(Hypertension. 1999;33:900-905.)
© 1999 American Heart Association, Inc.
Scientific Contributions |
From the Departments of Internal Medicine and of Physiology and Biophysics, University of Iowa College of Medicine, Iowa City.
Correspondence to Curt D. Sigmund, PhD, Chair, Molecular Biology Interdisciplinary Program, Director, Transgenic Animal Facility, Departments of Internal Medicine and of Physiology and Biophysics, 2191 Medical Laboratory (ML), University of Iowa College of Medicine, Iowa City, IA 52242. E-mail curt-sigmund{at}uiowa.edu
| Abstract |
|---|
|
|
|---|
Key Words: transcription, genetic posttranscriptional regulation RNA, messenger gene expression regulation
| Introduction |
|---|
|
|
|---|
The hREN proximal promoter has been repeatedly demonstrated to be extremely weak, driving only minimal reporter gene expression when transfected into a number of renin expressing and -nonexpressing cell types in culture (reviewed in Reference 11 ). In addition, our experiments indicate that hREN promoter-reporter constructs containing varying amounts of hREN 5'-flanking DNA extending up to 5 kb either fail to be expressed or confer an inappropriate pattern tissue- and cell-specific expression in transgenic mice (C.D.S. et al, unpublished observations, 1998). Moreover, transfection analysis revealed only minimal transcriptional induction of the hREN promoter in transfected Calu-6 cells stimulated with forskolin, and maximal stimulation required cotransfection with constitutively active cAMP-dependent protein kinase.3 4 Other studies reported a 2- to 4-fold induction in hREN transcriptional activity by forskolin that was partially dependent on the presence of the cAMP response element (CRE) and a POU-domain transcription factorbinding site with homology to Pit-1.5 6 In addition, the proximal promoter region of the renin gene contains potential activator protein-1 elements, which bind a transcription factor comprising a c-Jun homodimer or a c-Jun/c-Fos heterodimer. The binding activity of activator protein-1 is stimulated by activators of protein kinase C (PKC), such as phorbol esters, which have been reported to stimulate renin gene expression in choriodecidual cells.7
To formally test whether the forskolin-induced increase in hREN mRNA involves an increase in hREN transcription, nuclear run-on experiments were performed, and no significant increase in transcription rate was observed.3 It is therefore necessary to resolve the discrepancy between the 100-fold increase in steady-state hREN mRNA induced by forskolin and the lack of transcriptional induction observed in transfection and nuclear run-on experiments. These results suggest that posttranscriptional mechanisms may be involved in the regulation of hREN mRNA. In studies of cultured mouse juxtaglomerular cells, Chen et al.8 demonstrated that forskolin stimulation increased mouse renin mRNA stability by approximately 3-fold, suggesting the involvement of posttranscriptional mechanisms in human renin gene regulation. In the current study we demonstrate a posttranscriptional component to the induction of hREN mRNA by forskolin.
| Methods |
|---|
|
|
|---|
-32P]UTP and purified on a Sephadex G-50
quick-spin column (Boehringer Mannheim Biochemical). Primer
extension was performed as previously described by using a
gel-purified, 29-base oligonucleotide with the
sequence CCCCAGCGAGGCATCCTTCTCCATCCATC and end-labeled with
[
-32P]ATP and T4 polynucleotide
kinase.9 Labeled oligonucleotide (50 000
disintegrations per minute) was hybridized with varying amounts of
Calu-6 RNA as indicated.
