(Hypertension. 1999;33:981-986.)
© 1999 American Heart Association, Inc.
Scientific Contributions |
Angiotensin AT1 Receptor Subtype as a Cardiac Target of Aldosterone
Role in Aldosterone-Salt–Induced Fibrosis
From INSERM U127, IFR Lariboisière, Hôpital Lariboisière, Paris, France.
Correspondence to Claude Delcayre, U127-INSERM, Hôpital Lariboisière, 41 Bd de la Chapelle, 75475 Paris cedex 10, France. E-mail delcayre{at}infobiogen.fr
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract—This study tests the hypothesis that aldosterone induces cardiac fibrosis through an increase of cardiac angiotensin II (Ang II) AT1 receptor levels, thereby potentiating the fibrotic effect of Ang II by determining the effects of spironolactone and losartan on cardiac fibrosis, AT1 density, and gene expression in aldosterone-salt–treated rats. Fibrosis was quantified by slot blots of collagen I and III mRNA levels and videomorphometry of Sirius red–stained collagen. AT1 receptor density was determined by (125I-Sar1-Ile8)–Ang II competition binding, and AT1 mRNA levels were analyzed by quantitative reverse transcriptase polymerase chain reaction. One month of aldosterone-salt treatment induced a decrease in plasma Ang II and an increase in blood pressure, left ventricular hypertrophy, and ventricular fibrosis. Spironolactone (20 mg/kg per day) and losartan spironolactone (10 mg/kg per day) had no effect on the first 3 parameters. Losartan was as effective as spironolactone in preventing ventricular collagen mRNA increase and fibrosis. Ventricular density of AT1 receptors increased 2-fold and was accompanied by a 3-fold increase in the corresponding mRNA in aldosterone-salt compared with sham-operated rats. Both spironolactone and losartan prevented the elevation of ventricular AT1 density and that of right ventricular AT1 mRNA levels. These results demonstrate that the mechanism by which aldosterone-salt induces cardiac fibrosis involves Ang II acting through AT1 receptors. They also suggest that the cardiac AT1 receptor is a target for aldosterone.
Key Words: heart • aldosterone • angiotensin receptor • fibrosis
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Chronic excess of aldosterone (Aldo) is associated with marked deposition of cardiac interstitial and perivascular collagen.1 2 3 The Aldo antagonist spironolactone prevents this Aldo-induced cardiac fibrosis, evidence that the intracellular mineralocorticoid receptor is involved in this response.1 The biochemical pathways of Aldo action are, however, still a subject of debate. Brilla et al4 have described a stimulatory effect of Aldo on collagen synthesis in isolated cardiac fibroblasts. In contrast, recent in vitro5 and in vivo6 studies have shown that the Aldo-induced increase in cardiac collagen synthesis involves intermediate steps that remain to be defined.
Angiotensin II (Ang II) is a potent fibrogenic factor.4 5 Besides the well-known effect of Ang II in stimulating Aldo production from the adrenal cortex, a reciprocal interaction has been reported between the hormones. In vivo, mineralocorticoids increase Ang II binding in rat smooth muscle and vessels.7 8 9 In vitro, incubation of rat vascular smooth muscle cells with Aldo results in an increase of Ang II binding10 and potentiation of the Ang II hypertrophic response.11 Two main subtypes of Ang II receptors, AT1 and AT2, have been identified to date.12 AT1 mediates many of the functions of Ang II, including stimulation of collagen synthesis, whereas the role of AT2 is less well defined. Recent studies, however, have shown that chronic blockade of AT2 in Ang II–induced hypertensive rats has no effect on arterial pressure but antagonizes the Ang II effect on arterial hypertrophy and fibrosis.13 14 An increase in Ang II receptor density has been observed in the heart of Aldo-salt–treated rats.15 Taken together, these results support the hypothesis that Aldo might increase the tissue abundance of Ang II receptors. We therefore hypothesized that Aldo produces fibrosis through an increase of Ang II receptors in myocardium and that such an increase potentiates the fibrogenic action of Ang II in myocardium.
To test this hypothesis, we analyzed the effect of AT1 blockade on cardiac fibrosis in 1-month Aldo-salt–treated rats. Our results show that (1) losartan at very high doses prevents Aldo-induced cardiac fibrosis, (2) Aldo-salt increased cardiac AT1 density and gene expression, (3) spironolactone prevented the increased cardiac AT1 density. Together these results demonstrate that the mechanism of Aldo-induced cardiac fibrosis involves Ang II and upregulation of AT1.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Animals and Drugs
Eight-week-old male Sprague-Dawley rats (Iffa Credo, Lyon, France) weighing 175 g were used. The study was conducted in accordance with both institutional guidelines and those formulated by the European community for use of experimental animals (L358 to 86/609/EEC). Uninephrectomized rats were infused with 0.75 µg/h d-aldosterone (Sigma) through osmotic minipumps (Alzet 2002, Charles River) for 1 month, as described.2 Aldosterone was dissolved in 0.154 mol/L NaCl+5 mL/L ethanol. Rats were fed ad libitum and given 0.17 mol/L NaCl, 40 mmol/L KCl solution as drinking water. Eight rats were used in each experimental group. The drug-treated Aldo-salt rats received either 20 mg/kg per day spironolactone (Sigma) added to their drinking solution or 10 mg/kg per day losartan (Merck) infused by osmotic minipump. Subhypotensive doses of spironolactone1 and of losartan were intentionally selected to prevent cardiac fibrosis and to eliminate, as far as possible, the hemodynamic effects. Spironolactone was dissolved in ethanol at 25 mg/mL and then added to drinking water and did not reprecipitate at these dilutions. Losartan was solubilized in 0.154 mol/L NaCl+5 mL/L ethanol. Treated rats drank progressively more over the course of the study: Fluid intake was monitored over the 8-week period of administration and spironolactone concentration adjusted accordingly. Uninephrectomized sham-operated rats were implanted with osmotic minipumps containing vehicle for aldosterone (0.154 mol/L NaCl+5 mL/L ethanol) and received no salt in drinking water. