

The goals of the present study were to determine whether alterations in GABAB receptor function occur in another model of hypertension—one-kidney, figure-8 renal wrap hypertension—and then to examine a possible mechanism for any observed alterations. In the present study we examined GABAB receptor function in the NTS in this model of hypertension using microinjection techniques. We also examined whether chronic hypertension altered GABAB receptor mRNA by quantitation of mRNA for the receptor using quantitative, competitive reverse transcriptase–polymerase chain reaction (RT-PCR).15 Our results indicate enhanced pressor responses to NTS microinjection of GABAB agonists but not antagonists in hypertensive compared with sham-operated animals. In addition, GABAB mRNA levels in the NTS were elevated in hypertensive compared with sham-operated animals. Both of these findings suggest an alteration in GABAB receptor function and regulation within the NTS in chronic hypertension.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Microinjection Experiments
Adult male Sprague-Dawley rats (350 to 500 g, n=124) were used in the present studies. Experiments were performed using both the Charles River (n=93) and Harlan (n=31) strains. Cardiovascular responses did not differ between the 2 strains, so the data were pooled. All procedures were approved by the Institutional Animal Care and Use Committee. Anesthesia was induced by an intraperitoneal injection of medetomidine (0.5 mg/kg, Pfizer) and ketamine (75 mg/kg, Fort Dodge Laboratory). To induce hypertension, the rats were subjected to the figure-8 Grollman renal wrap procedure combined with contralateral nephrectomy.16 17 Sham-operated rats were similarly anesthetized and received unilateral nephrectomy alone. At the conclusion of surgery, anesthesia was terminated by intraperitoneal injection of atipamezole (Antisedan) (1 mg/kg, Pfizer). All studies were performed 4 to 5 weeks after the induction of hypertension.

Experiments were performed on rats anesthetized with intraperitoneal injections of either {alpha}-chloralose (80 mg/kg)/urethane (800 mg/kg, n=107) or thiobutabarbital (100 mg/kg, n=17). MAP and renal sympathetic nerve activity (RSNA) responses were not different between the 2 anesthetics, so the data were pooled for analysis. After induction of anesthesia, a femoral artery and vein were cannulated for measurement of arterial pressure and injection of drugs, respectively. Supplemental anesthetic was administered intravenously as determined by the stability of arterial pressure and heart rate with rats under resting conditions and during a pinch of the hind paw. The trachea was intubated and the animal placed in a stereotaxic head frame. After removal of overlying muscles, an occipital craniotomy was performed to expose the caudal medulla. Rectal temperature was monitored and maintained at 37±1°C using a heating pad that circulated warm water. The tracheal cannula was connected to a small-animal respirator (Harvard Apparatus), and positive-pressure ventilation was begun using room air supplemented with 100% O2. To minimize respiratory movements of the brain stem and respiratory fluctuations in arterial pressure, the animal was paralyzed by an intravenous injection of gallamine (10 to 20 mg), supplemented as needed, typically hourly, and given a pneumothorax. Since this paralytic agent has antimuscarinic properties, heart rate responses were minimal or absent and were not analyzed.

The renal sympathetic nerve was approached retroperitoneally via a flank incision. The nerve was isolated contralaterally to the nephrectomy and placed on bipolar, polytetrafluoroethylene-coated platinum wires with the ends bared. RSNA was measured with a Grass high-impedance probe (HIP-511) and amplified with a Grass P5 series AC amplifier. The output was rectified and integrated (Coulbourn S76 to 01) at time constants of 20 to 50 milliseconds. The zero level of RSNA was designated as the activity that remained after an intravenous injection of phenylephrine sufficient to raise MAP by 40 to 50 mm Hg and silence ongoing discharge in the nerve. The zero level of RSNA was subtracted from the resting RSNA, and this level was designated 100%. Changes in RSNA were expressed as a percentage change from the resting level of 100%.

We repeated the microinjection protocol described by Sved and Tsukamoto.13 14 A bipolar stimulating electrode was placed in the NTS using coordinates provided by these authors (0.5 mm caudal to the calamus, 0.5 mm lateral to the midline, and 0.5 mm below the surface of the brain). Using this electrode, an electrolytic lesion was placed in the right NTS to eliminate reflex buffering of responses to drugs injected into the left NTS. After a recovery period of 30 to 60 minutes, a glass micropipette (outer tip diameter<50 µm) filled with the drug being injected was placed into the contralateral NTS using the same stereotaxic coordinates. Drugs were injected slowly over 1 to 3 minutes using a pressurized source (WPI, Pneumatic Picopump PV800), and cardiovascular parameters were measured using a MacLab A/D system.

GABA agonists and antagonists were dissolved in artificial cerebrospinal fluid, and pH was adjusted to 7.4. The following drugs were microinjected in a 100-nL volume: baclofen (40 pmol), CGP-55845A (1 nmol), SCH-90511 (1 nmol), muscimol (100 pmol), bicuculline methiodide (10 pmol), and nipecotic acid (10 nmol). The doses of agonists used were determined in preliminary experiments (n=4 to 5 for each drug) and were taken as the dose that produced 70% to 80% of the maximal response. The doses of antagonists used were determined in preliminary experiments and were taken as the dose that reduced the response to microinjection of a selective agonist by >90%.

Arterial pressure, heart rate, and RSNA (both raw and integrated) were viewed and saved for off-line analysis using a MacLab A/D system. Statistical significance was determined using ANOVA with Scheffé's post hoc test for comparisons. All values are expressed as mean±SEM.

Molecular Analyses
Experiments were performed on adult, male Sprague-Dawley rats of the Charles River strain (350 to 460 g, n=15) 4 weeks after induction of hypertension as previously described. Two days before the experiment, an arterial catheter was placed in the femoral artery while the animal was under medetomidine/ketamine anesthesia (0.5 mg/kg IP and 75 g/kg IP, respectively). After a 2-day recovery period, blood pressure of the conscious animal was measured by connecting the arterial catheter to a pressure transducer (Kobe) and displayed using MacLab or Cambridge Electronic Design A/D converters. Blood pressure was measured for 3 hours, and measurements made during the last hour were used as an index of resting arterial pressure and heart rate.

The methods for quantitative, competitive RT-PCR from brain micropunches were recently described in detail.15 Briefly, after measurement of conscious MAP and heart rate, rats were anesthetized with pentobarbital (50 mg/kg IP) and the brain stem was quickly removed and frozen in isopentane cooled on dry ice. Using a rodent brain slicer (Brain Tree Scientific, BS 200), a 1-mm-thick section of the caudal medulla was obtained from the calamus to 1 mm caudal to the calamus. The section, still mounted on the razor blade, was frozen under liquid nitrogen to avoid RNA degradation. Using a blunt-end, 20-gauge stainless steel piece of hypodermic tubing (Small Parts Inc), bilateral punches of the NTS were removed under RNase-free conditions. RNA was isolated as per the manufacturer's protocol (Sigma Chemical Co), and RT was carried out in 20-µL volumes using oligo(dT) and MuLV reverse transcriptase according to the manufacturer's protocol (Gene Amp RNAPCR kit, Perkin-Elmer). The internal standard was synthesized by PCR using the method of Celi et al.18a The GABAB receptor primers were designed from the cDNA sequence (Gene Bank No. Y10369) that amplifies both GABAB-R1a and GABAB-R1b subtypes. Three primers were synthesized. Primer A (GTGACCATGATCCTTTCCAG) consisted of 20 bases corresponding to the 5' sequence (from 2461 to 2480 bp), and primer B (CAACAGTCGGGACTTCTCTT) consisted of 20 bases corresponding to the opposite strand of the target at the 3' sequence (from 2670 to 2651 bp) and at a predetermined distance from primer A. Amplification using these two primers resulted in a 209-bp PCR product. Another primer, primer C (CAACAGTCGGGACTTCTCTTTCATGGTGTCCTGCGTTTCA), was approximately 40 bp in length: 24 nucleotides at the 3' end corresponding to primer B and 24 nucleotides from the opposite strand of the target sequence upstream from primer B (from 2620 to 2601 bp). Amplification from primers A and C resulted in a 159-bp PCR product, which was used as an internal standard.

PCR was performed in 50-µL volumes using a thermal cycler (PTC 100, MJ Research). The PCR cycle used for the amplification started with an initial denaturation step at 95°C for 3 minutes; followed by 95°C for 1 minute, 60°C for 1 minute, and 72°C for 2 minutes for 35 cycles; and a final elongation step of 72°C for 7 minutes. Both products arising from amplification of target message and internal standard were then separated on 2% agarose gels, stained with ethidium bromide, and photographed (DS 34, Polaroid). The photograph was scanned (Scanjet 4C, Hewlett-Packard) and mass measured using a scientific imaging system (Kodak 1D analysis software). The mRNA levels were measured as the mass ratio of the target message to that of internal standard using an appropriate mass ladder with known molecular weights (low mass DNA ladder, BRL). Statistical significance was determined using ANOVA with Scheffé's post hoc test for comparisons. All values are expressed as mean±SEM.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Microinjection Experiments
Using the protocol established by Sved and Tsukamoto,13 14 we lesioned one side of the NTS and microinjected 100 nL of drug into the contralateral NTS. Control injections of artificial cerebrospinal fluid produced inconsistent changes in MAP of <5 mm Hg in both sham-operated normotensive and hypertensive rats. In sham-operated rats, injection of the GABAB agonist baclofen increased MAP from 101±3 to 122±3 mm Hg (n=7) (Figure 1Down and TableDown). In hypertensive rats, identical injections increased MAP from 132±3 to 168±5 mm Hg (n=8). The increase in pressure was significantly greater in the hypertensive (36±4 mm Hg) compared with the sham-operated (21±2 mm Hg) rats (P<0.01) (TableDown). This enhanced responsiveness was selective for the GABAB agonist, as results using the GABAA agonist muscimol revealed no such enhanced responsiveness in the hypertensive animals (increase in MAP of 21±2 mm Hg in 9 sham-operated rats and increase of 26±3 mm Hg in 7 hypertensive rats) (TableDown). These results suggest that in hypertensive animals there is a selective increase in the responses to GABAB agonists. Control and response values of MAP are given in the TableDown.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 1. A, Pulsatile arterial pressure (AP), MAP, and RSNA responses to microinjection of baclofen into NTS during the period indicated by vertical dashed lines. Raw RSNA is presented before rectification and averaging. B, Cresyl violet–stained section of caudal NTS illustrating extent of electrolytic lesion on right side of brain and local tissue damage resulting from several microinjections into NTS (arrow on left side of brain). Calibration bar=200 µm.


View this table:
[in this window]
[in a new window]
 
Table 1. Group Responses to Microinjection of GABA Receptor Agonists and Antagonists Into the NTS

There was also no difference in the responses to NTS microinjections of the GABAB antagonists CGP-55845A (decrease in MAP of 21±4 mm Hg in 7 sham-operated rats and decrease of 19±3 mm Hg in 11 hypertensive rats) and SCH-90511 (decrease in MAP of 17±2 mm Hg in 11 sham-operated rats and decrease of 19±3 mm Hg in 6 hypertensive rats) (TableUp). In addition, there were also no differences in the responses to NTS microinjections of the GABAA antagonist bicuculline (decrease in MAP of 22±2 mm Hg in 9 sham-operated rats and decrease of 20±2 mm Hg in 8 hypertensive rats) or the GABA uptake inhibitor nipecotic acid (increase in MAP of 25±3 mm Hg in 9 sham-operated rats and increase of 24±2 mm Hg in 9 hypertensive rats) (TableUp).

To examine whether enhanced sympathetic nerve responses mediated the enhanced responses to NTS microinjection of GABAB agonists in hypertensive rats, we measured RSNA responses during such injections. Microinjection of baclofen increased RSNA by 13±4% in 6 sham-operated rats and by 13±2% in 8 hypertensive rats. Microinjection of CGP-55845A decreased RSNA by 14±8% in 6 sham-operated rats and by 13±6% in 8 hypertensive rats, and microinjection of SCH-90511 decreased RSNA by 12±6% in 5 sham-operated rats and by 16±5% in 5 hypertensive rats. None of the RSNA responses were significantly different when sham-operated animals were compared with the renal wrap hypertensive animals.

RT-PCR Analysis of GABAB mRNA in NTS
MAP and heart rate of sham-operated animals were 100±5 mm Hg and 360±5 beats/min (n=8), respectively, and MAP and heart rate of renal wrapped animals were 134±6 mm Hg and 365±7 beats/min (n=7). Differences in MAP were significant (P=0.001), and differences in heart rate were not (P=0.585). A standard curve was constructed and demonstrates a linear relationship between the log of the mass ratio of target template and internal standard and the log of the amount of target template added (Figure 2Down), indicating similar amplification efficiencies for the target template and internal standard. The mRNA levels measured in 100 ng RNA isolated from the micropunches of caudal NTS from sham-operated and renal wrap animals are presented in Figure 3Down. The mass ratios of the target template (209 bp) to internal standard (159 bp) were significantly greater in hypertensive animals (4.13±0.99) compared with those of sham-operated animals (1.30±0.19) (P=0.010). This demonstrates that there is an increased level of GABAB mRNA in the NTS of hypertensive animals compared with sham-operated normotensive animals.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 2. A, Standard curve for GABAB mRNA. Curve constructed by plotting the log mass ratios of wild template (209 bp) to that of internal standard (159 bp) against the log input of the wild template. B, Typical gel from which standard curve was derived, showing separation of PCR products of wild-type and internal standard on a 2% agarose gel. Pairs of bands illustrate varying amounts, from 6.25 to 50 pg, of the wild template (top bands, 209 bp) with a constant amount, 25 pg, of internal standard (bottom bands, 159 bp). Note the inverse relationship between the brightness of the wild-type bands, reflecting relative abundance of the endogenous message, and the brightness of the internal standard bands.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 3. A, Population means for log mass ratios of GABAB mRNA for sham-operated normotensive (shaded bar) and renal wrap hypertensive (open bar) rats. Numbers in each bar indicate number of animals from which samples were obtained. B, Gel run from samples obtained from 2 normotensive sham-operated animals and 2 hypertensive animals.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The results of the present study demonstrate that within the NTS in the one-kidney, figure-8 renal wrap model of hypertension, GABAB receptor responses to agonist are enhanced and the enhanced responses are associated with an increased level of GABAB mRNA. The results of the present study differ from those of previous studies regarding the role of GABAB receptors in hypertension in several respects.6 14 18 For example, the present study found no difference in the responses of hypertensive animals to GABAB antagonists and nipecotic acid. Such differences could be related to the strain or source of rat, the model of hypertension, and/or the type of anesthetic used in the present study. For these reasons, we used two different sources of rat, two different GABAB receptor antagonists, and two different anesthetic protocols. Varying these factors did not reveal any difference in response; however, the differences could be related to any of a myriad of other physiological, pharmacological, or methodological factors.

Enhanced Response to GABAB Agonist in Hypertension
In general, the present results are consistent with those of previous studies that demonstrated a selective enhancement of GABAB responses in the NTS of SHR and DOCA-salt hypertensive rats,14 in that a similar phenomenon occurs in the one-kidney, figure-8 renal wrap model of hypertension. Therefore, alterations within the NTS in the MAP responses to activation of the GABAB receptor system, but not in the MAP responses to activation of GABAA receptors, might be a general characteristic of chronic hypertension. However, in the present study, no difference was found between normotensive and hypertensive rats in their responses to NTS microinjection of GABAB antagonists. This has important functional implications as it suggests that unlike the SHR and DOCA-salt models of hypertension, in one-kidney, figure-8 renal wrap hypertension GABAB receptor function is not tonically elevated. A tonic increase in GABAB receptor function, inferred from the enhanced response to injection of a GABAB antagonist in SHR and DOCA-salt hypertensive rats, has been suggested as a possible contributor to baroreflex resetting in hypertension.13 However, it is difficult to reconcile this suggestion with the observation that DOCA-salt hypertensive rats, while exhibiting the enhanced response to NTS microinjection of GABAB agonists and antagonists, do not exhibit an attenuated aortic depressor reflex.18 Therefore, it is difficult to determine the functional significance of tonically enhanced GABAB receptor responses as far as baroreflex function is concerned.

The observation that the enhanced pressor response to microinjection of baclofen into the NTS was not accompanied by an enhanced percentage increase in RSNA presents several possible interpretations. The first is that baroreceptor inhibition of sympathetic nerve activity (SNA) under resting conditions is similar in normotensive and hypertensive rats, and the enhanced pressor response results from an augmented release of a circulating hormone. An earlier study by Sved and Sved12 found that the amplitude and duration of the pressor response that followed the microinjection of baclofen into the NTS was significantly reduced after the intravenous administration of a vasopressin antagonist. Therefore, the augmented pressor response could be due to enhanced vasopressin release in hypertensive rats. This would lead one to predict that the augmented depressor response to NTS microinjections of GABAB antagonists reported previously14 is due to enhanced inhibition of vasopressin release. Since in conscious animals resting plasma vasopressin levels are normally very low,19 enhanced inhibition would require an increase in the circulating level in hypertension. In the model of hypertension used in the present study, resting vasopressin levels were elevated in hypertensive rats fed a high sodium diet19 ; however, no difference was observed between normotensive and hypertensive rats fed a normal sodium diet (J.R. Haywood, personal communication, 1998). Therefore, the possibility that the enhanced pressor response is due to enhanced vasopressin release does not appear likely.

A second possible interpretation is that enhanced sympathetic responses occur in other beds. We did not test the responses of other sympathetic nerves, so we cannot exclude this possibility. A third possible interpretation is that the current methods for analysis of sympathetic nerve responses are inadequate to make such between-group comparisons, without a simultaneous measure of end-organ flow or resistance. Because the measure of SNA is not absolute but is relative to the resting level and zero level determined for each animal, the occurrence of a shift in the basal level of SNA between normotensive and hypertensive animals cannot be determined. Indirect measures suggest that SNA is elevated in hypertension, as ganglionic blockade produces a greater fall in MAP in one-kidney, figure-8 renal wrap hypertensive rats compared with sham-operated normotensive rats.17 Therefore, the same percentage increase in SNA could produce an enhanced vasoconstriction if baseline SNA is elevated in hypertension.

Mechanism for Enhanced Responses to GABAB Agonist in Hypertension
A variety of physiological and pharmacological mechanisms could underlie the enhanced responses to activation of GABAB receptors within the NTS observed in this and previous studies. The enhanced pressor response could be the result of increased baroreceptor afferent input to the NTS in hypertension. This increased baroreceptor discharge could increase the discharge of NTS neurons, which would result in enhanced sympathoinhibitory output from the NTS. Under these conditions, the pharmacological inhibition of the NTS, by injection of baclofen, would result in a greater increase in MAP compared with the situation when the sympathoinhibitory output of the NTS is not as great, as in normotension. However, if this were the case one might predict that the effects of any agent that inhibits NTS neurons, eg, muscimol, would be enhanced in hypertension. Clearly, this was not the case in the present and previous6 studies.

Pharmacological mechanisms for the enhanced pressor response include alterations in the number and/or affinity of GABAB receptors. Singh and Ticku20 reported enhanced baclofen binding in the NTS of SHR, and the increase in mRNA for the GABAB receptor that we observed suggests that the number of GABAB receptors in chronically hypertensive rats increases. Unfortunately, at present an antibody that would permit immunoblotting (Western) or immunoprecipitation analyses of the GABAB receptor protein directly in our micropunches of NTS is not commercially available. Therefore, this question will remain unresolved until such antibodies are available or a radioligand binding study is performed.

To gain some insight into the molecular regulation of the GABAB receptor in hypertension, we analyzed mRNA for the receptor. We found a dramatic increase in GABAB mRNA level after 4 weeks of hypertension. Assuming that this mRNA is translated into functional receptor protein, such an increase could result in an enhanced response to GABAB receptor agonist. Several factors could induce an increase in GABAB receptor mRNA. Increases in synaptic inputs to neurons have been shown to alter gene expression,21 22 23 and the elevated baroreceptor input to NTS neurons might initiate transcription of GABAB receptor mRNA. Circulating hormones have also been shown to alter gene expression,24 25 26 and altered levels of angiotensin or catecholamines17 in chronic hypertension could induce an increased expression of GABAB receptor mRNA. The precise stimulus, or stimuli, that induces the increased GABAB mRNA levels in chronic hypertension will be the focus of future studies.

Significance
In chronic one-kidney, figure-8 renal wrap hypertension, there is an enhanced response to the NTS microinjection of the GABAB agonist baclofen. This suggests an upregulation of receptor function in this model of chronic hypertension. However, the responses to microinjection of GABAB receptor antagonists are not different when comparing normotensive and hypertensive rats; therefore, it does not appear that there is a tonic "overactivation" of GABAB receptors in this model of hypertension. The chronic hypertension is associated with an increased level of GABAB receptor mRNA in the caudal NTS.

Insights into the functional significance of alterations in GABAB receptor function in hypertension will require more information regarding the specific changes that occur in identified cells within this region. For example, from the present data, we cannot discern whether the increase in GABAB mRNA occurs in cells that already possess the receptor or whether it represents expression in a population that previously did not express the receptor. We cannot determine whether the increase in GABAB mRNA is a generalized occurrence among NTS neurons or whether the changes occur in a restricted subpopulation of NTS neurons. Our recent iontophoretic study examining the responses of NTS neurons to GABA receptor agonists found that cells which presumably received a monosynaptic aortic depressor nerve input were only slightly inhibited by baclofen, whereas cells receiving a polysynaptic input were markedly inhibited by the GABAB agonist.27 The data presented here might reflect a selective increase in the expression of GABAB receptor in the monosynaptic population that could enhance inhibitory effects of exogenously applied agonist.

Of course, the important question is what do these changes tell us about the role of endogenous GABA in hypertension? Changes in GABAB receptor function might serve a protective role and prevent overactivation of NTS neurons in response to an increase in pressure and resulting increase in baroreceptor afferent discharge. Overactivation of neurons can lead to depolarization inactivation and, in the face of prolonged depolarization, cell death.28 Numerous electrophysiological studies have found that in many NTS neurons, activation of baroreceptor afferent inputs evokes a negative feedback inhibition of discharge that limits the duration of the initial excitatory input.29 30 This feedback inhibition appears to be primarily mediated by activation of both GABAA and GABAB receptors,31 although other mechanisms could also be involved. Enhancement of the GABAB component of the feedback inhibition could serve a protective function.

Alternatively, changes in GABAB receptor function might serve to dampen excitatory inputs and maintain normal baroreflex buffering in the face of increased arterial pressure. In the absence of any adaptive changes in the baroreflex, resting RSNA would be near zero in hypertensive animals. However, a preliminary examination of baroreflex curves in normotensive and hypertensive rats has shown that in hypertensive animals, the curve is shifted to higher MAP values, with no change in gain around the new operating point (M.V. and S.W.M., unpublished observations, 1998). Adaptive changes within the NTS, such as those described here for the GABAB receptor system, could serve to maintain the operating point of the baroreflex in a linear region of the right-shifted reflex curve in hypertensive animals. However, as previously discussed, it is difficult to reconcile a role for GABAB receptors in baroreflex resetting given the lack of tonically enhanced GABAB receptor function. This is indicated by the similar responses of normotensive and hypertensive rats to antagonist, observed in the present study, and the lack of baroreflex resetting in DOCA-salt hypertensive rats, which exhibit enhanced responses to GABAB antagonists.18

Finally, changes in GABAB receptor function could contribute to the attenuated baroreflex inhibition of cardiovascular function observed in hypertension. During sustained stimulation of the aortic nerve, a significant degree of adaptation was observed in the steady-state depressor response evoked in hypertensive rats compared with normotensive rats, and this enhanced adaptation was blocked by NTS microinjection of GABAB antagonist.18 We have observed a similar enhanced adaptation of aortic nerve–evoked depressor responses in one-kidney, figure-8 renal wrap hypertensive rats (J. Zhang and S.W.M., unpublished observations, 1998). Enhanced GABAB receptor function could also mediate the enhanced adaptation, which results in attenuation of steady-state baroreflex responses, in this model of hypertension. It is interesting to consider that this would not require tonic activation of an enhanced GABAB receptor system. Our observation that GABAB antagonist responses are not increased suggests that there is no tonically enhanced activation of the GABAB receptor system in this model of hypertension. The enhanced responses would be evident only during increases in pressure and activation of baroreceptor afferent inputs, beyond the new, hypertensive operating point of the reflex.

The functional significance of the changes described here for the GABAB receptor system within the NTS of hypertensive animals could be (1) that the changes dampen responses to increases in afferent input to protect the neurons from overactivation, (2) that the changes permit normal baroreflex buffering of changes in MAP, even in the face of persistently elevated MAP, and/or (3) that the changes contribute to attenuated steady-state baroreflex inhibition in hypertensive animals. The results of the present study demonstrate that changes in physiological state can result in functional alterations in neurotransmitter systems within the NTS, and these alterations can be associated with alterations in the regulation of neurotransmitter systems within the NTS at the level of the gene.


*    Acknowledgments
 
This work was supported by grant HL-56637 from the National Institutes of Health. The authors gratefully acknowledge the expert technical assistance of Myrna Herrera-Rosales and Gail Clark.

Received September 16, 1998; first decision October 12, 1998; accepted November 2, 1998.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Bowery NG, Hudson AL, Price GW. GABAA and GABAB receptor binding site distribution in the rat central nervous system. Neuroscience. 1987;20:365–383.[Medline] [Order article via Infotrieve]

2. Barron KW, Pavelka SM, Garrett KM. Diazepam-sensitive GABAA receptors in the NTS participate in cardiovascular control. Brain Res. 1997;773:53–60.[Medline] [Order article via Infotrieve]

3. Kubo T, Kihara M. Evidence for the presence of GABAergic and glycine-like systems responsible for cardiovascular control in the nucleus tractus solitarii of the rat. Neurosci Lett. 1987;74:331–336.[Medline] [Order article via Infotrieve]

4. Kubo T, Kihara M. Evidence for GABA receptor-mediated modulation of the aortic baroreceptor reflex in the nucleus tractus solitarii of the rat. Neurosci Lett. 1988;89:156–160.[Medline] [Order article via Infotrieve]

5. Florentino A, Varga K, Kunos G. Mechanism of the cardiovascular effects of GABAB receptor activation in the nucleus tractus solitarii of the rat. Brain Res. 1990;535:264–270.[Medline] [Order article via Infotrieve]

6. Catelli JM, Sved AF. Enhanced pressor response to GABA in the nucleus tractus solitarii of the spontaneously hypertensive rat. Eur J Pharmacol. 1988;151:243–248.[Medline] [Order article via Infotrieve]

7. Jordan D, Mifflin SW, Spyer KM. Hypothalamic inhibition of neurones in the nucleus tractus solitarius of the cat is GABA mediated. J Physiol (Lond). 1988;399:389–404.[Abstract/Free Full Text]

8. Suzuki M, Kuramochi T, Suga T. GABA receptor subtypes involved in the neuronal mechanisms of baroreceptor reflex in the nucleus tractus solitarii of rabbits. J Auton Nerv Sys. 1993;43:27–36.[Medline] [Order article via Infotrieve]

9. Ruggeri P, Cogo CE, Picchio V, Molinari C, Ermirio R, Calaresu FR. Influence of GABAergic mechanisms on baroreceptor inputs to nucleus tractus solitarii of rats. Am J Physiol. 1996;271:H931–H936.[Abstract/Free Full Text]

10. Brooks PA, Glaum SR, Miller RJ, Spyer KM. The actions of baclofen on neurones and synaptic transmission in the nucleus tractus solitarius of the rat in vitro. J Physiol (Lond). 1992;457:115–129.

11. Brooks PA, Glaum SR. GABAB receptors modulate a tetanus-induced sustained potentiation of monosynaptic inhibitory transmission in the rat nucleus tractus solitarii in vitro. J Auton Nerv Sys. 1995;54:16–26.

12. Sved JC, Sved AF. Cardiovascular responses elicited by gamma-aminobutyric acid in the nucleus tractus solitarius: evidence of the action of GABAB receptor. Neuropharmacology. 1989;28:515–520.[Medline] [Order article via Infotrieve]

13. Sved AF, Tsukamoto K. Tonic stimulation of GABAB receptors in the nucleus tractus solitarius modulates the baroreceptor reflex. Brain Res. 1992;592:37–43.[Medline] [Order article via Infotrieve]

14. Tsukamoto K, Sved AF. Enhanced {gamma}-aminobutyric acid–mediated responses in nucleus tractus solitarius of hypertensive rats. Hypertension. 1993;22:819–825.[Abstract/Free Full Text]

15. Durgam VR, Mifflin SW. Comparative analysis of multiple receptor subunit mRNA in micropunches obtained from different brain regions using a competitive RT-PCR method. J Neurosci Methods. 1998;84:33–40.[Medline] [Order article via Infotrieve]

16. Grollman A. A simplified procedure for inducing chronic renal hypertension in the mammal. Proc Soc Exp Biol Med. 1944;57:102–104.

17. Haywood JR, Williams SFD, Ball NA. Contribution of sodium to the mechanism of one-kidney, renal-wrap hypertension. Am J Physiol. 1984;247:H797–H803.[Abstract/Free Full Text]

18. Yin M, Sved AF. Role of {gamma}-aminobutyric acid B receptors in baroreceptor reflexes in hypertensive rats. Hypertension. 1996;27:1291–1298.[Abstract/Free Full Text]

18. Celi FS, Zenilman ME, Shuldiner AR. A rapid versatile method to synthesize internal standard for competitive PCR. Nucleic Acids Res.. 1993;21:1047.[Free Full Text]

19. Hinojosa C, Shade RE. Plasma vasopressin concentration in high sodium renal hypertension. J Hypertens. 1986;4:529–534.[Medline] [Order article via Infotrieve]

20. Singh R, Ticku MK. Comparison of [3H]baclofen binding to GABAB receptors in spontaneously hypertensive and normotensive rats. Brain Res. 1985;358:1–9.[Medline] [Order article via Infotrieve]

21. Cole AF, Saffen DW, Baraban JM, Worley PF. Rapid increase of an immediate early gene messenger RNA in hippocampal neurons by synaptic NMDA receptor activation. Nature. 1989;340:474–476.[Medline] [Order article via Infotrieve]

22. Raymond LA, Blackstone CD, Huganir RL. Phosphorylation of amino acid neurotransmitter receptors in synaptic plasticity. Trends Neurosci. 1993;16:147–153.[Medline] [Order article via Infotrieve]

23. Misgeld U, Bijak M, Jarolimek W. A physiological role for GABAB receptors and the effects of baclofen in the mammalian central nervous system. Prog Neurobiol. 1995;46:423–462.[Medline] [Order article via Infotrieve]

24. Gavish M. Hormonal regulation of peripheral-type benzodiazepine receptors. J Steroid Biochem Mol Biol. 1995;53:57–59.[Medline] [Order article via Infotrieve]

25. Fenelon VS, Herbison AE. Plasticity in GABAA receptor subunit mRNA expression by hypothalamic magnocellular neurons in the adult rat. J Neurosci. 1996;16:4872–4880.[Abstract/Free Full Text]

26. Nair SM, Werkman TR, Craig J, Finnell R, Joels M, Eberwine JH. Corticosteroid regulation of ion channel conductances and mRNA levels in individual hippocampal CA1 neurons. J Neurosci. 1998;18:2685–2696.[Abstract/Free Full Text]

27. Zhang J, Mifflin SW. Receptor subtype specific effects of GABA agonists on neurons receiving aortic depressor nerve inputs within the nucleus of the solitary tract. J Auton Nerv Syst. In press.

28. Monaghan DT, Bridges RJ, Cotman CW. The excitatory amino acid receptors: their classes, pharmacology, and distinct properties in the function of the central nervous system. Annu Rev Pharmacol Toxicol. 1989;29:365–402.[Medline] [Order article via Infotrieve]

29. Mifflin SW, Spyer KM, Withington-Wray DJ. Baroreceptor inputs to the nucleus tractus solitarius in the cat: postsynaptic actions and the influence of respiration. J Physiol (Lond). 1988;399:349–367.[Abstract/Free Full Text]

30. Mifflin SW. Convergent carotid sinus nerve and superior laryngeal nerve afferent inputs to neurons in the NTS. Am J Physiol. 1996;271:R870–R880.[Abstract/Free Full Text]

31. Wang Y, Jordan J. GABAA and GABAB receptors are involved in vagal afferent inhibitory input to neurones in the nucleus tractus solitarii of anesthetized rats. J Physiol (Lond). 1997;504:197P–198P.




This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
D.-P. Li, Q. Yang, H.-M. Pan, and H.-L. Pan
Plasticity of pre- and postsynaptic GABAB receptor function in the paraventricular nucleus in spontaneously hypertensive rats
Am J Physiol Heart Circ Physiol, August 1, 2008; 295(2): H807 - H815.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
F. Yao, C. Sumners, S. T. O'Rourke, and C. Sun
Angiotensin II increases GABAB receptor expression in nucleus tractus solitarii of rats
Am J Physiol Heart Circ Physiol, June 1, 2008; 294(6): H2712 - H2720.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
G. Tolstykh, P. M. de Paula, and S. Mifflin
Voltage-Dependent Calcium Currents Are Enhanced in Nucleus of the Solitary Tract Neurons Isolated From Renal Wrap Hypertensive Rats
Hypertension, May 1, 2007; 49(5): 1163 - 1169.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
W. Zhang, M. Herrera-Rosales, and S. Mifflin
Chronic Hypertension Enhances the Postsynaptic Effect of Baclofen in the Nucleus Tractus Solitarius
Hypertension, March 1, 2007; 49(3): 659 - 663.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
Y.-W. Cheng, M.-C. Ku, C.-M. Ho, C.-Y. Chai, and C.-K. Su
GABAB-receptor-mediated suppression of sympathetic outflow from the spinal cord of neonatal rats
J Appl Physiol, November 1, 2005; 99(5): 1658 - 1667.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. Vitela, M. Herrera-Rosales, J. R. Haywood, and S. W. Mifflin
Baroreflex regulation of renal sympathetic nerve activity and heart rate in renal wrap hypertensive rats
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2005; 288(4): R856 - R862.
[Abstract] [Full Text] [PDF]


Home page
Exp PhysiolHome page
A. G. Teschemacher, S. Wang, T. Lonergan, H. Duale, H. Waki, J. F. R. Paton, and S. Kasparov
Targeting specific neuronal populations using adeno- and lentiviral vectors: applications for imaging and studies of cell function
Exp Physiol, January 1, 2005; 90(1): 61 - 69.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
A. F. Sved and J. C. Sved
Plasticity of GABA function in the nucleus tractus solitarius in hypertension
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2003; 285(6): R1272 - R1273.
[Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
L. Mei, J. Zhang, and S. Mifflin
Hypertension alters GABA receptor-mediated inhibition of neurons in the nucleus of the solitary tract
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2003; 285(6): R1276 - R1286.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
G. Tolstykh, S. Belugin, O. Tolstykh, and S. Mifflin
Responses to GABAA Receptor Activation Are Altered in NTS Neurons Isolated From Renal-Wrap Hypertensive Rats
Hypertension, October 1, 2003; 42(4): 732 - 736.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
A. M. Wasserman, M. Ferreira Jr., N. Sahibzada, Y. M. Hernandez, and R. A. Gillis
GABA-mediated neurotransmission in the ventrolateral NTS plays a role in respiratory regulation in the rat
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2002; 283(6): R1423 - R1441.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
S. W. Mifflin
What Does the Brain Know About Blood Pressure?
Physiology, December 1, 2001; 16(6): 266 - 271.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. Vitela and S. W. Mifflin
{{gamma}}-Aminobutyric AcidB Receptor-Mediated Responses in the Nucleus Tractus Solitarius Are Altered in Acute and Chronic Hypertension
Hypertension, February 1, 2001; 37(2): 619 - 622.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. Zhang and S. W. Mifflin
Integration of Aortic Nerve Inputs in Hypertensive Rats
Hypertension, January 1, 2000; 35(1): 430 - 436.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Durgam, V. R.
Right arrow Articles by Mifflin, S. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Durgam, V. R.
Right arrow Articles by Mifflin, S. W.