Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 1999;33:981-986

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Robert, V.
Right arrow Articles by Delcayre, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Robert, V.
Right arrow Articles by Delcayre, C.
Related Collections
Right arrow ACE/Angiotension receptors
Right arrow Hypertension - basic studies
Right arrow Other Vascular biology

(Hypertension. 1999;33:981-986.)
© 1999 American Heart Association, Inc.


Scientific Contributions

Angiotensin AT1 Receptor Subtype as a Cardiac Target of Aldosterone

Role in Aldosterone-Salt–Induced Fibrosis

Valérie Robert; Christophe Heymes; Jean-Sébastien Silvestre; Abdelkarim Sabri; Bernard Swynghedauw; Claude Delcayre

From INSERM U127, IFR Lariboisière, Hôpital Lariboisière, Paris, France.

Correspondence to Claude Delcayre, U127-INSERM, Hôpital Lariboisière, 41 Bd de la Chapelle, 75475 Paris cedex 10, France. E-mail delcayre{at}infobiogen.fr


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—This study tests the hypothesis that aldosterone induces cardiac fibrosis through an increase of cardiac angiotensin II (Ang II) AT1 receptor levels, thereby potentiating the fibrotic effect of Ang II by determining the effects of spironolactone and losartan on cardiac fibrosis, AT1 density, and gene expression in aldosterone-salt–treated rats. Fibrosis was quantified by slot blots of collagen I and III mRNA levels and videomorphometry of Sirius red–stained collagen. AT1 receptor density was determined by (125I-Sar1-Ile8)–Ang II competition binding, and AT1 mRNA levels were analyzed by quantitative reverse transcriptase polymerase chain reaction. One month of aldosterone-salt treatment induced a decrease in plasma Ang II and an increase in blood pressure, left ventricular hypertrophy, and ventricular fibrosis. Spironolactone (20 mg/kg per day) and losartan spironolactone (10 mg/kg per day) had no effect on the first 3 parameters. Losartan was as effective as spironolactone in preventing ventricular collagen mRNA increase and fibrosis. Ventricular density of AT1 receptors increased 2-fold and was accompanied by a 3-fold increase in the corresponding mRNA in aldosterone-salt compared with sham-operated rats. Both spironolactone and losartan prevented the elevation of ventricular AT1 density and that of right ventricular AT1 mRNA levels. These results demonstrate that the mechanism by which aldosterone-salt induces cardiac fibrosis involves Ang II acting through AT1 receptors. They also suggest that the cardiac AT1 receptor is a target for aldosterone.


Key Words: heart • aldosterone • angiotensin receptor • fibrosis


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Chronic excess of aldosterone (Aldo) is associated with marked deposition of cardiac interstitial and perivascular collagen.1 2 3 The Aldo antagonist spironolactone prevents this Aldo-induced cardiac fibrosis, evidence that the intracellular mineralocorticoid receptor is involved in this response.1 The biochemical pathways of Aldo action are, however, still a subject of debate. Brilla et al4 have described a stimulatory effect of Aldo on collagen synthesis in isolated cardiac fibroblasts. In contrast, recent in vitro5 and in vivo6 studies have shown that the Aldo-induced increase in cardiac collagen synthesis involves intermediate steps that remain to be defined.

Angiotensin II (Ang II) is a potent fibrogenic factor.4 5 Besides the well-known effect of Ang II in stimulating Aldo production from the adrenal cortex, a reciprocal interaction has been reported between the hormones. In vivo, mineralocorticoids increase Ang II binding in rat smooth muscle and vessels.7 8 9 In vitro, incubation of rat vascular smooth muscle cells with Aldo results in an increase of Ang II binding10 and potentiation of the Ang II hypertrophic response.11 Two main subtypes of Ang II receptors, AT1 and AT2, have been identified to date.12 AT1 mediates many of the functions of Ang II, including stimulation of collagen synthesis, whereas the role of AT2 is less well defined. Recent studies, however, have shown that chronic blockade of AT2 in Ang II–induced hypertensive rats has no effect on arterial pressure but antagonizes the Ang II effect on arterial hypertrophy and fibrosis.13 14 An increase in Ang II receptor density has been observed in the heart of Aldo-salt–treated rats.15 Taken together, these results support the hypothesis that Aldo might increase the tissue abundance of Ang II receptors. We therefore hypothesized that Aldo produces fibrosis through an increase of Ang II receptors in myocardium and that such an increase potentiates the fibrogenic action of Ang II in myocardium.

To test this hypothesis, we analyzed the effect of AT1 blockade on cardiac fibrosis in 1-month Aldo-salt–treated rats. Our results show that (1) losartan at very high doses prevents Aldo-induced cardiac fibrosis, (2) Aldo-salt increased cardiac AT1 density and gene expression, (3) spironolactone prevented the increased cardiac AT1 density. Together these results demonstrate that the mechanism of Aldo-induced cardiac fibrosis involves Ang II and upregulation of AT1.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Animals and Drugs
Eight-week-old male Sprague-Dawley rats (Iffa Credo, Lyon, France) weighing 175 g were used. The study was conducted in accordance with both institutional guidelines and those formulated by the European community for use of experimental animals (L358 to 86/609/EEC). Uninephrectomized rats were infused with 0.75 µg/h d-aldosterone (Sigma) through osmotic minipumps (Alzet 2002, Charles River) for 1 month, as described.2 Aldosterone was dissolved in 0.154 mol/L NaCl+5 mL/L ethanol. Rats were fed ad libitum and given 0.17 mol/L NaCl, 40 mmol/L KCl solution as drinking water. Eight rats were used in each experimental group. The drug-treated Aldo-salt rats received either 20 mg/kg per day spironolactone (Sigma) added to their drinking solution or 10 mg/kg per day losartan (Merck) infused by osmotic minipump. Subhypotensive doses of spironolactone1 and of losartan were intentionally selected to prevent cardiac fibrosis and to eliminate, as far as possible, the hemodynamic effects. Spironolactone was dissolved in ethanol at 25 mg/mL and then added to drinking water and did not reprecipitate at these dilutions. Losartan was solubilized in 0.154 mol/L NaCl+5 mL/L ethanol. Treated rats drank progressively more over the course of the study: Fluid intake was monitored over the 8-week period of administration and spironolactone concentration adjusted accordingly. Uninephrectomized sham-operated rats were implanted with osmotic minipumps containing vehicle for aldosterone (0.154 mol/L NaCl+5 mL/L ethanol) and received no salt in drinking water. Rats were individually housed in metabolic cages for collection of 24-hour urine for urinary Na+ and K+ assay by flame photometry. Systolic blood pressure was measured by the tail-cuff method.2 At the time of killing, blood was collected for assay of plasma renin activity, Ang II, and corticosterone with the use of radioimmunoassay kits. The cross-reactivity versus Ang I of the anti–Ang II antibodies used in this study was 13.6%. The heart and the kidney were removed and left ventricle (LV) plus septum was separated from the right ventricle (RV). Tissue samples were frozen in liquid nitrogen and stored at -80°C until use.

Collagen Morphometry
Equatorial sections (5 µm) were cut in a cryostat at -20°C and stained with the collagen-specific Sirius red stain, as previously described.2 Images were digitized on a Macintosh IIfx by a gray level camera mounted on Leica x10 binoculars. Total collagen was quantified by Optilab 2.6.1 image analysis software (Graftek, Velizy, France).

RNA Extraction and Assay
Total RNA was purified according to Chomczynski and Sacchi,16 resuspended in water, and stored at -70°C until use. Samples were then analyzed by Northern and slot blots as previously described2 6 ; 20 µg of RNA was used for Northern blots and 1, 2, 4, and 10 µg of RNA for slot blots. Membranes were hybridized at 42°C with rat collagen {alpha}1 (I) and {alpha}1 (III) cDNA probes, and then with rat ribosomal 18S RNA oligonucleotide for normalization of collagen signals. Radioactive signals were analyzed by a computer-based imaging system (Bas 1000, Fuji).

Quantitative Reverse Transcriptase Polymerase Chain Reaction
The sequences of antisense and sense primers (Bioprobe, Paris, France) for AT1 were 5'GCACAATCGCCATAATTATCC3' (extending from base 719 through base 739 of the coding sequence) and 5'CACCTATGTAAGATCGCTTC3' (extending from base 295 through base 314 of the coding sequence). The expected size of the reverse transcriptase polymerase chain reaction (RT-PCR) product was 444 bp. For preparation of internal standards, the AT1 PCR product was subcloned into a pCR II-vector (TA cloning Kit, Invitrogen, Paris, France), and a 93-bp fragment was removed after double digestion with AccI and SspI restriction enzymes, providing a 351-bp PCR fragment. The internal standard AT1 RNA was then synthesized by in vitro transcription with T7 RNA polymerase after linearization with HindIII. The transcription reactions were performed in the presence of labeled UTP as a precursor, and the concentration of each transcript was determined after measurement of the radioactivity incorporated into RNA product. Total RNA was then RT-PCR amplified as previously detailed.17 Radioactive signals were analyzed on the Fuji Bas 1000 imaging system.

Quantitative Autoradiography of AT1
Binding analysis of AT1 was performed on 20-µm equatorial transverse sections of rat cardiac ventricles with the use of 0.5 nmol/L (125I-Sar1-Ile8)-Ang II, as previously described.17 To identify AT1 receptors, incubations were also made in the presence of the AT2 antagonist PD 123319 at 10 µmol/L, and signals were analyzed on the Fuji Bas 1000 imaging system.

Statistical Analysis
Results are expressed as mean±SEM and differences between groups evaluated by ANOVA comparison with the Scheffé test. A value of P<0.05 was considered statistically significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Anatomic, Urinary, and Plasma Data
As shown in the Table, systolic blood pressure increased by 26% (P<0.001) after 1 month of Aldo-salt treatment, with a marked decrease in body weight and a 51% (P<0.001) increase in heart weight–to–body weight ratio. In Aldo-salt–treated rats, addition of spironolactone (20 mg/kg per day) or losartan (10 mg/kg per day) had no effect on these parameters. The kidney–to–body weight ratio was also elevated by Aldo-salt treatment, and this renal hypertrophy was partially blocked by spironolactone. Aldo-salt treatment produced a marked increase in urine volume and Na+/K+ ratio. Both parameters were further increased in the spironolactone group compared with Aldo-salt alone, whereas losartan had no effect. Plasma renin activity, plasma Ang II, and corticosterone concentrations were markedly decreased at 1 month of Aldo-salt treatment, and neither spironolactone nor losartan altered these changes. Although no change in plasma potassium was seen in the Aldo-salt group, both spironolactone and losartan decreased plasma potassium.


View this table:
[in this window]
[in a new window]
 
Table 1. Anatomical, Urinary, and Plasmatic Data of Rats After 1-Month Treatment

Collagen Morphometry and Gene Expression
Histological examination of the hearts (Figure 1A) showed typical cardiac alterations including interstitial and perivascular fibrosis as previously described after Aldo-salt treatment.6 Quantification of total collagen volume fraction after Sirius red staining showed a 2-fold elevation (P<0.001) in the Aldo-salt group that was totally prevented by spironolactone or losartan (Figure 1B). In parallel, the levels of collagen I and III mRNA in the LV were analyzed by Northern blot (Figure 2A) and quantified by slot blot. Aldo-salt treatment similarly induced a 2-fold increase (P<0.001) of both collagen I and III mRNA levels (Figure 2, B and C, respectively), again totally prevented by either spironolactone or losartan.



