Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 1999;33:900-905

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sinn, P. L.
Right arrow Articles by Sigmund, C. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sinn, P. L.
Right arrow Articles by Sigmund, C. D.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*DACTINOMYCIN
Related Collections
Right arrow Gene expression
Right arrow Genomics
Right arrow Hypertension - basic studies

(Hypertension. 1999;33:900-905.)
© 1999 American Heart Association, Inc.


Scientific Contributions

Human Renin mRNA Stability Is Increased in Response to cAMP in Calu-6 Cells

Patrick L. Sinn; Curt D. Sigmund

From the Departments of Internal Medicine and of Physiology and Biophysics, University of Iowa College of Medicine, Iowa City.

Correspondence to Curt D. Sigmund, PhD, Chair, Molecular Biology Interdisciplinary Program, Director, Transgenic Animal Facility, Departments of Internal Medicine and of Physiology and Biophysics, 2191 Medical Laboratory (ML), University of Iowa College of Medicine, Iowa City, IA 52242. E-mail curt-sigmund{at}uiowa.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—The human carcinoma–derived cell line Calu-6 has previously been demonstrated to endogenously express human renin (hREN) mRNA and to markedly increase steady-state hREN mRNA levels (100-fold after 24 hours) in response to analogues of cAMP and postreceptor activators of adenylyl cyclase such as forskolin. However, both transfection analysis using hREN promoter-reporter constructs and nuclear run-on experiments suggest that transcriptional activity alone cannot account for this level of induction. We performed primer extension, reverse transcription–polymerase chain reaction, and 3' rapid amplification of cDNA ends to compare hREN mRNA between unstimulated and forskolin-stimulated cells. We demonstrate that hREN mRNA is identical under both conditions with respect to (1) utilization of the appropriate transcription start site, (2) processing of renin mRNA, and (3) utilization of the proper polyadenylation site and length of the poly-A tail. To address the mechanism of induction caused by cAMP, we used transcriptional inhibition and measured decay of hREN mRNA before and after forskolin or phorbol ester treatment. Experiments with both actinomycin D and 5,6-dichlororibofuranosylbenzimidazole (DRB) showed that forskolin treatment markedly stabilized hREN mRNA in Calu-6 cells. A 2.3-fold increase in hREN mRNA half-life was also observed after treatment of Calu-6 cells with phorbol ester. Experiments with DRB demonstrated a similar robust stabilization of hREN mRNA after forskolin and phorbol ester treatment. These data demonstrate that the induction in hREN mRNA in response to both cAMP and phorbol ester occurs by a mechanism involving a posttranscriptional component.


Key Words: transcription, genetic • posttranscriptional regulation • RNA, messenger • gene expression regulation


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Renin is the first and rate-limiting step in the catalytic conversion of angiotensinogen to the peptide hormone angiotensin II. Although the physiological importance of renin has been appreciated for some time, the molecular mechanisms regulating expression of the renin gene remain unclear. Most previous studies of renin gene regulation have primarily focused on transcriptional mechanisms with transfection analysis in renin-expressing and -nonexpressing cell lines (reviewed in Reference 11 ). One limitation to studies of human renin (hREN) gene regulation stems from the paucity of cells lines that express renin endogenously. We previously reported that Calu-6, an immortalized cell line derived from a human pulmonary carcinoma, expresses hREN endogenously,2 and it remains the only cell line known to stably express hREN mRNA over many passages. Calu-6 hREN mRNA levels are elevated after treatment with analogues of cAMP, such as 8-bromo-cAMP and dibutyryl cAMP, or postreceptor activators of adenylyl cyclase, such as forskolin.3

