Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 1999;33:943-948

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hattori, Y.
Right arrow Articles by Kasai, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hattori, Y.
Right arrow Articles by Kasai, K.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*NITRIC OXIDE
Related Collections
Right arrow Genomics
Right arrow Growth factors/cytokines
Right arrow Smooth muscle proliferation and differentiation
Right arrow Endothelium/vascular type/nitric oxide

(Hypertension. 1999;33:943-948.)
© 1999 American Heart Association, Inc.


Scientific Contributions

Troglitazone Upregulates Nitric Oxide Synthesis in Vascular Smooth Muscle Cells

Yoshiyuki Hattori; Sachiko Hattori; Kikuo Kasai

From the Department of Endocrinology, Dokkyo University School of Medicine, Mibu, Tochigi, Japan.

Correspondence to Yoshiyuki Hattori, MD, Department of Endocrinology, Dokkyo University School of Medicine, Mibu, Tochigi 321-0293, Japan. E-mail yhattori{at}dokkyomed.ac.jp


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—We investigated the effects of troglitazone on cytokine-stimulated nitric oxide (NO) production in cultured rat vascular smooth muscle cells (VSMC). The increase in NO formation caused by interleukin-1{alpha} (IL-1) was enhanced by troglitazone in a concentration-dependent manner. Bacterial lipopolysaccharide–stimulated NO synthesis was also increased by troglitazone. The combinations of IL-1, tumor necrosis factor-{alpha}, or lipopolysaccharide with interferon-{gamma} (IFN) were strong stimuli for induction of NO synthesis in VSMC, which were further potentiated by the presence of troglitazone. When troglitazone was added at increasing intervals after the stimulation of VSMC with IL-1, the enhancement in NO production decreased as the interval lengthened, suggesting that troglitazone alters NO synthase (NOS) expression by VSMC rather than having a direct affect on VSMC NOS activity. Troglitazone had no effect on IL-1–elicited or IL-1/IFN–elicited nuclear factor-{kappa}B activity in VSMC. Troglitazone inhibited the degradation of cytokine-induced NOS mRNA. Thus troglitazone appears to enhance IL-1–induced NOS mRNA levels by prolonging its half-life rather than activating its transcription, which is nuclear factor -{kappa}B–dependent. No expression of peroxisome proliferator–activated receptor-{gamma} (PPAR{gamma}) was detected in VSMC, and 15-deoxy-D12,14 prostaglandin J2, the natural ligand for the PPAR{gamma}, did not resemble the effect of troglitazone on IL-1–induced NO synthesis. These results indicate that troglitazone upregulates cytokine-stimulated NO synthesis in VSMC through PPAR{gamma}-independent mechanisms. Considering its inhibitory effects on the action of numerous growth factors on VSMC, the direct vascular effects of troglitazone shown in this study may have important implications for prevention of restenosis and possibly atherosclerosis.


Key Words: troglitazone • nitric oxide • peroxisome proliferator–activated receptor-{gamma} • cytokines • muscle, smooth, vascular


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The thiazolidinediones are novel insulin-sensitizing agents that have been shown to significantly reduce hyperinsulinemia in insulin-resistant animals and humans and to reduce hyperglycemia in diabetic models, including humans.1 2 3

Migration and proliferation of vascular smooth muscle cells (VSMC) are critical events in the development of restenosis and in the progression of atherosclerosis.4 A previous study demonstrated that the thiazolidinedione analogue pioglitazone inhibited insulin, epidermal growth factor, and serum-induced growth of cultured arterial VSMC.5 The effect of troglitazone has been investigated on intimal hyperplasia after balloon injury of the vessel wall, a situation in which platelet-derived growth factor (PDGF) and basic fibroblast growth factor (bFGF) are induced and regulate these VSMC activities. Troglitazone inhibited both bFGF-induced VSMC growth and PDGF-induced VSMC migration as well as VSMC intimal hyperplasia after endothelial injury in rats.6

In animal models of restenosis after balloon angioplasty, endogenous nitric oxide (NO) also appears to modulate myointimal hyperplasia.7 Although the endothelial source of NO synthesis is removed by angioplasty, the inducible isoform of NO synthase (iNOS) is expressed by VSMC in the vicinity of the injury. This may explain the observation that systemic administration of L-arginine (an NO precursor) can reduce the degree of myointimal hyperplasia after balloon angioplasty in animal models and that the effect of arginine is blocked by coadministration of an NO synthase inhibitor.8 9