DNase treatments and reverse transcriptionpolymerase chain reactions
(RT-PCRs) of Calu-6 RNA were conducted as previously
described.10 The primers for PCR were as follows:
TCGGTGGCAGGGAGAAAG (intron 4 up); CTGGCAGAGGGGGAGAGTT (intron 4 down);
ATCTGCCCCGGACCCCTTCTG (intron 9 up); GTGCCCCTCCCCTAACTCTGATGG (intron 9
down); CGGCACCCCACCCCAGACC (exons 3 to 6 up); and GACACCAGTCTTGATGAGG
(exons 3 to 6 down). 3' Rapid amplification of cDNA ends (RACE) was
used to confirm the poly-A addition site and to measure the length of
the poly-A tail as previously described.11 An
oligo-dTanchor primer was used for the RT reaction. The anchor
portion allows for PCR with a gene-specific primer and an
anchor-specific primer. The reaction occurs with
[
-32P]UTP, and 1000 dpm of the resulting
cDNA is run on a denaturing polyacrylamide gel. The upstream
(gene-specific) oligonucleotide was
CTTATGCCCTCAGATCGAG, the anchor primer was GGTGTACCGCGG, and the
oligo-dTanchor primer was GGTGTACCGCGGTTTTTTTTTT. Quantification of
3' RACE products, Northern blots, and dot blots were performed
using a Molecular Dynamics Storm 420 PhosphorImager and the ImageQuant
software provided by the manufacturer. mRNA turnover data are
presented as mean±SEM after normalization with respect to
GAPDH.
Nuclear extracts from Calu-6 cells were prepared as previously described with the following modifications.12 Cells from 80% confluent monolayer cultures were harvested and washed in 1x PBS. Pelleted cells were resuspended in buffer containing 10 mmol/L HEPES, pH 7.9; 1.5 mmol/L MgCl2; 10 mmol/L KCl; and 0.5 mmol/L DTT; maintained on ice to swell; and lysed by being rapidly and repeatedly drawn through a 26-gauge needle.4 After centrifugation, the nuclear and cytoplasmic extracts were separated, the nuclear pellet was washed with 1x PBS, and RNA was purified as described above. Trypan blue staining indicated the absence of nuclei in the cytoplasmic preparation and the presence of abundant nuclei but not whole cells in the nuclear preparation.
| Results |
|---|
|
|
|---|
|
Primer extension analysis was performed to compare transcription start sites. An antisense primer was designed to hybridize to hREN mRNA 76 nucleotides downstream of the normal transcription initiation site. The identical primer extension product was observed in both the untreated and forskolin-treated cells, indicating utilization of the same major transcription initiation site in both untreated and forskolin-treated cells (Figure 2). We also confirmed appropriate processing of hREN mRNA by performing RT-PCR with primers spanning the entire mRNA (data not shown). Identical RT-PCR products were obtained from RNA isolated from treated and untreated cells, suggesting that both species of hREN mRNA are identical in overall structure.
|
In addition to the major species of hREN mRNA observed by Northern blot analysis is a higher-molecular-weight band (labeled with an asterisk in Figure 1). To determine whether this represents unprocessed hREN hnRNA, nuclear and cytoplasmic RNAs from untreated or forskolin-treated Calu-6 cells were subjected to Northern blot analysis. This analysis revealed that the slower-migrating band is nucleus-specific, thus supporting the notion that it is unprocessed hnRNA (Figure 3A). Moreover, similar results were obtained in both untreated and forskolin-treated cells. RT-PCR was performed to provide additional support for the identification of the higher-molecular-weight band as unprocessed hREN hnRNA. A schematic of the 2 intron-specific primer sets and the 1 exon-specific primer set used in this analysis is shown in Figure 3B. Intronic RNA was clearly identifiable by RT-PCR in whole-cell (not shown) and nuclear RNA preparations but not in cytoplasmic RNA preparations (Figure 3C). As expected, RT-PCR products consistent with mature mRNA were observed in both the nuclei and cytoplasmic preparations.