The hREN proximal promoter has been repeatedly demonstrated to be extremely weak, driving only minimal reporter gene expression when transfected into a number of renin expressing and -nonexpressing cell types in culture (reviewed in Reference 11 ). In addition, our experiments indicate that hREN promoter-reporter constructs containing varying amounts of hREN 5'-flanking DNA extending up to –5 kb either fail to be expressed or confer an inappropriate pattern tissue- and cell-specific expression in transgenic mice (C.D.S. et al, unpublished observations, 1998). Moreover, transfection analysis revealed only minimal transcriptional induction of the hREN promoter in transfected Calu-6 cells stimulated with forskolin, and maximal stimulation required cotransfection with constitutively active cAMP-dependent protein kinase.3 4 Other studies reported a 2- to 4-fold induction in hREN transcriptional activity by forskolin that was partially dependent on the presence of the cAMP response element (CRE) and a POU-domain transcription factor–binding site with homology to Pit-1.5 6 In addition, the proximal promoter region of the renin gene contains potential activator protein-1 elements, which bind a transcription factor comprising a c-Jun homodimer or a c-Jun/c-Fos heterodimer. The binding activity of activator protein-1 is stimulated by activators of protein kinase C (PKC), such as phorbol esters, which have been reported to stimulate renin gene expression in choriodecidual cells.7

To formally test whether the forskolin-induced increase in hREN mRNA involves an increase in hREN transcription, nuclear run-on experiments were performed, and no significant increase in transcription rate was observed.3 It is therefore necessary to resolve the discrepancy between the 100-fold increase in steady-state hREN mRNA induced by forskolin and the lack of transcriptional induction observed in transfection and nuclear run-on experiments. These results suggest that posttranscriptional mechanisms may be involved in the regulation of hREN mRNA. In studies of cultured mouse juxtaglomerular cells, Chen et al.8 demonstrated that forskolin stimulation increased mouse renin mRNA stability by approximately 3-fold, suggesting the involvement of posttranscriptional mechanisms in human renin gene regulation. In the current study we demonstrate a posttranscriptional component to the induction of hREN mRNA by forskolin.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Calu-6 cells were maintained as previously described.2 Cells were grown to 95% confluence and treated with either forskolin (10 µmol/L) or phorbol 12-myristate 13-acetate (TPA; 100 nmol/L) for 24 hours before transcriptional inhibition. Actinomycin D (10.0 µg/mL) or 5,6-dichlororibofuranosylbenzimidazole (DRB; 50.0 µg/mL) was used independently. RNA purification was conducted with TriReagent (Molecular Research Corp) and using the manufacturer's protocol. Northern blots and dot blots were generated and hybridized as previously described.3 The hREN cRNA antisense probe was labeled by in vitro transcription containing [{alpha}-32P]UTP and purified on a Sephadex G-50 quick-spin column (Boehringer Mannheim Biochemical). Primer extension was performed as previously described by using a gel-purified, 29-base oligonucleotide with the sequence CCCCAGCGAGGCATCCTTCTCCATCCATC and end-labeled with [{gamma}-32P]ATP and T4 polynucleotide kinase.9 Labeled oligonucleotide (50 000 disintegrations per minute) was hybridized with varying amounts of Calu-6 RNA as indicated.

DNase treatments and reverse transcription–polymerase chain reactions (RT-PCRs) of Calu-6 RNA were conducted as previously described.10 The primers for PCR were as follows: TCGGTGGCAGGGAGAAAG (intron 4 up); CTGGCAGAGGGGGAGAGTT (intron 4 down); ATCTGCCCCGGACCCCTTCTG (intron 9 up); GTGCCCCTCCCCTAACTCTGATGG (intron 9 down); CGGCACCCCACCCCAGACC (exons 3 to 6 up); and GACACCAGTCTTGATGAGG (exons 3 to 6 down). 3' Rapid amplification of cDNA ends (RACE) was used to confirm the poly-A addition site and to measure the length of the poly-A tail as previously described.11 An oligo-dT–anchor primer was used for the RT reaction. The anchor portion allows for PCR with a gene-specific primer and an anchor-specific primer. The reaction occurs with [{alpha}-32P]UTP, and 1000 dpm of the resulting cDNA is run on a denaturing polyacrylamide gel. The upstream (gene-specific) oligonucleotide was CTTATGCCCTCAGATCGAG, the anchor primer was GGTGTACCGCGG, and the oligo-dT–anchor primer was GGTGTACCGCGGTTTTTTTTTT. Quantification of 3' RACE products, Northern blots, and dot blots were performed using a Molecular Dynamics Storm 420 PhosphorImager and the ImageQuant software provided by the manufacturer. mRNA turnover data are presented as mean±SEM after normalization with respect to GAPDH.

Nuclear extracts from Calu-6 cells were prepared as previously described with the following modifications.12 Cells from 80% confluent monolayer cultures were harvested and washed in 1x PBS. Pelleted cells were resuspended in buffer containing 10 mmol/L HEPES, pH 7.9; 1.5 mmol/L MgCl2; 10 mmol/L KCl; and 0.5 mmol/L DTT; maintained on ice to swell; and lysed by being rapidly and repeatedly drawn through a 26-gauge needle.4 After centrifugation, the nuclear and cytoplasmic extracts were separated, the nuclear pellet was washed with 1x PBS, and RNA was purified as described above. Trypan blue staining indicated the absence of nuclei in the cytoplasmic preparation and the presence of abundant nuclei but not whole cells in the nuclear preparation.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Calu-6 cells express human renin endogenously at a low basal level; however, with the addition of forskolin, hREN RNA is induced by 2 orders of magnitude after 24 hours (Figure 1).3 A similar albeit less marked induction is seen with the addition of the phorbol ester TPA, an activator of the PKC pathway (Figure 1). The TPA response is similar to that seen in primary cultures of JG cells, in which phorbol esters have been shown to stimulate renin mRNA levels independently of forskolin.7 A longer exposure revealed low-level hREN expression in the untreated lane, and equal loading of the blot is demonstrated by 28S rRNA staining. We previously demonstrated that transcriptional activity of the hREN promoter could not account for the increase in hREN mRNA caused by forskolin.3 However, given the 100-fold induction of hREN mRNA in response to forskolin and the difficulty in observing both uninduced and induced mRNAs on the same gel, we performed experiments to ensure that both species of hREN mRNA were identical with respect to transcription initiation and mRNA processing.



View larger version (50K):
[in this window]
[in a new window]
 
Figure 1. Expression of hREN mRNA in response to cAMP and TPA. Northern blot analysis was performed with 10 µg of total RNA from Calu-6 cells. Treated cells received 10 µmol/L forskolin and/or increasing amounts of TPA as indicated. Ramped TPA concentrations were 100 nmol/L, 500 nmol/L, or 1.0 µmol/L. The mature hREN message is indicated, as well as a consistently observed slower-migrating band (*). The positions of rRNAs are indicated. The methylene blue stain of the 28S rRNA is shown to demonstrate equal loading.

Primer extension analysis was performed to compare transcription start sites. An antisense primer was designed to hybridize to hREN mRNA 76 nucleotides downstream of the normal transcription initiation site. The identical primer extension product was observed in both the untreated and forskolin-treated cells, indicating utilization of the same major transcription initiation site in both untreated and forskolin-treated cells (Figure 2). We also confirmed appropriate processing of hREN mRNA by performing RT-PCR with primers spanning the entire mRNA (data not shown). Identical RT-PCR products were obtained from RNA isolated from treated and untreated cells, suggesting that both species of hREN mRNA are identical in overall structure.



View larger version (63K):
[in this window]
[in a new window]
 
Figure 2. Transcriptional initiation in hREN. Primer extension was performed on hREN mRNAs from both forskolin-treated (+F) and untreated (-F) Calu-6 cells. A labeled oligonucleotide primer was hybridized 76 bp downstream of the transcription start site and subjected to RT as detailed in Methods. The amount of RNA used in the assay is indicated. M indicates end-labeled molecular marker from pBR322 digested with HpaII. Sizes are in nucleotides.

In addition to the major species of hREN mRNA observed by Northern blot analysis is a higher-molecular-weight band (labeled with an asterisk in Figure 1). To determine whether this represents unprocessed hREN hnRNA, nuclear and cytoplasmic RNAs from untreated or forskolin-treated Calu-6 cells were subjected to Northern blot analysis. This analysis revealed that the slower-migrating band is nucleus-specific, thus supporting the notion that it is unprocessed hnRNA (Figure 3A). Moreover, similar results were obtained in both untreated and forskolin-treated cells. RT-PCR was performed to provide additional support for the identification of the higher-molecular-weight band as unprocessed hREN hnRNA. A schematic of the 2 intron-specific primer sets and the 1 exon-specific primer set used in this analysis is shown in Figure 3B. Intronic RNA was clearly identifiable by RT-PCR in whole-cell (not shown) and nuclear RNA preparations but not in cytoplasmic RNA preparations (Figure 3C). As expected, RT-PCR products consistent with mature mRNA were observed in both the nuclei and cytoplasmic preparations.