Proinflammatory cytokines such as interleukin-1 (IL-1) and tumor necrosis factor-{alpha} (TNF) induce iNOS in VSMC.10 11 The purpose of this study was to determine the effect of the thiazolidinedione troglitazone on the cytokine-induced NO synthesis in VSMC. The thiazolidinediones are ligands for the peroxisome proliferator–activated receptor-{gamma} (PPAR{gamma}).12 PPAR{gamma} has been found to inhibit macrophage activation.13 PPAR{gamma} activators seem to exert their anti-inflammatory action, in part, by antagonizing the activities of transcription factors such as nuclear factor-{kappa}B (NF-{kappa}B),13 which has been shown to mediate the induction of iNOS.14 15 We therefore investigated the effect of troglitazone, the synthetic PPAR{gamma} agonist, on cytokine-stimulated iNOS gene expression as well as NF-{kappa}B activation of VSMC to better understand troglitazone's mechanism of action on NO synthesis by VSMC.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cell Culture and RNA Extraction
VSMC were isolated by elastase and collagenase digestion of thoracic aortas from male Wistar rats, as previously described.16 Cells in passages 10 to 15 were used for experiments. Total RNA was extracted from confluent VSMC by use of a modified guanidinium isothiocyanate method.17

Nitrite Assay
Nitrite accumulation, an indicator of NO synthesis, was measured in the cell culture medium of confluent VSMC.18 Nitrite was quantified colorimetrically after adding 100 µL of Griess reagent (1% sulfanilamide and 0.1% naphthylenediamine in 5% phosphoric acid) to 100-µL samples. Absorbance at 550 nm was determined with a microplate reader (Molecular Devices). Nitrite concentrations were calculated by comparison with the absorbance of standard solutions of sodium nitrite prepared in cell culture medium.

Northern Blot Analysis of iNOS mRNA
An iNOS cDNA (kindly provided by Dr Nunokawa)19 labeled with [{alpha}-32P]dCTP by random priming was used as a probe. Total RNA (10 µg per lane) was subjected to electrophoresis on a 1.2% agarose gel containing formaldehyde and transferred to nitrocellulose filters. The filters were prehybridized at 68°C for 15 minutes and then hybridized with the 32P-labeled iNOS cDNA probe in a rapid hybridization solution (QUIKHYB; Stratagene) at 68°C for 1 hour. The hybridized filters were washed twice for 15 minutes at room temperature with 2x SSC/0.1% SDS and then twice for 30 minutes at 60°C with 0.1x SSC/0.1% SDS. The filters were exposed to an imaging plate (Fuji Photo Film Co) at room temperature for 6 hours and analyzed with the use of a FUJIX bioimaging analyzer (BAS2000II, Fuji Photo Film Co).

NF-{kappa}B Activation
To study NF-{kappa}B activation, the cells were stably transfected with a cis-reporter plasmid containing the luciferase reporter gene linked to 5 repeats of NF-{kappa}B binding sites (pNF{kappa}B-Luc, Stratagene). For this, the pNF{kappa}B-Luc plasmid was transfected together with a pSV2neo helper plasmid (Clontech, Palo Alto, Calif) into rat VSMC with FuGEN 6 transfection reagent (Boehringer Mannheim, Mannheim, Germany). The cells were cultured in the presence of G418 (Clontech) at a concentration of 500 µg/mL with medium replacement at 2- to 3-day intervals. Approximately 3 weeks later, G418-resistant clones were isolated with the use of a cloning cylinder and analyzed individually for expression of luciferase activity. Thus several clones were selected for analysis of NF-{kappa}B activation. Luciferase activity was measured with a luciferase assay kit (Stratagene).

Reverse Transcription-Polymerase Chain Reaction Assay of PPAR{gamma} mRNA
Reverse transcription polymerase chain reaction (RT-PCR) was performed by standard methods.16 The sequences of the forward (21-mer, 5'-AGCCCTTTACCACAGTTGATT-3') and reverse (21-mer, 5'-AGACATCCCCACAGCAAG-3') primers were based on the published mouse PPAR{gamma} cDNA sequence.20 The predicted amplification product was 425 bp in length, comprising nucleotides 588 to 1012 of mouse PPAR{gamma}.20 In addition, RT-PCR to distinguish PPAR{gamma}1 mRNA from PPAR{gamma}2 mRNA was performed for 3T3-L1 cells with the use of primers for amplification of each entire coding region. PCR products were electrophoresed through a 1.5% agarose gel containing ethidium bromide and visualized by UV-induced fluorescence. To ensure that equal amounts of reverse-transcribed RNA were added to the PCR reaction, we amplified glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA in parallel, as a reference, using primers described by Terada et al.21 The PCR primers used for the full-length coding regions of PPAR{gamma}1 and PPAR{gamma}2 are: PPAR{gamma}1 forward, AAGACTACCCTTTACTGAAATTACC; PPAR{gamma}2 forward, AGCAAATCTCTGTTTTATGCTGTT; and reverse, TTCCTGCTAATACAAGTCCTTGTA.

Statistical Analysis
Data are presented as mean±SEM. Multiple comparisons were evaluated by ANOVA followed by Fisher's protected least-significant difference test. Student's unpaired t test was used for comparisons between 2 experiments. A value of P<0.05 was considered statistically significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
We examined the effects of troglitazone on NO synthesis by rat VSMC stimulated with IL-1, TNF, and lipopolysaccharide (LPS) alone or in combination with interferon-{gamma} (IFN). As shown in Figure 1, the increase in NO formation caused by IL-1 was enhanced by troglitazone in a concentration-dependent manner. LPS-stimulated NO synthesis was also increased by troglitazone. NO synthesis was not induced in cells treated with TNF alone or IFN alone in the presence and absence of troglitazone. The combination of IL-1, TNF, or LPS with IFN were strong stimuli for induction of NO synthesis in VSMC, confirming prior reports that immuno-stimulants induce iNOS activity in rat VSMC by a mechanism that is synergistic with IFN.18 The increased induction of NO synthesis caused by IL-1, LPS, or TNF in combination with IFN was also enhanced in the presence of troglitazone.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 1. Effects of troglitazone on cytokine-induced nitrite production in VSMC. VSMC were stimulated with IL-1 (10 ng/mL), LPS (30 µg/mL), or TNF (10 ng/mL) alone or in combination with IFN (100 U/mL) for 24 hours, after which nitrite accumulation in culture medium was measured. Data are mean±SEM of triplicate observations. *P<0.05 and **P<0.01 compared with control (no troglitazone).

Time-course studies, with the use of a final concentration of 25 µmol/L troglitazone, were conducted to determine whether troglitazone has a direct affect on VSMC NOS activity or alters iNOS expression by VSMC (Figure 2). When troglitazone was added at increasing intervals after the stimulation of VSMC with IL-1, the enhancement in nitrite production decreased as the interval lengthened. When troglitazone was added 8 hours after stimulation with IL-1, the amounts of nitrite in the supernatants were the same as in supernatants from the activated controls (no troglitazone).



View larger version (52K):
[in this window]
[in a new window]
 
Figure 2. Effect of adding troglitazone after stimulation of VSMC with IL-1. Troglitazone (25 µmol/L) was added at the indicated time after stimulation of VSMC with 10 ng/mL IL-1. Nitrite accumulation was measured 24 hours after administration of IL-1. Data are mean±SEM of triplicate observations. **P<0.01 compared with control (time=0 hours).

Next we investigated the effects of troglitazone on iNOS mRNA induction and its stability. We stimulated VSMC with IL-1 in the presence or absence of troglitazone. After 6 hours, iNOS mRNA levels were assessed by Northern blot analysis for IL-1–stimulated or (IL-1+troglitazone)–stimulated cells. Thereafter, the rate of disappearance of iNOS mRNA was evaluated after blocking further transcription with actinomycin D (5 µg/mL). As shown in Figure 3, the rate of decay of iNOS mRNA was blunted markedly by treatment with troglitazone. In the cells treated with troglitazone, iNOS mRNA decayed much more slowly, and the half-life increased >4-fold after the addition of troglitazone from {approx}2 hours to 8 hours compared with control cells.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 3. Effect of troglitazone on iNOS mRNA stability in rat aortic smooth muscle cells. Cells were incubated for 6 hours with IL-1 in the presence or absence of troglitazone (50 µmol/L) to increase the levels of iNOS mRNA and then exposed to 5 µg/mL of actinomycin D (ACTD). After the indicated times, total RNA was isolated and analyzed by Northern blot analysis with an iNOS-specific probe. Quantitation was performed with a bioimaging analyzer, and data represent mean of duplicate determinations from each of 2 RNA preparations (IL-1 only, {circ}; IL-1+troglitazone, {bullet}).