|
To address whether posttranscriptional mechanisms play a role in the
induction by forskolin, we measured the decay of hREN mRNA after
transcriptional inhibition. Preliminary experiments examining the
incorporation of tritiated uridine into trichloroacetic
acidprecipitable counts revealed that 10 µg/mL actinomycin D and 50
µg/mL DRB inhibited transcription in Calu-6 cells by 95% and 90%,
respectively. Decay curves revealed that the half-life of hREN mRNA in
the basal state after actinomycin D treatment was
4.2 hours (Figure 4A). Interestingly, there was no indication of hREN mRNA decay
in cells pretreated with forskolin for 24 hours (Figure 4B). The
half-life of hREN mRNA was likewise attenuated, albeit to a lesser
extent, after pretreatment with TPA (Figure 4C). Although
actinomycin D is a very efficient transcriptional
inhibitor, it exerts its affects by intercalating between
GC base pairs and is known to have a stabilizing affect of its own on
many mRNAs.13 Therefore, it was necessary to repeat these
studies with a different transcriptional inhibitor that
acts through a distinct mechanism. DRB has been reported to prevent
transcriptional initiation without an effect on mRNA
stability.14 With the use of DRB, it was determined that
the hREN mRNA half-life was 1.7 hours in untreated cells (Figure 5A) and 8.8 hours after TPA pretreatment (Figure 5C).
Like actinomycin D, there was no significant decay of hREN mRNA within
the 60-hour period after forskolin pretreatment (Figure 5B).
|
|
Differences in the poly-A tail length of mRNA have been previously reported to affect its stability.15 To confirm utilization of the appropriate poly-A site and to measure poly-A tail length, we used 3' RACE, a modified RT-PCR protocol that includes an oligo-dT RT primer containing an anchor primer overhang (labeled 1 in Figure 6A). An anchor-specific primer (labeled 2) and a gene-specific primer (labeled 3) are used for the subsequent PCR that results in a characteristic pattern of multiple bands due to the variable nature of the hybridization of the RT primer to different positions on the poly-A tail. Our data demonstrate a major 3' RACE product close to 160 bases long. This finding does not reflect an unpolyadenylated hREN mRNA but results from hybridization of the oligo-dTanchor primer close to the beginning of the poly-A tail, thus indicating that hREN mRNA from both untreated and forskolin-treated cells is utilizing the same and correct poly-A site. Overall, the same banding pattern was seen in the presence or absence of forskolin, suggesting that the poly-A tail length is very similar in both mRNAs (Figure 6B). The most prevalent 3' RACE products were 360 to 400 bp long, thus indicating a collection of hREN mRNA molecules with a poly-A tail length of 200 to 240 nucleotides. Although a band at 200 bp is absent from the untreated sample, this result was not reproducible.
|
| Discussion |
|---|
|
|
|---|
In untreated Calu-6 cells, hREN RNA decays with a half-life of 1.7 hours when DRB is added as a transcriptional inhibitor or 4.2 hours when actinomycin D is included as an inhibitor. The difference between the inhibitors may in part be due to the stabilizing effects known to be imparted by actinomycin D.13 It should be noted that this difference can be considered negligible when compared with the stability of hREN mRNA after forskolin treatment, where we found no evidence for turnover even after 60 hours of transcriptional inhibition. Therefore, we could not calculate a precise half-life for hREN mRNA under those conditions. Moreover, we noted a slight upward slope in the hREN decay curves under forskolin-treated conditions. This could be explained by either continued transcription in the presence of the inhibitors, because the measured efficiency of transcriptional inhibition was <100%, or, more likely, to our method of quantifying mRNA decay that relied on GAPDH mRNA as an internal standard. Our studies indicate that the turnover of GAPDH mRNA was negligible during the first 12 hours after transcriptional inhibition but that it turned over more rapidly than did hREN mRNA thereafter (data not shown).
The precise mechanisms causing either enhanced RNA stabilization or decay remain unclear. Most information on posttranscriptional regulation has been obtained from an analysis of the iron response element (IRE) of the transferrin receptor and the AUUUA motif present in the 3' untranslated region (UTR) of certain immediate-early genes such as c-fos.15 16 Clearly, sequences present within mRNA, primarily but not exclusively located within the 3' UTR, can determine its stability. Sequences such as the AUUUA can confer decreased stability when placed downstream of normally stable messages.17 The hREN mRNA lacks any AUUUA motifs in its 3' UTR that might account for its relatively long half-life, even under unstimulated conditions. Although a number of secondary structures can theoretically form within the hREN 3' UTR, it remains unclear whether these are either necessary or sufficient for increasing stability or whether specific RNA binding proteins like those binding to the transferrin receptor IRE are involved.16
In addition to these specific sequences, a number of studies have demonstrated a correlation between poly-A tail length and mRNA stability, implying that the poly-A tract may protect certain mRNAs from rapid degradation.15 Although our data suggest that both stimulated and unstimulated hREN mRNAs utilize the same poly-A site and have similar poly-A tract length, we cannot formally rule out its importance in regulating the stability of the message. Moreover, our data demonstrating use of the same transcription initiation site rule out the possibility of additional sequences in the 5' UTR. Although 5' UTRs have yet to be demonstrated to specifically target RNA binding proteins involved in mRNA stability, their effect can be indirect, by changing overall translational efficiency. Some mRNAs become stable while others are more prone to degradation when associated with ribosomes.15 18 Moreover, sequences located upstream of the 3' UTR have been shown to be important for regulating mRNA stability.19
One aspect of mRNA turnover that has received considerable attention is the phenomenon of nonsense codonmediated decay (reviewed in Reference 2020 ). This is observed in a number of genes, particularly disease genes, when premature nonsense codon mutations are present in the mRNA. Although the mechanism remains unclear, the end product is the degradation of the mRNA before a truncated protein is generated. Interestingly, this mechanism may be protective in some disease processes, because loss of protein function may be preferable to the accumulation of abnormal protein that may have dominant negative effects. Moreover, it is likely that the process of scanning an mRNA for degradation in this pathway occurs in the nucleus, either during splicing or mRNA transport.
Unfortunately, this still leaves unresolved the mechanism causing increased hREN mRNA after stimulation of the PKA and PKC pathways. Based on other systems, it is likely that some sequence motif(s) present within the mRNA may be the target of an RNA binding protein(s) that may prevent its turnover, either by stabilizing mRNA structure or by inhibiting the action or binding of ribonucleases designed to degrade mRNA. It remains possible that the synthesis of the RNA binding protein(s) may occur by transcriptional induction via the classic cAMP-CRE pathway or that a pre-existing protein may directly or indirectly require the phosphorylating actions of PKA or PKC. Such a pre-existing protein may be labile, because we previously demonstrated that hREN mRNA induction required active translation.3 In conclusion, the abundance of an mRNA depends on 4 factors: (1) the rate of transcription to form a primary RNA product, (2) maturation of this initial RNA transcript, (3) transport of the mature mRNA to the cytoplasm, and (4) the rate of its degradation. Combining both transcriptional and posttranscriptional mechanisms may provide a mechanism for tighter control of gene regulation than can be achieved through transcriptional mechanisms alone.
| Acknowledgments |
|---|
Received August 31, 1998; first decision October 8, 1998; accepted November 12, 1998.
| References |
|---|
|
|
|---|
2.
Lang JA, Yang G, Kern JA, Sigmund CD.
Endogenous human renin expression and promoter activity in
a pulmonary carcinoma cell line (Calu-6).
Hypertension. 1995;25:704710.
3.
Lang JA, Ying L-H, Morris BJ, Sigmund CD.
Transcription and post-transcriptional mechanisms regulate expression
of human renin gene in Calu-6 cells. Am J Physiol. 1996;271:F94F100.
4.
Ying L, Morris BJ, Sigmund CD. Transactivation of the
human renin promoter by the cyclic AMP/protein kinase A pathway is
mediated by both CREB-dependent and CREB-independent mechanisms in
Calu-6 cells. J Biol Chem. 1997;272:24122420.
5.
Gilbert MT, Sun J, Yan Y, Oddoux C, Lazarus A, Tansey
WP, Lavin TN, Catanzaro DF. Renin gene promoter activity in GC cells is
regulated by cAMP and thyroid hormone through Pit-1-dependent
mechanisms. J Biol Chem. 1994;269:16.
6. Germain S, Konoshita T, Philippe J, Corvol P, Pinet F. Transcriptional induction of the human renin gene by cyclic AMP requires CREB and a factor binding to pituitary-specific trans-acting factor (Pit-1) motif. Biochem J. 1996;316:107113.