View larger version (84K):
[in this window]
[in a new window]
 
Figure 3. Cell fractionation of hREN mRNA and RT-PCR confirmation of hREN hnRNA. A, Calu-6 cells were fractionated into nuclear (N) and cytoplasmic (C) fractions, and RNA (10 µg) from each fraction and a corresponding whole-cell (W) RNA were subjected to Northern blot analysis. *Indicates upper band in Figure 1. B, Schematic representation of the hREN gene, showing the positions of primer sets used to amplify introns (closed arrows) and exons (open arrows) to differentiate immature heterogeneous nuclear RNA from mature mRNA. C, Random hexamers were used to reverse transcribe RNA from nuclear (N) and cytoplasmic (C) fractions purified from Calu-6 cells and subsequently subjected to PCR. The primer sets used in the amplification are indicated.

To address whether posttranscriptional mechanisms play a role in the induction by forskolin, we measured the decay of hREN mRNA after transcriptional inhibition. Preliminary experiments examining the incorporation of tritiated uridine into trichloroacetic acid–precipitable counts revealed that 10 µg/mL actinomycin D and 50 µg/mL DRB inhibited transcription in Calu-6 cells by 95% and 90%, respectively. Decay curves revealed that the half-life of hREN mRNA in the basal state after actinomycin D treatment was {approx}4.2 hours (Figure 4A). Interestingly, there was no indication of hREN mRNA decay in cells pretreated with forskolin for 24 hours (Figure 4B). The half-life of hREN mRNA was likewise attenuated, albeit to a lesser extent, after pretreatment with TPA (Figure 4C). Although actinomycin D is a very efficient transcriptional inhibitor, it exerts its affects by intercalating between GC base pairs and is known to have a stabilizing affect of its own on many mRNAs.13 Therefore, it was necessary to repeat these studies with a different transcriptional inhibitor that acts through a distinct mechanism. DRB has been reported to prevent transcriptional initiation without an effect on mRNA stability.14 With the use of DRB, it was determined that the hREN mRNA half-life was 1.7 hours in untreated cells (Figure 5A) and 8.8 hours after TPA pretreatment (Figure 5C). Like actinomycin D, there was no significant decay of hREN mRNA within the 60-hour period after forskolin pretreatment (Figure 5B).



View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. hREN mRNA decay in the presence of actinomycin D. The decay rate of hREN in Calu-6 cells was determined with actinomycin D. Cells were either untreated (A), pretreated for 24 hours with forskolin (B), or pretreated for 24 hours with TPA (C). Cells were exposed to actinomycin D at time 0 and harvested at the indicated time points. hREN mRNA levels were corrected against GAPDH and using a PhosphorImager (n=3). The half-life (t1/2) of hREN is indicated.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 5. hREN mRNA decay in the presence of DRB. The decay rate of hREN in Calu-6 cells was determined with DRB. Cells were left untreated (A), pretreated for 24 hours with forskolin (B), or pretreated for 24 hours with TPA (C). Cells were exposed to DRB at time 0 and harvested at the indicated time points. hREN RNA levels were corrected against GAPDH and using a PhosphorImager (n=3). The half-life (t1/2) of each mRNA is indicated.