In addition, we investigated the effects of troglitazone on regulation of NF-{kappa}B activation by using VSMC stably transfected with an NF-{kappa}B response element-luciferase reporter plasmid. Since troglitazone is reported to have antioxidant properties,22 23 its effect on NF-{kappa}B activity was compared with 2 antioxidants, N-acetylcysteine (NAC) and pyrrolidine dithiocarbamate (PDTC), which have been shown to prevent NF-{kappa}B activation.24 25 IL-1 either alone or in combination with IFN markedly induced NF-{kappa}B activity, though IFN by itself did not show any effects. Troglitazone had no effects on IL-1–induced or IL-1/IFN–induced NF-{kappa}B activity at concentrations examined (Figure 4). In contrast, NAC (1 mmol/L) or PDTC (50 µmol/L) markedly attenuated IL-1–induced NF-{kappa}B activity, by 68% and by 88%, respectively.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 4. Effect of troglitazone on NF-{kappa}B–dependent transcriptional activity. VSMC were transfected with pNF{kappa}B-Luc (a cis-reporter plasmid containing the luciferase reporter gene linked to 5 repeats of an NF-{kappa}B binding site). The cells were left untreated ({bullet}) or were treated with IL-1 ({blacktriangleup}) or IL-1/IFN ({blacksquare}) in the presence of different concentrations of troglitazone. After 4 hours, cells were lysed and luciferase activities were measured. Data are mean±SEM of triplicate observations.

We next determined whether the effects of 15-deoxy-D12 13 prostaglandin J2 (15 days-PGJ2; Cayman Chemical, Ann Arbor, Mich), the natural ligand for PPAR{gamma},26 27 resemble those of troglitazone on IL-1–induced NO synthesis in VSMC. The 15 days-PGJ2 did not increase IL-1–induced NO production but rather decreased it at the higher concentrations (Figure 5).



View larger version (12K):
[in this window]
[in a new window]
 
Figure 5. Effects of 15 days-PGJ2 on cytokine-induced nitrite production in VSMC. VSMC were stimulated with IL-1 (10 ng/mL) for 24 hours, after which nitrite accumulation in the culture medium was measured. Data are mean±SEM of triplicate observations. *P<0.05 and **P<0.01 compared with control (no troglitazone).

Using RT-PCR, we examined whether PPAR{gamma} mRNA is present in VSMC. Although PPAR{gamma} mRNA is clearly expressed in 3T3-L1 fibroblasts and its expression is substantially increased by 3-day treatment, which induces differentiation into adipocytes (3T3-L1/D),28 it was barely detectable in VSMC. We did not find any increase in PPAR{gamma} mRNA abundance in VSMC even after the cells were stimulated with IL-1 or IL-1/IFN (data not shown). To confirm that adipocytes really express PPAR{gamma} mRNA, RT-PCR for amplification of the entire coding regions of both PPAR{gamma}1 and PPAR{gamma}2 was performed separately with 3T3-L1/D cells, which express both mRNAs (Figure 6).



View larger version (42K):
[in this window]
[in a new window]
 
Figure 6. RT-PCR analysis of PPAR{gamma} and GAPDH expression in rat VSMC and mouse 3T3-L1 cells. RNA was isolated from 3T3-L1 cells untreated (3T3-L1) or treated for 3 days with dexamethasone/insulin/3-isobutyl-1-methylxanthine (3T3-L1/D) as well as VSMC (in triplicate) and amplified with the use of PPAR{gamma}-specific primers (top). Separate experiment shows RT-PCR amplification of the full-length coding regions for PPAR{gamma}1 and PPAR{gamma}2 with RNA from 3T3-L1/D cells (bottom).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The present investigation demonstrates that troglitazone increases cytokine-stimulated NO synthesis in VSMC. To learn whether these effects of troglitazone on cytokine-induced NO synthesis by VSMC are mediated by PPAR{gamma}, we examined whether the effects of the natural PPAR{gamma} ligand, 15 days-PGJ2,26 27 resemble those of troglitazone and whether PPAR{gamma} mRNA is expressed in VSMC. We found that 15 days-PGJ2 does not enhance cytokine-stimulated NO synthesis by VSMC and that with the use of RT-PCR, the expression of PPAR{gamma} mRNA is very low in VSMC, suggesting that the stimulatory effect of troglitazone on cytokine-induced NO generation is unlikely to be mediated by PPAR{gamma}. The potential importance of the NF-{kappa}B system as a key player in control of transcription of genes for mediators of a variety of inflammatory responses, from those mediated by cytokine pathways to atherogenesis and thrombogenesis, is receiving increasing recognition. Interestingly, it has been shown that macrophage expression of PPAR{gamma} is markedly upregulated on cell activation and that PPAR{gamma}-specific ligands inhibit expression of certain genes, including iNOS, by antagonizing the transcription factors such as NF-{kappa}B in activated macrophage.13 By contrast, VSMC appear to express very low levels of PPAR{gamma} both under basal and activated conditions, and troglitazone had no effects on IL-1–induced NF-{kappa}B activities in VSMC. Alternatively, we found that troglitazone inhibits the degradation of cytokine-induced iNOS mRNA. Thus troglitazone appears to enhance IL-1–induced iNOS mRNA levels by prolonging mRNA half-life rather than activating iNOS transcription, which is NF-{kappa}B dependent.14 15 Unlike NAC and PDTC,24 25 troglitazone does not suppress cytokine-induced NO production by inhibiting the activation of NF-{kappa}B as an antioxidant but enhances NO generation by potentiating iNOS induction.