7. Caroff N, Della BR, Philippe J, Corvol P, Pinet F. Regulation of human renin secretion and renin transcription by quantitative PCR in cultured chorionic cells: synergistic effect of cyclic AMP and protein kinase C. Biochem Biophys Res Commun. 1993;193:13321338.[Medline] [Order article via Infotrieve]
8.
Chen M, Schnermann J, Smart AM, Brosius FC, Killen PD,
Briggs JP. Cyclic AMP selectively increases renin mRNA stability in
cultured juxtaglomerular granular cells. J Biol
Chem. 1993;268:2413824144.
9.
Ding Y, Davisson RL, Hardy DO, Zhu L-J, Merrill DC,
Catterall JF, Sigmund CD. The kidney androgen-regulated protein (KAP)
promoter confers renal proximal tubule cell-specific and highly
androgen-responsive expression on the human angiotensinogen
gene in transgenic mice. J Biol Chem. 1997;272:2814228148.
10.
Davisson RL, Nuutinen N, Coleman ST, Sigmund CD.
Inappropriate splicing of a chimeric gene containing a large internal
exon results in exon skipping in transgenic mice. Nucleic Acids
Res. 1996;24:40234028.
11. Sheflin LG, Brooks EM, Keegan BP, Spaulding SW. Increased epidermal growth factor expression produced by testosterone in the submaxillary gland of female mice is accompanied by changes in poly-A tail length and periodicity. Endocrinology. 1996;137:20852092.[Abstract]
12. Lee KAW, Bindereif A, Green MR. A small scale procedure for preparation of nuclear extracts that support efficient transcription and pre-mRNA splicing. Genet Anal Techn. 1988;5:2231.
13. Stacey KJ, Nagamine Y, Hume DA. RNA synthesis inhibition stabilises urokinase mRNA in macrophages. FEBS Lett. 1994;356:311313.[Medline] [Order article via Infotrieve]
14.
Chodosh LA, Fire A, Samuels M, Sharp PA.
5,6-Dichloro-1-b-D-ribofuranosylbenzimidazole (DRB) inhibits
transcription elongation by RNA polymerase II in vitro. J
Biol Chem. 1989;264:22502257.
15. Sachs AB. Messenger RNA degradation in eukaryotes. Cell. 1993;74:413421.[Medline] [Order article via Infotrieve]
16. Klausner RD, Rouault TA, Harford JB. Regulating the fate of mRNA: the control of cellular iron metabolism. Cell. 1993;72:1928.[Medline] [Order article via Infotrieve]
17. Shaw G, Kamen R. A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell. 1986;46:659667.[Medline] [Order article via Infotrieve]
18.
Poyet P, Henning SJ, Rosen JM. Hormone dependent
B-casein mRNA stabilization requires ongoing protein synthesis.
Mol Endocrinol. 1989;3:19611968.
19.
Wisdom R, Lee W. The protein-coding region of c-myc
mRNA contains a sequence that specifies rapid mRNA turnover and
induction by protein synthesis inhibitors. Genes
Dev. 1991;5:232243.