Differences in the poly-A tail length of mRNA have been previously reported to affect its stability.15 To confirm utilization of the appropriate poly-A site and to measure poly-A tail length, we used 3' RACE, a modified RT-PCR protocol that includes an oligo-dT RT primer containing an anchor primer overhang (labeled 1 in Figure 6A). An anchor-specific primer (labeled 2) and a gene-specific primer (labeled 3) are used for the subsequent PCR that results in a characteristic pattern of multiple bands due to the variable nature of the hybridization of the RT primer to different positions on the poly-A tail. Our data demonstrate a major 3' RACE product close to 160 bases long. This finding does not reflect an unpolyadenylated hREN mRNA but results from hybridization of the oligo-dT–anchor primer close to the beginning of the poly-A tail, thus indicating that hREN mRNA from both untreated and forskolin-treated cells is utilizing the same and correct poly-A site. Overall, the same banding pattern was seen in the presence or absence of forskolin, suggesting that the poly-A tail length is very similar in both mRNAs (Figure 6B). The most prevalent 3' RACE products were 360 to 400 bp long, thus indicating a collection of hREN mRNA molecules with a poly-A tail length of 200 to 240 nucleotides. Although a band at 200 bp is absent from the untreated sample, this result was not reproducible.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 6. Poly-A site and poly-A tract length. The poly-A site and poly-A tail length were determined by 3' RACE. RT was conducted with an oligo-dT primer with an anchor sequence (A). The subsequent PCR step uses both gene- and anchor-specific primers. B, The overall length of the PCR products are shown: (1) oligo-dT–anchor primer for RT, (2) anchor primer for PCR, and (3) gene-specific primer for PCR.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
hREN mRNA levels are markedly induced in response to forskolin in Calu-6 cells. We have previously demonstrated that this induction is not due entirely to increased transcriptional activity of the hREN promoter but requires an additional mechanism.3 The present study demonstrates that a posttranscriptional mechanism plays an important role in this induction. Moreover, we demonstrate hREN mRNA induction can also be attained, albeit to a lesser extent, with the phorbol ester TPA, which elicits its effects through the PKC pathway, and that a posttranscriptional mechanism is partially responsible for this induction as well.

In untreated Calu-6 cells, hREN RNA decays with a half-life of 1.7 hours when DRB is added as a transcriptional inhibitor or 4.2 hours when actinomycin D is included as an inhibitor. The difference between the inhibitors may in part be due to the stabilizing effects known to be imparted by actinomycin D.13 It should be noted that this difference can be considered negligible when compared with the stability of hREN mRNA after forskolin treatment, where we found no evidence for turnover even after 60 hours of transcriptional inhibition. Therefore, we could not calculate a precise half-life for hREN mRNA under those conditions. Moreover, we noted a slight upward slope in the hREN decay curves under forskolin-treated conditions. This could be explained by either continued transcription in the presence of the inhibitors, because the measured efficiency of transcriptional inhibition was <100%, or, more likely, to our method of quantifying mRNA decay that relied on GAPDH mRNA as an internal standard. Our studies indicate that the turnover of GAPDH mRNA was negligible during the first 12 hours after transcriptional inhibition but that it turned over more rapidly than did hREN mRNA thereafter (data not shown).

The precise mechanisms causing either enhanced RNA stabilization or decay remain unclear. Most information on posttranscriptional regulation has been obtained from an analysis of the iron response element (IRE) of the transferrin receptor and the AUUUA motif present in the 3' untranslated region (UTR) of certain immediate-early genes such as c-fos.15 16 Clearly, sequences present within mRNA, primarily but not exclusively located within the 3' UTR, can determine its stability. Sequences such as the AUUUA can confer decreased stability when placed downstream of normally stable messages.17 The hREN mRNA lacks any AUUUA motifs in its 3' UTR that might account for its relatively long half-life, even under unstimulated conditions. Although a number of secondary structures can theoretically form within the hREN 3' UTR, it remains unclear whether these are either necessary or sufficient for increasing stability or whether specific RNA binding proteins like those binding to the transferrin receptor IRE are involved.16

In addition to these specific sequences, a number of studies have demonstrated a correlation between poly-A tail length and mRNA stability, implying that the poly-A tract may protect certain mRNAs from rapid degradation.15 Although our data suggest that both stimulated and unstimulated hREN mRNAs utilize the same poly-A site and have similar poly-A tract length, we cannot formally rule out its importance in regulating the stability of the message. Moreover, our data demonstrating use of the same transcription initiation site rule out the possibility of additional sequences in the 5' UTR. Although 5' UTRs have yet to be demonstrated to specifically target RNA binding proteins involved in mRNA stability, their effect can be indirect, by changing overall translational efficiency. Some mRNAs become stable while others are more prone to degradation when associated with ribosomes.15 18 Moreover, sequences located upstream of the 3' UTR have been shown to be important for regulating mRNA stability.19

One aspect of mRNA turnover that has received considerable attention is the phenomenon of nonsense codon–mediated decay (reviewed in Reference 2020 ). This is observed in a number of genes, particularly disease genes, when premature nonsense codon mutations are present in the mRNA. Although the mechanism remains unclear, the end product is the degradation of the mRNA before a truncated protein is generated. Interestingly, this mechanism may be protective in some disease processes, because loss of protein function may be preferable to the accumulation of abnormal protein that may have dominant negative effects. Moreover, it is likely that the process of scanning an mRNA for degradation in this pathway occurs in the nucleus, either during splicing or mRNA transport.

Unfortunately, this still leaves unresolved the mechanism causing increased hREN mRNA after stimulation of the PKA and PKC pathways. Based on other systems, it is likely that some sequence motif(s) present within the mRNA may be the target of an RNA binding protein(s) that may prevent its turnover, either by stabilizing mRNA structure or by inhibiting the action or binding of ribonucleases designed to degrade mRNA. It remains possible that the synthesis of the RNA binding protein(s) may occur by transcriptional induction via the classic cAMP-CRE pathway or that a pre-existing protein may directly or indirectly require the phosphorylating actions of PKA or PKC. Such a pre-existing protein may be labile, because we previously demonstrated that hREN mRNA induction required active translation.3 In conclusion, the abundance of an mRNA depends on 4 factors: (1) the rate of transcription to form a primary RNA product, (2) maturation of this initial RNA transcript, (3) transport of the mature mRNA to the cytoplasm, and (4) the rate of its degradation. Combining both transcriptional and posttranscriptional mechanisms may provide a mechanism for tighter control of gene regulation than can be achieved through transcriptional mechanisms alone.


*    Acknowledgments
 
Funds in support of this work were obtained from the National Institutes of Health, Bethesda, Md (HL56006 and HL48058 to C.D.S.) and the American Heart Association (AHA). C.D.S. was an Established Investigator of the AHA. We would like to thank Debbie Davis, Xiaoji Zhang, and Julie Lang for their excellent technical assistance.

Received August 31, 1998; first decision October 8, 1998; accepted November 12, 1998.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Sinn PL, Sigmund CD. Understanding the regulation of renin gene expression through in vitro and in vivo models. In: Husain A, Graham RM, eds. Drugs, Enzymes and Receptors of the Renin Angiotensin System: A Century of Discovery. Sydney, Australia: Harwood Academic Publishers/Gordon and Breach Scientific International Publishers; 1999.

2. Lang JA, Yang G, Kern JA, Sigmund CD. Endogenous human renin expression and promoter activity in a pulmonary carcinoma cell line (Calu-6). Hypertension. 1995;25:704–710.[Abstract/Free Full Text]

3. Lang JA, Ying L-H, Morris BJ, Sigmund CD. Transcription and post-transcriptional mechanisms regulate expression of human renin gene in Calu-6 cells. Am J Physiol. 1996;271:F94–F100.[Abstract/Free Full Text]

4. Ying L, Morris BJ, Sigmund CD. Transactivation of the human renin promoter by the cyclic AMP/protein kinase A pathway is mediated by both CREB-dependent and CREB-independent mechanisms in Calu-6 cells. J Biol Chem. 1997;272:2412–2420.[Abstract/Free Full Text]

5. Gilbert MT, Sun J, Yan Y, Oddoux C, Lazarus A, Tansey WP, Lavin TN, Catanzaro DF. Renin gene promoter activity in GC cells is regulated by cAMP and thyroid hormone through Pit-1-dependent mechanisms. J Biol Chem. 1994;269:1–6.[Free Full Text]

6. Germain S, Konoshita T, Philippe J, Corvol P, Pinet F. Transcriptional induction of the human renin gene by cyclic AMP requires CREB and a factor binding to pituitary-specific trans-acting factor (Pit-1) motif. Biochem J. 1996;316:107–113.

7. Caroff N, Della BR, Philippe J, Corvol P, Pinet F. Regulation of human renin secretion and renin transcription by quantitative PCR in cultured chorionic cells: synergistic effect of cyclic AMP and protein kinase C. Biochem Biophys Res Commun. 1993;193:1332–1338.[Medline] [Order article via Infotrieve]

8. Chen M, Schnermann J, Smart AM, Brosius FC, Killen PD, Briggs JP. Cyclic AMP selectively increases renin mRNA stability in cultured juxtaglomerular granular cells. J Biol Chem. 1993;268:24138–24144.[Abstract/Free Full Text]

9. Ding Y, Davisson RL, Hardy DO, Zhu L-J, Merrill DC, Catterall JF, Sigmund CD. The kidney androgen-regulated protein (KAP) promoter confers renal proximal tubule cell-specific and highly androgen-responsive expression on the human angiotensinogen gene in transgenic mice. J Biol Chem. 1997;272:28142–28148.[Abstract/Free Full Text]

10. Davisson RL, Nuutinen N, Coleman ST, Sigmund CD. Inappropriate splicing of a chimeric gene containing a large internal exon results in exon skipping in transgenic mice. Nucleic Acids Res. 1996;24:4023–4028.[Abstract/Free Full Text]

11. Sheflin LG, Brooks EM, Keegan BP, Spaulding SW. Increased epidermal growth factor expression produced by testosterone in the submaxillary gland of female mice is accompanied by changes in poly-A tail length and periodicity. Endocrinology. 1996;137:2085–2092.[Abstract]

12. Lee KAW, Bindereif A, Green MR. A small scale procedure for preparation of nuclear extracts that support efficient transcription and pre-mRNA splicing. Genet Anal Techn. 1988;5:22–31.

13. Stacey KJ, Nagamine Y, Hume DA. RNA synthesis inhibition stabilises urokinase mRNA in macrophages. FEBS Lett. 1994;356:311–313.[Medline] [Order article via Infotrieve]

14. Chodosh LA, Fire A, Samuels M, Sharp PA. 5,6-Dichloro-1-b-D-ribofuranosylbenzimidazole (DRB) inhibits transcription elongation by RNA polymerase II in vitro. J Biol Chem. 1989;264:2250–2257.[Abstract/Free Full Text]

15. Sachs AB. Messenger RNA degradation in eukaryotes. Cell. 1993;74:413–421.[Medline] [Order article via Infotrieve]

16. Klausner RD, Rouault TA, Harford JB. Regulating the fate of mRNA: the control of cellular iron metabolism. Cell. 1993;72:19–28.[Medline] [Order article via Infotrieve]

17. Shaw G, Kamen R. A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell. 1986;46:659–667.[Medline] [Order article via Infotrieve]

18. Poyet P, Henning SJ, Rosen JM. Hormone dependent B-casein mRNA stabilization requires ongoing protein synthesis. Mol Endocrinol. 1989;3:1961–1968.[Abstract/Free Full Text]

19. Wisdom R, Lee W. The protein-coding region of c-myc mRNA contains a sequence that specifies rapid mRNA turnover and induction by protein synthesis inhibitors. Genes Dev. 1991;5:232–243.[Abstract/Free Full Text]

20. Maquat LE. When cells stop making sense: effects of nonsense codons on RNA metabolism in vertebrate cells. RNA. 1995;1:453–465.[Abstract]




This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
X. Zhou, E. T. Weatherford, X. Liu, E. Born, H. L. Keen, and C. D. Sigmund
Dysregulated human renin expression in transgenic mice carrying truncated genomic constructs: evidence supporting the presence of insulators at the renin locus
Am J Physiol Renal Physiol, September 1, 2008; 295(3): F642 - F653.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
V. T. Todorov, M. Desch, N. Schmitt-Nilson, A. Todorova, and A. Kurtz
Peroxisome Proliferator-Activated Receptor-{gamma} Is Involved in the Control of Renin Gene Expression
Hypertension, November 1, 2007; 50(5): 939 - 944.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
E. T. Weatherford, H. Itani, H. L. Keen, and C. D. Sigmund
Is Peroxisome Proliferator-Activated Receptor-{gamma} a New "Pal" of Renin?
Hypertension, November 1, 2007; 50(5): 844 - 846.
[Full Text] [PDF]


Home page
EndocrinologyHome page
H. A. Itani, X. Liu, J. H. Pratt, and C. D. Sigmund
Functional Characterization of Polymorphisms in the Kidney Enhancer of the Human Renin Gene
Endocrinology, March 1, 2007; 148(3): 1424 - 1430.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
L. Chen, S. M. Kim, M. Oppermann, R. Faulhaber-Walter, Y. Huang, D. Mizel, M. Chen, M. L. S. Lopez, L. S. Weinstein, R. A. Gomez, et al.
Regulation of renin in mice with Cre recombinase-mediated deletion of G protein Gs{alpha} in juxtaglomerular cells
Am J Physiol Renal Physiol, January 1, 2007; 292(1): F27 - F37.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Zhoux, D. R. Davis, and C. D. Sigmund
The Human Renin Kidney Enhancer Is Required to Maintain Base-line Renin Expression but Is Dispensable for Tissue-specific, Cell-specific, and Regulated Expression
J. Biol. Chem., November 17, 2006; 281(46): 35296 - 35304.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. Klar, M. Sigl, B. Obermayer, F. Schweda, B. K. Kramer, and A. Kurtz
Calcium Inhibits Renin Gene Expression by Transcriptional and Posttranscriptional Mechanisms
Hypertension, December 1, 2005; 46(6): 1340 - 1346.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Klar, H. Vitzthum, and A. Kurtz
Aldosterone enhances renin gene expression in juxtaglomerular cells
Am J Physiol Renal Physiol, February 1, 2004; 286(2): F349 - F355.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. J. Adams, D. J. Beveridge, L. van der Weyden, H. Mangs, P. J. Leedman, and B. J. Morris
HADHB, HuR, and CP1 Bind to the Distal 3'-Untranslated Region of Human Renin mRNA and Differentially Modulate Renin Expression
J. Biol. Chem., November 7, 2003; 278(45): 44894 - 44903.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
P. B Persson
Renin: origin, secretion and synthesis
J. Physiol., November 1, 2003; 552(3): 667 - 671.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
P. B. Persson, A. Skalweit, R. Mrowka, and B.-J. Thiele
Control of renin synthesis
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2003; 285(3): R491 - R497.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
X. Liu, X. Huang, and C. D. Sigmund
Identification of a Nuclear Orphan Receptor (Ear2) as a Negative Regulator of Renin Gene Transcription
Circ. Res., May 16, 2003; 92(9): 1033 - 1040.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
A. Skalweit, A. Doller, A. Huth, T. Kahne, P. B. Persson, and B.-J. Thiele
Posttranscriptional Control of Renin Synthesis: Identification of Proteins Interacting With Renin mRNA 3'-Untranslated Region
Circ. Res., March 7, 2003; 92(4): 419 - 427.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. P. Kohm, A. Mozaffarian, and V. M. Sanders
B Cell Receptor- and {beta}2-Adrenergic Receptor-Induced Regulation of B7-2 (CD86) Expression in B Cells
J. Immunol., June 15, 2002; 168(12): 6314 - 6322.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. Lee and S. G. Laychock
Regulation of Inositol Trisphosphate Receptor Isoform Expression in Glucose-Desensitized Rat Pancreatic Islets: Role of Cyclic Adenosine 3',5'-Monophosphate and Calcium
Endocrinology, April 1, 2000; 141(4): 1394 - 1402.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. L. Sinn, D. R. Davis, and C. D. Sigmund
Highly Regulated Cell Type-restricted Expression of Human Renin in Mice Containing 140- or 160-Kilobase Pair P1 Phage Artificial Chromosome Transgenes
J. Biol. Chem., December 10, 1999; 274(50): 35785 - 35793.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
P. L. Sinn, X. Zhang, and C. D. Sigmund
JG cell expression and partial regulation of a human renin genomic transgene driven by a minimal renin promoter
Am J Physiol Renal Physiol, October 1, 1999; 277(4): F634 - F642.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Q. Shi, T. A. Black, K. W. Gross, and C. D. Sigmund
Species-Specific Differences in Positive and Negative Regulatory Elements in the Renin Gene Enhancer
Circ. Res., September 17, 1999; 85(6): 479 - 488.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sinn, P. L.
Right arrow Articles by Sigmund, C. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sinn, P. L.
Right arrow Articles by Sigmund, C. D.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*DACTINOMYCIN
Related Collections
Right arrow Gene expression
Right arrow Genomics
Right arrow Hypertension - basic studies