View larger version (43K):
[in this window]
[in a new window]
 
Figure 1. Analysis of cardiac fibrosis. A,Typical examples of Sirius red–stained ventricular sections from sham-operated and 1-month Aldo-salt–treated rats. Bar represents 1 mm. B, Quantification of collagen volume fraction by videomorphometry of 5-µm Sirius red–stained equatorial sections. n=8 for all groups. Sham indicates sham-operated; Aldo, aldosterone-salt; Spi, spironolactone; Los, losartan. ***P<0.001 vs sham-operated group.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 2. Analysis of collagen I and III mRNAs in rat LV. A,Northern blot: 20 µg of RNA was used per lane. All rats were treated for 1 month as follows: A, sham-operated; B, Aldo-salt; C, Aldo-salt+spironolactone; D, Aldo-salt+losartan. B, mRNA levels of collagen I and III mRNAs/18 S rRNAs determined by slot blot analysis in rat LV (Spi, spironolactone; Los, losartan). n=8 for all groups. Sham indicates sham-operated; Aldo, aldosterone-salt. ***P<0.001 vs sham-operated group.

AT1 Autoradiography
As illustrated in Figure 3A, AT1 binding was uniformly distributed throughout the ventricular myocardium of control (sham-operated) rats. No specific change in distribution was found with any treatment. AT1 density was elevated by 41% (P<0.01) in the ventricular myocardium of Aldo-salt–treated rats (Figure 3B). Spironolactone treatment completely prevented the increase of AT1 density, and losartan-treated rats showed a decrease in density compared with sham-operated levels.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 3. In situ autoradiographic identification of Ang II receptors in rat heart. A,Representative analysis of (125I-Sar1-Ile8)-Ang II binding on 20-µm equatorial transverse sections of rat cardiac ventricles. Rats were treated for 1 month, as indicated in figure (Spi, spironolactone; Los, losartan). B, Quantitative results from Ang II receptor binding. Specific binding was calculated as the difference between total and nonspecific binding. n=8 for all groups. Sham indicates sham-operated; Aldo, aldosterone-salt. **P<0.01 vs sham-operated group.

AT1 mRNA Determination
Figure 4A shows typical RT-PCR analysis of AT1 mRNA in both ventricles of the rat heart. With the use of quantitative RT-PCR, we found that Aldo-salt treatment induced a 3-fold increase in LV AT1 mRNA level compared with sham-operated rats (1.28±0.13 vs 0.46±0.07 mol/g total RNA, P<0.001) (Figure 4B) and a 1.5-fold increase in RV AT1 mRNA level (0.43±0.03 vs 0.27±0.02 mol/g total RNA, P<0.001) (Figure 4C). The Aldo-induced increase of LV AT1 mRNA level was not altered either by spironolactone or losartan; in contrast, the increase of RV AT1 mRNA level was totally prevented by both spironolactone and losartan.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 4. Quantitative RT-PCR analysis of Ang AT1 mRNA levels in rat LV and RV. Rats were treated for 1 month, as indicated in figure (Spi, spironolactone; Los, losartan). A, 30 ng of total RNA with 20 000 molecules of internal standard AT1 mRNA was submitted to RT-PCR as described in Methods. B, Bar graph of results of RT-PCR analysis. n=8 for all groups. Sham indicates sham-operated; Aldo, aldosterone-salt. ***P<0.001 vs sham-operated group.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The main results of this study on the rat heart are that (1) high-dose losartan prevents Aldo-salt–induced fibrosis and upregulation of collagen types I and III mRNA, (2) 1-month Aldo-salt treatment increases AT1 density and AT1 mRNA accumulation, and (3) spironolactone and losartan prevent the Aldo-salt-induced increase in AT1 density independent of blood pressure and plasma concentration of Ang II.

Role of AT1 in Aldo-Salt Cardiac Fibrosis
We have previously shown in this model of hypertension that cardiac collagen type I and III mRNA levels increase at approximately 15 days of treatment. Such a delay favors an indirect control of Aldo on collagen gene expression and suggests intermediate steps.6 The main result of the present work is that chronic high-dose losartan administration totally prevented not only elevation in collagen accumulation but also the rise of collagen I and III mRNAs. In this model, elevation of collagen mRNA levels precedes that of protein.6 Taken together, these results suggest the involvement of Ang II by the AT1 receptor in Aldo-salt–induced cardiac fibrosis.

Such a result is at variance from previous studies showing that captopril1 and losartan18 did not prevent cardiac fibrosis in the same model. There are several possibilities that might explain this discrepancy. (1) angiotensin-converting enzyme (ACE) inhibition decreases not only Ang II synthesis but also bradykinin degradation. Bradykinin modulates fibroblast collagen,19 and blockade of bradykinin B2 receptors by HOE-140 completely prevents Ang II–induced cardiac fibrosis.20 Given the increased cardiac bradykinin receptors described in Aldo-salt excess,21 these observations may explain that cardiac fibrosis develops despite ACE blockade. (2) In the present study, rats were treated for 4 weeks with 10 mg/kg per day of losartan, that is, at a 3.3-fold higher dose than that used by Young and Funder.18 As it is known that cardiac ACE binding is increased in Aldo-treated rats21 with increased cardiac Ang II formation as a probable consequence and that cardiac AT1 binding is also increased as reported here and as published previously by Sun and colleagues,15 it is likely that a high dose of AT1 inhibitor is required to prevent Ang II action. Diminished cardiac fibrosis by AT1 blockade has been also observed in models of hypertension in which the circulating renin-angiotensin system is not activated, as in the stroke-prone spontaneously hypertensive rat strain22 or in deoxycorticosterone (DOCA)-salt treatment.23

The increase of AT1 density is consistent with a potentiation of Ang II effects. For example, in smooth muscle, the consequence of increased Ang II receptor density is to strongly enhance Ang II hypertrophy.24 Similarly, in cardiomyocytes from DOCA-salt–treated rats, the increased AT1 density is associated with an increased intracellular calcium response to Ang II.25 Hence, the rise of cardiac AT1 density seen in the Aldo-salt model might potentiate the well-described fibrogenic effect of Ang II.4 5 22 26

Aldosterone and Cardiac AT1 Receptors
These results raise the question of the mechanism whereby Aldo increases the density of AT1. Lowering the plasma concentrations of potassium or Ang II, or increased glucocorticoid levels, has been shown in a variety of models to increase Ang II receptor density.27 28 29 It seems unlikely that these factors are involved here because (1) the plasma concentration of corticosterone fell in all groups, (2) plasma potassium was unchanged in the Aldo-salt group, and (3) Ang II binding normalized in the spironolactone and losartan groups despite plasma concentrations of Ang II remaining low. Direct effects of mineralocorticoids on Ang II receptor density have been demonstrated in vitro in cultured vascular smooth muscle cells in which DOCA8 or Aldo9 increase Ang II receptor density in a time- and concentration-dependent manner. Despite the differences in target tissue, the decrease of elevated AT1 levels by spironolactone reported here suggests that the cardiac action of Aldo through mineralocorticoid receptors is to increase the level of AT1.

Mechanisms of Control of AT1 mRNA
Recent sequence analysis of AT1 gene has evidenced the presence of several glucocorticoid-responsive elements in the promoter region.30 It has been shown that the mineralocorticoid receptor–Aldo complex is able to bind to GRE sequences to activate the transcription of genes containing these regulatory elements.31 One hypothesis tested in this study is that Aldo-salt treatment stimulates cardiac AT1 gene expression, resulting in increased AT1 density, with quantitative RT-PCR performed on RNA prepared separately from the LV and the RV. Aldo-salt treatment induced increases in both cardiac Ang II binding and AT1 receptor mRNA. In all groups, AT1 binding was homogenously distributed throughout the ventricular myocardium. However, in the spironolactone and losartan groups, levels of LV AT1 mRNA remained elevated in sharp contrast to RV AT1 mRNA and cardiac Ang II binding, which returned to control levels. In addition, AT1 mRNA levels were increased 3-fold in LV and only 1.5-fold in RV with Aldo-salt, again suggesting a differential response of ventricles in terms of regulation of AT1 mRNA. One possible explanation of these results is that AT1 gene expression may be under the control of both Aldo and hemodynamic factors. The doses of spironolactone and losartan were chosen to have no effect on hypertension, so that the LV but not the RV remained exposed to increased hemodynamic load in all treatment groups. The consequences of chronic Aldo-salt induced hypertension on cardiac structure have been previously described, and both marked hypertrophy and upregulation of atrial natriuretic peptide are consistently observed in LV, not in RV.1 2 3 On this hypothesis, blockade of Aldo action by spironolactone or losartan results in decreased AT1 mRNAs in RV, which remain elevated in LV in response to hemodynamic factors. This idea is consistent with previous studies indicating that mechanical factors trigger the increase of AT1 mRNA level in ventricles during hemodynamic overload.32 Moreover, an increase of AT1 receptors primarily caused by increased AT1 gene transcription is seen in neonatal rat cardiac myocytes subjected to stretch.33 Even though conclusions from neonatal isolated cells cannot be extrapolated to the in vivo situation, they are further evidence that cardiac AT1 gene expression may be modified by hemodynamic overload. In the same vein, control AT1 mRNA concentrations were 1.7-fold higher in LV than RV. The reason of this difference is unknown; it may reflect metabolic differences between the RV and the LV under very different conditions of work and load.

These observations support the hypothesis that AT1 mRNA is upregulated by Aldo and is maintained elevated in the LV by hemodynamic factors. The differential response of the mRNA and of protein to blockade of either Aldo or Ang II action suggests that the regulation of AT1 receptors is more complex than anticipated and that posttranscriptional control may play an important modulatory role.

Mineralocorticoids and Fibrosis
Mechanisms for cardiac fibrosis seen in mineralocorticoid-salt excess are still uncertain. Previous results have shown that Aldo-salt or DOCA-salt cardiac fibrosis may be prevented or reduced by several classes of inhibitors, making it difficult to postulate a simple mechanism of fibrosis development. One of the essential contributions of this work is to emphasize the existence of a connection between the actions of Aldo and Ang II leading to increased responsiveness of cardiac cells to Ang II. The growth-promoting effect of Ang II has been well described, and it may thus participate in the stimulation of myofibroblast proliferation observed at sites of fibrosis in Aldo-salt–treated or Ang II–treated animals.34 Ang II–induced intracellular calcium increase may also be involved in this process because the calcium channel blocker mibefradil prevents Aldo-induced or Ang II–induced cardiac fibrosis.34 Increased cardiac bradykinin receptor binding is seen in Aldo-salt excess,21 and blockade of bradykinin B2 receptors prevents the Ang II–induced cardiac fibrosis20 ; the postulated pathway of bradykinin action is also through stimulation of myofibroblast proliferation, possibly mediated by prostaglandin release.20 The intervention of other fibrogenic hormones such as endothelin-1 in Aldo-salt cardiac fibrosis is also likely, given that it is overexpressed in the endothelium of coronary arteries and endocardium of DOCA-salt–treated rats,35 and the endothelin antagonist bosentan decreases cardiac fibrosis in the same model.36


*    Acknowledgments
 
This study was supported by grants from INSERM. Jean-Sebastien Silvestre is the recipient of a fellowship from the Ministère de la Recherche et de l'Enseignement Supérieur. The authors thank Dr Alain Carayon for Ang II assays, Dr Bernard Levy for helpful discussions, and Dr Bernard Prendergast for help in preparing the manuscript. They also thank Thierry Dakhli for animal handling.

Received July 14, 1998; first decision August 3, 1998; accepted December 2, 1998.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Brilla CG, Matsubara LS, Weber KT. Anti-aldosterone treatment and the prevention of myocardial fibrosis in primary and secondary hyperaldosteronism. J Mol Cell Cardiol. 1993;25:563–575.[Medline] [Order article via Infotrieve]

2. Robert V, Thiem NV, Cheav SL, Mouas C, Swynghedauw B, Delcayre C. Increased cardiac types I and III collagen mRNAs in aldosterone-salt hypertension. Hypertension. 1994;24:30–36.[Abstract/Free Full Text]

3. Young M, Fullerton M, Dilley R, Funder JW. Mineralocorticoids, hypertension and cardiac fibrosis. J Clin Invest. 1994;93:2578–2583.

4. Brilla CG, Zhou G, Matsubara LS, Weber KT. Collagen metabolism in cultured adult rat cardiac fibroblasts: response to angiotensin II and aldosterone. J Mol Cell Cardiol. 1995;28:809–820.

5. Fullerton M, Funder JW. Aldosterone and cardiac fibrosis: in vitro studies. Cardiovasc Res. 1994;28:1863–1867.[Abstract/Free Full Text]

6. Robert V, Silvestre JS, Charlemagne D, Sabri A, Trouve P, Wassef M, Swynghedauw B, Delcayre C. Biological determinants of aldosterone-induced cardiac fibrosis in rats. Hypertension. 1995;26:971–978.[Abstract/Free Full Text]

7. Douglas JG, Brown JP. Effect of prolonged low dose infusion of angiotensin II and aldosterone on rat smooth muscle and adrenal angiotensin II receptors. Endocrinology. 1982;111:988–992.[Abstract/Free Full Text]

8. Schiffrin EL, Gutkowska J, Genest J. Effect of angiotensin II and deoxycorticosterone infusion on vascular angiotensin II receptors in rat. Am J Physiol. 1984;246:H608–H614.[Abstract/Free Full Text]

9. Schiffrin EL, Franks DJ, Gutkowska J. Effect of aldosterone on vascular angiotensin II receptors in the rat. Can J Physiol Pharmacol. 1985;63:1522–1527.[Medline] [Order article via Infotrieve]

10. Ullian ME, Schelling JR, Limas ST. Aldosterone enhances angiotensin II receptor binding and inositol phosphate response. Hypertension. 1992;20:67–73.[Abstract/Free Full Text]

11. Hatakeyama H, Miyamori I, Fujita T, Takeda Y, Takeda R, Yamamoto H. Vascular aldosterone. J Biol Chem. 1994;269:24316–24320.[Abstract/Free Full Text]

12. Matsubara H, Kanasaki M, Murasawa S, Tsukaguchi Y, Nio Y, Inada M. Differential gene expression and regulation of angiotensin II receptor subtypes in rat cardiac fibroblasts and cardiomyocytes in culture. J Clin Invest. 1994;93:1592–1601.

13. Levy BI, Benessiano J, Henrion D, Caputo L, Heymes C, Duriez M, Poitevin P, Samuel JL. Chronic blockade of AT2-subtype receptors prevents the effect of angiotensin II on the rat vascular structure. J Clin Invest. 1996;98:418–425.[Medline] [Order article via Infotrieve]

14. Sabri A, Levy BI, Poitevin P, Caputo L, Faggin E, Marotte F, Rappaport L, Samuel JL. Differential roles of AT1 and AT2 receptor subtypes in vascular trophic and phenotypic changes in response to stimulation with angiotensin II. Arterioscler Thromb Vasc Biol. 1997;17:257–264.[Abstract/Free Full Text]

15. Sun Y, Weber KT. Ang II and aldosterone receptor binding in rat heart and kidney: response to chronic angiotensin II or aldosterone. J Lab Clin Med. 1993;122:404–411.[Medline] [Order article via Infotrieve]

16. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–159.[Medline] [Order article via Infotrieve]

17. Heymes C, Silvestre JS, Llorens-Cortes C, Chevalier B, Marotte F, Levy BI, Swynghedauw B, Samuel JL. Cardiac senescence is associated with enhanced expression of angiotensin II receptor subtypes. Endocrinology. 1998;139:2579–2587.[Abstract/Free Full Text]

18. Young MJ, Funder JW. The renin-angiotensin system in experimental mineralocorticoid-salt-induced cardiac fibrosis. Am J Physiol. 1996;271:E883–E888.[Free Full Text]

19. Goldstein RH, Polgar P. The effect and interaction of bradykinin and prostaglandins on protein and collagen production by lung fibroblasts. J Biol Chem. 1982;257:8630–8633.[Abstract/Free Full Text]

20. Sigusch HH, Campbell SE, Weber KT. Angiotensin II-induced myocardial fibrosis in rats: role of nitric oxide, prostaglandins and bradykinin. Cardiovasc Res. 1996;31:546–554.[Medline] [Order article via Infotrieve]

21. Sun Y, Ratajska A, Weber KT. Bradykinin receptor and tissue ACE binding in myocardial fibrosis: response to chronic angiotensin II or aldosterone administration in rats. J Mol Cell Cardiol. 1995;27:813–822.[Medline] [Order article via Infotrieve]

22. Fornes P, Richer C, Vacher E, Bruneval P, Giudicelli JF. Losartan's protective effects in stroke prone spontaneously hypertensive rats persist durably after treatment withdrawal. J Cardiovasc Pharmacol. 1993;22:305–313.[Medline] [Order article via Infotrieve]

23. Kim S, Ohta K, Hamaguchi A, Omura T, Yukimura T, Miura K, Inada Y, Wada T, Ishimura Y, Chatani F, Iwao H. Role of angiotensin II in renal injury of deoxycorticosterone acetate-salt hypertensive rats. Hypertension. 1994;24:195–204.[Abstract/Free Full Text]

24. Ullian ME, Walsh LG, Morinelli TA. Potentiation of angiotensin II action by corticosteroids in vascular tissue. Cardiovasc Res. 1996;32:266–273.[Abstract/Free Full Text]

25. Fareh J, Touyz RM, Schiffrin EL, Thibault G. Cardiac type-1 angiotensin II receptor status in deoxycorticosterone acetate-salt hypertension in rats. Hypertension. 1997;30:1253–1259.[Abstract/Free Full Text]

26. Nicoletti A, Heudes D, Hinglais N, Appay MD, Philippe M, Sassy-Prignet C, Bariety J, Michel JB. Left ventricular fibrosis in renovascular hypertensive rats: effect of losartan and spironolactone. Hypertension. 1995;26:101–111.[Abstract/Free Full Text]

27. Linas ST, Marzec-Calvert R, Ullian ME. K depletion alters angiotensin II receptor expression in vascular smooth muscle cells. Am J Physiol. 1990;258:C849–C854.[Abstract/Free Full Text]

28. Gunther S, Gimbrone MA, Alexander RW. Regulation by angiotensin II of its receptors in resistance blood vessels. Nature (London). 1980;287:230–232.[Medline] [Order article via Infotrieve]

29. Della Bruna R, Ries S, Himmelstoss C, Kurtz A. Expression of cardiac angiotensin II AT1 receptor genes in rat hearts is regulated by steroids but not by angiotensin II. J Hypertens. 1995;13:763–769.[Medline] [Order article via Infotrieve]

30. Guo DF, Uno S, Ishihata A, Nakamura N, Inagami T. Identification of a cis-acting glucocorticoid responsive element in the rat angiotensin II type 1A promoter. Circ Res. 1995;77:249–257.[Abstract/Free Full Text]

31. Pearce D, Yamamoto KR. Mineralocorticoid and glucocorticoid receptor activities distinguished by nonreceptor factors at a composite response element. Science. 1993;259:1161–1165.[Abstract/Free Full Text]

32. Suzuki J, Matsubara H, Urakami M, Inada M. Rat angiotensin II (type 1A) receptor mRNA regulation and subtype expression in myocardial growth and hypertrophy. Circ Res. 1993;73:439–447.[Abstract/Free Full Text]

33. Kijima K, Matsubara H, Murasawa S, Maruyama K, Mori Y, Okhubo N, Komuro I, Yazaki Y, Iwasaka T, Inada M. Mechanical stretch induces enhanced expression of angiotensin II receptor subtypes in neonatal rat cardiac myocytes. Circ Res. 1996;79:887–897.[Abstract/Free Full Text]

34. Ramires FJA, Sun Y, Weber KT. Myocardial fibrosis associated with aldosterone or angiotensin II administration: attenuation by calcium channel blockade. J Mol Cell Cardiol. 1998;30:475–483.[Medline] [Order article via Infotrieve]

35. Lariviere R, Deng LY, Day R, Sventek P, Thibault G, Schiffrin EL. Increased endothelin-1 gene expression in the endothelium of coronary arteries and endocardium in the DOCA-salt hypertensive rat. J Mol Cell Cardiol. 1995;27:2123–2131.[Medline] [Order article via Infotrieve]

36. Karam H, Heudes D, Hess P, Gonzales MF, Loffler BM, Clozel M, Clozel JP. Respective role of humoral factors and blood pressure in cardiac remodeling of DOCA hypertensive rats. Cardiovasc Res. 1996;31:287–295.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
HypertensionHome page
T. Nakamura, K. Kataoka, M. Fukuda, H. Nako, Y. Tokutomi, Y.-F. Dong, H. Ichijo, H. Ogawa, and S. Kim-Mitsuyama
Critical Role of Apoptosis Signal-Regulating Kinase 1 in Aldosterone/Salt-Induced Cardiac Inflammation and Fibrosis
Hypertension, September 1, 2009; 54(3): 544 - 551.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. M. Luther, Z. Wang, J. Ma, N. Makhanova, H.-S. Kim, and N. J. Brown
Endogenous Aldosterone Contributes to Acute Angiotensin II-Stimulated Plasminogen Activator Inhibitor-1 and Preproendothelin-1 Expression in Heart But Not Aorta
Endocrinology, May 1, 2009; 150(5): 2229 - 2236.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. L. Wilkinson-Berka, G. Tan, K. Jaworski, and A. G. Miller
Identification of a Retinal Aldosterone System and the Protective Effects of Mineralocorticoid Receptor Antagonism on Retinal Vascular Pathology
Circ. Res., January 2, 2009; 104(1): 124 - 133.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. Diez
Effects of Aldosterone on the Heart: Beyond Systemic Hemodynamics?
Hypertension, September 1, 2008; 52(3): 462 - 464.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A.C. Montezano, G.E. Callera, A. Yogi, Y. He, R.C. Tostes, G. He, E.L. Schiffrin, and R.M. Touyz
Aldosterone and Angiotensin II Synergistically Stimulate Migration in Vascular Smooth Muscle Cells Through c-Src-Regulated Redox-Sensitive RhoA Pathways
Arterioscler Thromb Vasc Biol, August 1, 2008; 28(8): 1511 - 1518.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. Yamada, M. Kushibiki, T. Osanai, H. Tomita, and K. Okumura
Vasoconstrictor effect of aldosterone via angiotensin II type 1 (AT1) receptor: possible role of AT1 receptor dimerization
Cardiovasc Res, July 1, 2008; 79(1): 169 - 178.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
Z.-H. Zhang, Y. Yu, Y.-M. Kang, S.-G. Wei, and R. B. Felder
Aldosterone acts centrally to increase brain renin-angiotensin system activity and oxidative stress in normal rats
Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H1067 - H1074.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
N. J. Brown
Aldosterone and Vascular Inflammation
Hypertension, February 1, 2008; 51(2): 161 - 167.
[Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. A. Cooper, A. Whaley-Connell, J. Habibi, Y. Wei, G. Lastra, C. Manrique, S. Stas, and J. R. Sowers
Renin-angiotensin-aldosterone system and oxidative stress in cardiovascular insulin resistance
Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2009 - H2023.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Stas, A. Whaley-Connell, J. Habibi, L. Appesh, M. R. Hayden, P. R. Karuparthi, M. Qazi, E. M. Morris, S. A. Cooper, C. D. Link, et al.
Mineralocorticoid Receptor Blockade Attenuates Chronic Overexpression of the Renin-Angiotensin-Aldosterone System Stimulation of Reduced Nicotinamide Adenine Dinucleotide Phosphate Oxidase and Cardiac Remodeling
Endocrinology, August 1, 2007; 148(8): 3773 - 3780.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. M. Mejia-Vilet, V. Ramirez, C. Cruz, N. Uribe, G. Gamba, and N. A. Bobadilla
Renal ischemia-reperfusion injury is prevented by the mineralocorticoid receptor blocker spironolactone
Am J Physiol Renal Physiol, July 1, 2007; 293(1): F78 - F86.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Wong, F. E. Brennan, M. J. Young, P. J. Fuller, and T. J. Cole
A Direct Effect of Aldosterone on Endothelin-1 Gene Expression in Vivo
Endocrinology, April 1, 2007; 148(4): 1511 - 1517.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Hirono, T. Yoshimoto, N. Suzuki, T. Sugiyama, M. Sakurada, S. Takai, N. Kobayashi, M. Shichiri, and Y. Hirata
Angiotensin II Receptor Type 1-Mediated Vascular Oxidative Stress and Proinflammatory Gene Expression in Aldosterone-Induced Hypertension: The Possible Role of Local Renin-Angiotensin System
Endocrinology, April 1, 2007; 148(4): 1688 - 1696.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. A. Frias, M. C. Rebsamen, C. Gerber-Wicht, and U. Lang
Prostaglandin E2 activates Stat3 in neonatal rat ventricular cardiomyocytes: A role in cardiac hypertrophy
Cardiovasc Res, January 1, 2007; 73(1): 57 - 65.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. M. Luther, J. V. Gainer, L. J. Murphey, C. Yu, D. E. Vaughan, J. D. Morrow, and N. J. Brown
Angiotensin II Induces Interleukin-6 in Humans Through a Mineralocorticoid Receptor-Dependent Mechanism
Hypertension, December 1, 2006; 48(6): 1050 - 1057.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
S. Johar, A. C. Cave, A. Narayanapanicker, D. J. Grieve, and A. M. Shah
Aldosterone mediates angiotensin II-induced interstitial cardiac fibrosis via a Nox2-containing NADPH oxidase
FASEB J, July 1, 2006; 20(9): 1546 - 1548.
[Abstract] [Full Text] [PDF]


Home page
Journal of Renin-Angiotensin-Aldosterone SystemHome page
J. Nehme, N. Mercier, C. Labat, A. Benetos, M. E Safar, C. Delcayre, and P. Lacolley
Differences Between Cardiac and Arterial Fibrosis and Stiffness in Aldosterone-Salt Rats: Effect of Eplerenone
Journal of Renin-Angiotensin-Aldosterone System, March 1, 2006; 7(1): 31 - 39.
[Abstract] [PDF]


Home page
Am J Health Syst PharmHome page
T. R. Marcy and T. L. Ripley
Aldosterone antagonists in the treatment of heart failure
Am. J. Health Syst. Pharm., January 1, 2006; 63(1): 49 - 58.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
P. J. Fuller and M. J. Young
Mechanisms of Mineralocorticoid Action
Hypertension, December 1, 2005; 46(6): 1227 - 1235.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
K. Ishizawa, Y. Izawa, H. Ito, C. Miki, K. Miyata, Y. Fujita, Y. Kanematsu, K. Tsuchiya, T. Tamaki, A. Nishiyama, et al.
Aldosterone Stimulates Vascular Smooth Muscle Cell Proliferation Via Big Mitogen-Activated Protein Kinase 1 Activation
Hypertension, October 1, 2005; 46(4): 1046 - 1052.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
L.-J. Min, M. Mogi, J.-M. Li, J. Iwanami, M. Iwai, and M. Horiuchi
Aldosterone and Angiotensin II Synergistically Induce Mitogenic Response in Vascular Smooth Muscle Cells
Circ. Res., September 2, 2005; 97(5): 434 - 442.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. Ma, F. Albornoz, C. Yu, D. W. Byrne, D. E. Vaughan, and N. J. Brown
Differing Effects of Mineralocorticoid Receptor-Dependent and -Independent Potassium-Sparing Diuretics on Fibrinolytic Balance
Hypertension, August 1, 2005; 46(2): 313 - 320.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
D. Fraccarollo, P. Galuppo, I. Schmidt, G. Ertl, and J. Bauersachs
Additive amelioration of left ventricular remodeling and molecular alterations by combined aldosterone and angiotensin receptor blockade after myocardial infarction
Cardiovasc Res, July 1, 2005; 67(1): 97 - 105.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
F. Xiao, J. R. Puddefoot, S. Barker, and G. P. Vinson
Mechanism for Aldosterone Potentiation of Angiotensin II-Stimulated Rat Arterial Smooth Muscle Cell Proliferation
Hypertension, September 1, 2004; 44(3): 340 - 345.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
J E Macdonald, N Kennedy, and A D Struthers
Effects of spironolactone on endothelial function, vascular angiotensin converting enzyme activity, and other prognostic markers in patients with mild heart failure already taking optimal treatment
Heart, July 1, 2004; 90(7): 765 - 770.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Q. Wang, S. Clement, G. Gabbiani, J.-D. Horisberger, M. Burnier, B. C. Rossier, and E. Hummler
Chronic hyperaldosteronism in a transgenic mouse model fails to induce cardiac remodeling and fibrosis under a normal-salt diet
Am J Physiol Renal Physiol, June 1, 2004; 286(6): F1178 - F1184.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
F. Michel, M.-L. Ambroisine, M. Duriez, C. Delcayre, B. I. Levy, and J.-S. Silvestre
Aldosterone Enhances Ischemia-Induced Neovascularization Through Angiotensin II-Dependent Pathway
Circulation, April 27, 2004; 109(16): 1933 - 1937.
[Abstract] [Full Text] [PDF]


Home page
Journal of Renin-Angiotensin-Aldosterone SystemHome page
F. K Shieh, E. Kotlyar, and F. Sam
Aldosterone and cardiovascular remodelling: focus on myocardial failure
Journal of Renin-Angiotensin-Aldosterone System, March 1, 2004; 5(1): 3 - 13.
[Abstract] [PDF]


Home page
J Am Coll CardiolHome page
D. Fraccarollo, P. Galuppo, S. Hildemann, M. Christ, G. Ertl, and J. Bauersachs
Additive improvement of left ventricular remodeling and neurohormonal activation by aldosterone receptor blockade with eplerenone and ACE inhibition in rats with myocardial infarction
J. Am. Coll. Cardiol., November 5, 2003; 42(9): 1666 - 1673.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
S. D. Solomon and M. A. Pfeffer
Aldosterone antagonism and myocardial infarction: From animals to man and back
J. Am. Coll. Cardiol., November 5, 2003; 42(9): 1674 - 1676.
[Full Text] [PDF]


Home page
CirculationHome page
B. Pitt, N. Reichek, R. Willenbrock, F. Zannad, R. A. Phillips, B. Roniker, J. Kleiman, S. Krause, D. Burns, and G. H. Williams
Effects of Eplerenone, Enalapril, and Eplerenone/Enalapril in Patients With Essential Hypertension and Left Ventricular Hypertrophy: The 4E-Left Ventricular Hypertrophy Study
Circulation, October 14, 2003; 108(15): 1831 - 1838.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. Sawathiparnich, L. J. Murphey, S. Kumar, D. E. Vaughan, and N. J. Brown
Effect of Combined AT1 Receptor and Aldosterone Receptor Antagonism on Plasminogen Activator Inhibitor-1
J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3867 - 3873.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. C. White
Aldosterone: Direct Effects on and Production by the Heart
J. Clin. Endocrinol. Metab., June 1, 2003; 88(6): 2376 - 2383.
[Full Text] [PDF]


Home page
CirculationHome page
N. J. Brown
Eplerenone: Cardiovascular Protection
Circulation, May 20, 2003; 107(19): 2512 - 2518.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. J. Casal, J.-S. Silvestre, C. Delcayre, and A. M. Capponi
Expression and Modulation of Steroidogenic Acute Regulatory Protein Messenger Ribonucleic Acid in Rat Cardiocytes and after Myocardial Infarction
Endocrinology, May 1, 2003; 144(5): 1861 - 1868.
[Abstract] [Full Text] [PDF]


Home page
Journal of Renin-Angiotensin-Aldosterone SystemHome page
S. M MacKenzie, R. Fraser, J. M. Connell, and E. Davies
Local renin-angiotensin systems and their interactions with extra-adrenal corticosteroid production
Journal of Renin-Angiotensin-Aldosterone System, December 1, 2002; 3(4): 214 - 221.
[Abstract] [PDF]


Home page
CirculationHome page
S. D. Solomon and M. A. Pfeffer
Renin-Angiotensin System and Cardiac Rupture After Myocardial Infarction
Circulation, October 22, 2002; 106(17): 2167 - 2169.
[Full Text] [PDF]


Home page
HypertensionHome page
A. S. Mihailidou, M. Mardini, J. W. Funder, and M. Raison
Mineralocorticoid and Angiotensin Receptor Antagonism During Hyperaldosteronemia
Hypertension, August 1, 2002; 40(2): 124 - 129.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
Q. Wang, E. Hummler, J. Nussberger, S. Clement, G. Gabbiani, H. R. Brunner, and M. Burnier
Blood Pressure, Cardiac, and Renal Responses to Salt and Deoxycorticosterone Acetate in Mice: Role of Renin Genes
J. Am. Soc. Nephrol., June 1, 2002; 13(6): 1509 - 1516.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
Y. Takeda, T. Yoneda, M. Demura, M. Usukura, and H. Mabuchi
Calcineurin Inhibition Attenuates Mineralocorticoid-Induced Cardiac Hypertrophy
Circulation, February 12, 2002; 105(6): 677 - 679.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
M. Hayashi, T. Tsutamoto, A. Wada, K. Maeda, N. Mabuchi, T. Tsutsui, T. Matsui, M. Fujii, T. Matsumoto, T. Yamamoto, et al.
Relationship between transcardiac extraction of aldosterone and left ventricular remodeling in patients with first acute myocardial infarction: extracting aldosterone through the heart promotes ventricular remodeling after acute myocardial infarction
J. Am. Coll. Cardiol., November 1, 2001; 38(5): 1375 - 1382.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. Foldes, M. Suo, I. Szokodi, Z. Lako-Futo, R. deChatel, O. Vuolteenaho, P. Huttunen, H. Ruskoaho, and M. Toth
Factors Derived from Adrenals Are Required for Activation of Cardiac Gene Expression in Angiotensin II-Induced Hypertension
Endocrinology, October 1, 2001; 142(10): 4256 - 4263.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
H. Peng, O. A. Carretero, M. E. Alfie, J. A. Masura, and N.-E. Rhaleb
Effects of Angiotensin-Converting Enzyme Inhibitor and Angiotensin Type 1 Receptor Antagonist in Deoxycorticosterone Acetate-Salt Hypertensive Mice Lacking Ren-2 Gene
Hypertension, March 1, 2001; 37(3): 974 - 980.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
A. Fiebeler, F. Schmidt, D. N. Muller, J.-K. Park, R. Dechend, M. Bieringer, E. Shagdarsuren, V. Breu, H. Haller, and F. C. Luft
Mineralocorticoid Receptor Affects AP-1 and Nuclear Factor-{{kappa}}B Activation in Angiotensin II-Induced Cardiac Injury
Hypertension, February 1, 2001; 37(2): 787 - 793.
[Abstract] [Full Text] [PDF]


Home page
Journal of Renin-Angiotensin-Aldosterone SystemHome page
K. T Weber and Yao Sun
Recruitable ACE and tissue repair in the infarcted heart
Journal of Renin-Angiotensin-Aldosterone System, December 1, 2000; 1(4): 295 - 303.
[PDF]


Home page
EndocrinologyHome page
R. Rocha, C. T. Stier Jr., I. Kifor, M. R. Ochoa-Maya, H. G. Rennke, G. H. Williams, and G. K. Adler
Aldosterone: A Mediator of Myocardial Necrosis and Renal Arteriopathy
Endocrinology, October 1, 2000; 141(10): 3871 - 3878.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
M. G. St. J. Sutton and N. Sharpe
Left Ventricular Remodeling After Myocardial Infarction : Pathophysiology and Therapy
Circulation, June 27, 2000; 101(25): 2981 - 2988.
[Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
Q. N. Diep, M. El Mabrouk, P. Yue, and E. L. Schiffrin
Effect of AT1 receptor blockade on cardiac apoptosis in angiotensin II-induced hypertension
Am J Physiol Heart Circ Physiol, May 1, 2002; 282(5): H1635 - H1641.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Robert, V.
Right arrow Articles by Delcayre, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Robert, V.
Right arrow Articles by Delcayre, C.
Related Collections
Right arrow ACE/Angiotension receptors
Right arrow Hypertension - basic studies
Right arrow Other Vascular biology