In clinical studies, within the therapeutic range of 200 to 600 mg once daily, troglitazone improves glycemic control and insulin sensitivity. The postdose plasma drug concentrations in humans observed 2.5 to 3.5 hours after 200-mg troglitazone ranged from 0.5 to 0.7 µg/mL (:11.3 to 15.9 µmol/L).29 In the present study, troglitazone potentiated cytokine-induced formation of NO in VSMC with a 2.6-fold increase at 50 µmol/L and initial detectable effects at {approx}10 µmol/L. These concentrations that enhance NO formation in vitro are likely to be attained in plasma or vascular tissue under therapeutic conditions in humans.

It is unknown whether agents that inhibit VSMC growth prevent the development of advanced atherosclerotic lesions; thiazolidinediones may be useful agents to address this question. This issue is particularly relevant to the diabetic who has a 2- to 4-fold increased incidence of coronary artery disease compared with the nondiabetic.30 Coronary balloon angioplasty is associated with a high rate of restenosis that detracts from its clinical value in the treatment of coronary artery disease. A recent clinical study shows that NO donors, which inhibit VSMC proliferation and decrease platelet aggregation in addition to their vasodilator effect, appear to have beneficial effects on restenosis after coronary balloon angioplasty.31 More recently, it has been demonstrated that troglitazone has a potent inhibitory effect on carotid arterial wall thickness in type 2 diabetes.32 Taken together, the demonstration that troglitazone increases the NO generation in VSMC raises strong interest in its potential utility to inhibit human restenosis.

Troglitazone is an agent that not only improves the insulin-resistant state in diabetic patients3 but also inhibits the action of numerous growth factors on VSMC.6 The finding that troglitazone potentiates the induction of NO synthesis may have important implications for inhibition of restenosis and atherosclerosis, pathological states in which NO plays a preventative role. Thiazolidinediones may be useful for their metabolic effects as well as for their direct vascular effects in insulin-resistant subjects, who have an increased incidence of coronary artery diseases.


*    Acknowledgments
 
This work was supported in part by a grant from the Japan Private School Promotion Foundation. Troglitazone was a generous gift from Sankyo Pharmaceutical Co (Tokyo, Japan).

Received October 27, 1998; first decision November 23, 1998; accepted December 1, 1998.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Lee MK, Miles PD, Khoursheed M, Gao KM, Moossa AR, Olefsky JM. Metabolic effects of troglitazone on fructose-induced insulin resistance in the rat. Diabetes. 1994;43:1435–1439.[Abstract]

2. Iwamoto Y, Kuzuya T, Matsuda A, Awata T, Kumakura S, Inooka G, Shiraishi I. Effect of new oral antidiabetic agent CS-045 on glucose tolerance and insulin secretion in patients with NIDDM. Diabetes Care. 1991;14:1083–1086.[Abstract]

3. Nolan JJ, Ludvik B, Beerdsen P, Joyce M, Olefsky J. Improvement in glucose tolerance and insulin resistance in obese subjects treated with troglitazone. N Engl J Med. 1994;331:1188–1193.[Abstract/Free Full Text]

4. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature. 1993;362:801–809.[Medline] [Order article via Infotrieve]

5. Dubey RK, Zhang HY, Reddy SR, Boegehold MA, Kotchen TA. Pioglitazone attenuates hypertension and inhibits growth of renal arteriolar smooth muscle in rats. Am J Physiol. 1993;265:R726–R732.[Abstract/Free Full Text]

6. Law RE, Meehan WP, Xi XP, Graf K, Wuthrich DA, Coats W, Faxon D, Hsueh WA. Troglitazone inhibits vascular smooth muscle cell growth and intimal hyperplasia. J Clin Invest. 1996;98:1897–1905.[Medline] [Order article via Infotrieve]

7. Cooke JP, Dzau VJ. Nitric oxide synthase: role in the genesis of vascular disease. Annu Rev Med. 1997;48:489–509.[Medline] [Order article via Infotrieve]

8. McNamara DB, Bedi B, Aurora H, Tena L, Ignarro LJ, Kadowitz PJ, Akers DL. L-arginine inhibits balloon catheter-induced intimal hyperplasia. Biochem Biophys Res Commun. 1993;193:291–296.[Medline] [Order article via Infotrieve]

9. Tarry WC, Makhoul RG. L-Arginine improves endothelium-dependent vasorelaxation and reduces intimal hyperplasia after balloon angioplasty. Arterioscler Thromb. 1994;14:938–943.[Abstract/Free Full Text]

10. Busse R, Mulsch A. Induction of nitric oxide synthase by cytokines in vascular smooth muscle cells. FEBS Lett. 1990;275:87–90.[Medline] [Order article via Infotrieve]

11. Beasley D, Schwartz JH, Brenner BM. Interleukin 1 induces prolonged L-arginine-dependent cyclic guanosine monophosphate and nitrite production in rat vascular smooth muscle cells. J Clin Invest. 1991;87:602–608.

12. Spiegelman BM. PPAR-gamma: adipogenic regulator and thiazolidinedione receptor. Diabetes. 1998;47:507–514.[Abstract]

13. Ricote M, Li AC, Willson TM, Kelly CJ, Glass CK. The peroxisome proliferator-activated receptor-gamma is a negative regulator of macrophage activation. Nature. 1998;391:79–82.[Medline] [Order article via Infotrieve]

14. Xie QW, Kashiwabara Y, Nathan C. Role of transcription factor NF-kB/Rel in induction of nitric oxide synthase. J Biol Chem. 1994;269:4705–4708.[Abstract/Free Full Text]

15. Nunokawa Y, Oikawa S, Tanaka S. Human inducible nitric oxide synthase gene is transcriptionally regulated by nuclear factor-kB dependent mechanism. Biochem Biophys Res Commun. 1996;223:347–352.[Medline] [Order article via Infotrieve]

16. Hattori Y, Gross SS. GTP cyclohydrolase I mRNA is induced by LPS in vascular smooth muscle: characterization, sequence and relationship to nitric oxide synthase. Biochem Biophys Res Commun. 1993;195:435–441.[Medline] [Order article via Infotrieve]

17. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–159.[Medline] [Order article via Infotrieve]

18. Gross SS, Levi R. Tetrahydrobiopterin synthesis: an absolute requirement for cytokine-induced nitric oxide generation by vascular smooth muscle. J Biol Chem. 1992;267:25722–25729.[Abstract/Free Full Text]

19. Nunokawa Y, Ishida N, Tanaka S,. Cloning of inducible nitric oxide synthase in rat vascular smooth muscle cells. Biochem Biophys Res Commun. 1993;1993:191:89–94.

20. Tontonoz P, Hu E, Graves RA, Budavari AI, Spiegelman BM. mPPAR gamma 2. tissue-specific regulator of an adipocyte enhancer. Genes Dev. 1994;8:1224–1234.[Abstract/Free Full Text]

21. Terada Y, Tomita K, Nonoguchi H, Marumo F,. Polymerase chain reaction localization of constitutive nitric oxide synthase and soluble guanylate cyclase messenger RNAs in microdissected rat nephron segments. J Clin Invest. 1992;1992:90:659–665.

22. Cominacini L, Young MM, Capriati A, Garbin U, Fratta Pasini A, Campagnola M, Davoli A, Rigoni A, Contessi GB, Lo Cascio V. Troglitazone increases the resistance of low density lipoprotein to oxidation in healthy volunteers. Diabetologia. 1997;40:1211–1218.[Medline] [Order article via Infotrieve]

23. Cominacini L, Garbin U, Pastorino AM, Campagnola M, Fratta Pasini A, Davoli A, Rigoni A, Lo Cascio V. Effects of troglitazone on in vitro oxidation of LDL and HDL induced by copper ions and endothelial cells. Diabetologia. 1997;40:165–172.[Medline] [Order article via Infotrieve]

24. Weber C, Erl W, Pietsch A, Strobel M, Ziegler-Heitbrock HW, Weber PC. Antioxidants inhibit monocyte adhesion by suppressing nuclear factor-kappa B mobilization and induction of vascular cell adhesion molecule-1 in endothelial cells stimulated to generate radicals. Arterioscler Thromb. 1994;14:1665–1673.[Abstract/Free Full Text]

25. Schreck R, Meier B, Mannel DN, Droge W, Baeuerle PA. Dithiocarbamates as potent inhibitors of nuclear factor kappa B activation in intact cells. J Exp Med. 1992;175:1181–1194.[Abstract/Free Full Text]

26. Kliewer SA, Lenhard JM, Willson TM, Patel I, Morris DC, Lehmann JM. A prostaglandin J2 metabolite binds peroxisome proliferator-activated receptor gamma and promotes adipocyte differentiation. Cell. 1995;83:813–819.[Medline] [Order article via Infotrieve]

27. Forman BM, Tontonoz P, Chen J, Brun RP, Spiegelman BM, Evans RM. 15-Deoxy-delta 12, 14-prostaglandin J2 is a ligand for the adipocyte determination factor PPAR gamma. Cell. 1995;83:803–812.[Medline] [Order article via Infotrieve]

28. Rubin CS, Lai E, Rosen OM. Acquisition of increased hormone sensitivity during in vitro adipocyte development. J Biol Chem. 1977;252:3554–3557.[Abstract/Free Full Text]

29. Izumi T, Enomoto S, Hosiyama K, Sasahara K, Shibukawa A, Nakagawa T, Sugiyama Y. Prediction of the human pharmacokinetics of troglitazone, a new and extensively metabolized antidiabetic agent, after oral administration, with an animal scale-up approach. J Pharmacol Exp Ther. 1996;277:1630–1641.[Abstract/Free Full Text]

30. Savage PJ. Cardiovascular complications of diabetes mellitus: what we know and what we need to know about their prevention. Ann Intern Med. 1996;124:123–126.[Abstract/Free Full Text]

31. The ACCORD Study. Effect of the direct nitric oxide donors linsidomine and molsidomine on angiographic restenosis after coronary balloon angioplasty. Circulation. 1997;95:83–89.[Abstract/Free Full Text]

32. Minamikawa J, Tanaka S, Yamauchi M, Inoue D, Koshiyama H. Potent inhibitory effect of troglitazone on carotid arterial wall thickness in type 2 diabetes. J Clin Endocrinol Metab. 1998;83:1818–1820.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Nephrol Dial TransplantHome page
A. C. Calkin, S. Giunti, K. A. Jandeleit-Dahm, T. J. Allen, M. E. Cooper, and M. C. Thomas
PPAR-{alpha} and -{gamma} agonists attenuate diabetic kidney disease in the apolipoprotein E knockout mouse
Nephrol. Dial. Transplant., September 1, 2006; 21(9): 2399 - 2405.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Wakino, K. Hayashi, T. Kanda, S. Tatematsu, K. Homma, K. Yoshioka, I. Takamatsu, and T. Saruta
Peroxisome Proliferator-Activated Receptor {gamma} Ligands Inhibit Rho/Rho Kinase Pathway by Inducing Protein Tyrosine Phosphatase SHP-2
Circ. Res., September 3, 2004; 95(5): e45 - e55.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. J. Baek, J.-S. Kim, J. B. Nixon, R. P. DiAugustine, and T. E. Eling
Expression of NAG-1, a Transforming Growth Factor-{beta} Superfamily Member, by Troglitazone Requires the Early Growth Response Gene EGR-1
J. Biol. Chem., February 20, 2004; 279(8): 6883 - 6892.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
T.-M. Lee and T.-F. Chou
Troglitazone administration limits infarct size by reduced phosphorylation of canine myocardial connexin43 proteins
Am J Physiol Heart Circ Physiol, October 1, 2003; 285(4): H1650 - H1659.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. J. Baek, L. C. Wilson, L. C. Hsi, and T. E. Eling
Troglitazone, a Peroxisome Proliferator-activated Receptor gamma (PPARgamma ) Ligand, Selectively Induces the Early Growth Response-1 Gene Independently of PPARgamma . A NOVEL MECHANISM FOR ITS ANTI-TUMORIGENIC ACTIVITY
J. Biol. Chem., February 14, 2003; 278(8): 5845 - 5853.
[Abstract] [Full Text] [PDF]


Home page
J CARDIOVASC PHARMACOL THERHome page
R. Carrillo-Jimenez, G. A. Lamas, and C. H. Hennekens
Thiazolidinediones Could Improve Endothelial Dysfunction and Risk of Premature Coronary Heart Disease in HIV-Infected Patients
Journal of Cardiovascular Pharmacology and Therapeutics, December 1, 2002; 7(4): 207 - 210.
[Abstract] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
E. Cernuda-Morollon, F. Rodriguez-Pascual, P. Klatt, S. Lamas, and D. Perez-Sala
PPAR Agonists Amplify iNOS Expression While Inhibiting NF-{kappa}B: Implications for Mesangial Cell Activation by Cytokines
J. Am. Soc. Nephrol., September 1, 2002; 13(9): 2223 - 2231.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
C. S. Elangbam, T. A. Brodie, H. Roger Brown, J. B. Nold, T. J. Raczniak, R. D. Tyler, R. M. Lightfoot, and H. G. Wall
Vascular Effects of GI262570X (PPAR-{gamma} agonist) in the Brown Adipose Tissue of Han Wistar Rats: A Review of 1-month, 13-week, 27-week and 2-year Oral Toxicity Studies
Toxicol Pathol, June 1, 2002; 30(4): 420 - 426.
[Abstract] [PDF]


Home page
Cardiovasc ResHome page
Y. Hattori, N. Nakanishi, and K. Kasai
Statin enhances cytokine-mediated induction of nitric oxide synthesis in vascular smooth muscle cells
Cardiovasc Res, June 1, 2002; 54(3): 649 - 658.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
Y. Aizawa, J.-i. Kawabe, N. Hasebe, N. Takehara, and K. Kikuchi
Pioglitazone Enhances Cytokine-Induced Apoptosis in Vascular Smooth Muscle Cells and Reduces Intimal Hyperplasia
Circulation, July 24, 2001; 104(4): 455 - 460.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
Y. Hattori, S. Hattori, and K. Kasai
4-Hydroxynonenal Prevents NO Production in Vascular Smooth Muscle Cells by Inhibiting Nuclear Factor-{{kappa}}B-Dependent Transcriptional Activation of Inducible NO Synthase
Arterioscler. Thromb. Vasc. Biol., July 1, 2001; 21(7): 1179 - 1183.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
S. Yonemitsu, H. Nishimura, M. Shintani, R. Inoue, Y. Yamamoto, H. Masuzaki, Y. Ogawa, K. Hosoda, G. Inoue, T. Hayashi, et al.
Troglitazone Induces GLUT4 Translocation in L6 Myotubes
Diabetes, May 1, 2001; 50(5): 1093 - 1101.
[Abstract] [Full Text]


Home page
Toxicol PatholHome page
C. S. Elangbam, R. D. Tyler, and R. M. Lightfoot
Peroxisome Proliferator-activated Receptors in Atherosclerosis and Inflammation--An Update
Toxicol Pathol, February 1, 2001; 29(2): 224 - 231.
[Abstract] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
K. Kasai, N. Banba, A. Hishinuma, M. Matsumura, H. Kakishita, M. Matsumura, S. Motohashi, N. Sato, and Y. Hattori
15-Deoxy-Delta 12,14-prostaglandin J2 facilitates thyroglobulin production by cultured human thyrocytes
Am J Physiol Cell Physiol, December 1, 2000; 279(6): C1859 - C1869.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
K. Takeda, T. Ichiki, T. Tokunou, Y. Funakoshi, N. Iino, K. Hirano, H. Kanaide, and A. Takeshita
Peroxisome Proliferator-Activated Receptor {gamma} Activators Downregulate Angiotensin II Type 1 Receptor in Vascular Smooth Muscle Cells
Circulation, October 10, 2000; 102(15): 1834 - 1839.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
U. Ikeda, M. Shimpo, Y. Murakami, and K. Shimada
Peroxisome Proliferator-Activated Receptor-{gamma} Ligands Inhibit Nitric Oxide Synthesis in Vascular Smooth Muscle Cells
Hypertension, June 1, 2000; 35(6): 1232 - 1236.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
B. Desvergne and W. Wahli
Peroxisome Proliferator-Activated Receptors: Nuclear Control of Metabolism
Endocr. Rev., October 1, 1999; 20(5): 649 - 688.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hattori, Y.
Right arrow Articles by Kasai, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hattori, Y.
Right arrow Articles by Kasai, K.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*NITRIC OXIDE
Related Collections
Right arrow Genomics
Right arrow Growth factors/cytokines
Right arrow Smooth muscle proliferation and differentiation
Right arrow Endothelium/vascular type/nitric oxide