20. Maquat LE. When cells stop making sense: effects of nonsense codons on RNA metabolism in vertebrate cells. RNA. 1995;1:453465.[Abstract]
This article has been cited by other articles:
![]() |
X. Zhou, E. T. Weatherford, X. Liu, E. Born, H. L. Keen, and C. D. Sigmund Dysregulated human renin expression in transgenic mice carrying truncated genomic constructs: evidence supporting the presence of insulators at the renin locus Am J Physiol Renal Physiol, September 1, 2008; 295(3): F642 - F653. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. T. Todorov, M. Desch, N. Schmitt-Nilson, A. Todorova, and A. Kurtz Peroxisome Proliferator-Activated Receptor-{gamma} Is Involved in the Control of Renin Gene Expression Hypertension, November 1, 2007; 50(5): 939 - 944. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. T. Weatherford, H. Itani, H. L. Keen, and C. D. Sigmund Is Peroxisome Proliferator-Activated Receptor-{gamma} a New "Pal" of Renin? Hypertension, November 1, 2007; 50(5): 844 - 846. [Full Text] [PDF] |
||||
![]() |
H. A. Itani, X. Liu, J. H. Pratt, and C. D. Sigmund Functional Characterization of Polymorphisms in the Kidney Enhancer of the Human Renin Gene Endocrinology, March 1, 2007; 148(3): 1424 - 1430. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chen, S. M. Kim, M. Oppermann, R. Faulhaber-Walter, Y. Huang, D. Mizel, M. Chen, M. L. S. Lopez, L. S. Weinstein, R. A. Gomez, et al. Regulation of renin in mice with Cre recombinase-mediated deletion of G protein Gs{alpha} in juxtaglomerular cells Am J Physiol Renal Physiol, January 1, 2007; 292(1): F27 - F37. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhoux, D. R. Davis, and C. D. Sigmund The Human Renin Kidney Enhancer Is Required to Maintain Base-line Renin Expression but Is Dispensable for Tissue-specific, Cell-specific, and Regulated Expression J. Biol. Chem., November 17, 2006; 281(46): 35296 - 35304. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Klar, M. Sigl, B. Obermayer, F. Schweda, B. K. Kramer, and A. Kurtz Calcium Inhibits Renin Gene Expression by Transcriptional and Posttranscriptional Mechanisms Hypertension, December 1, 2005; 46(6): 1340 - 1346. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Klar, H. Vitzthum, and A. Kurtz Aldosterone enhances renin gene expression in juxtaglomerular cells Am J Physiol Renal Physiol, February 1, 2004; 286(2): F349 - F355. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Adams, D. J. Beveridge, L. van der Weyden, H. Mangs, P. J. Leedman, and B. J. Morris HADHB, HuR, and CP1 Bind to the Distal 3'-Untranslated Region of Human Renin mRNA and Differentially Modulate Renin Expression J. Biol. Chem., November 7, 2003; 278(45): 44894 - 44903. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. B Persson Renin: origin, secretion and synthesis J. Physiol., November 1, 2003; 552(3): 667 - 671. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. B. Persson, A. Skalweit, R. Mrowka, and B.-J. Thiele Control of renin synthesis Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2003; 285(3): R491 - R497. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Liu, X. Huang, and C. D. Sigmund Identification of a Nuclear Orphan Receptor (Ear2) as a Negative Regulator of Renin Gene Transcription Circ. Res., May 16, 2003; 92(9): 1033 - 1040. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Skalweit, A. Doller, A. Huth, T. Kahne, P. B. Persson, and B.-J. Thiele Posttranscriptional Control of Renin Synthesis: Identification of Proteins Interacting With Renin mRNA 3'-Untranslated Region Circ. Res., March 7, 2003; 92(4): 419 - 427. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Kohm, A. Mozaffarian, and V. M. Sanders B Cell Receptor- and {beta}2-Adrenergic Receptor-Induced Regulation of B7-2 (CD86) Expression in B Cells J. Immunol., June 15, 2002; 168(12): 6314 - 6322. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Lee and S. G. Laychock Regulation of Inositol Trisphosphate Receptor Isoform Expression in Glucose-Desensitized Rat Pancreatic Islets: Role of Cyclic Adenosine 3',5'-Monophosphate and Calcium Endocrinology, April 1, 2000; 141(4): 1394 - 1402. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. Sinn, D. R. Davis, and C. D. Sigmund Highly Regulated Cell Type-restricted Expression of Human Renin in Mice Containing 140- or 160-Kilobase Pair P1 Phage Artificial Chromosome Transgenes J. Biol. Chem., December 10, 1999; 274(50): 35785 - 35793. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. Sinn, X. Zhang, and C. D. Sigmund JG cell expression and partial regulation of a human renin genomic transgene driven by a minimal renin promoter Am J Physiol Renal Physiol, October 1, 1999; 277(4): F634 - F642. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Shi, T. A. Black, K. W. Gross, and C. D. Sigmund Species-Specific Differences in Positive and Negative Regulatory Elements in the Renin Gene Enhancer Circ. Res., September 17, 1999; 85(6): 479 - 488. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Hypertension Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1999 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |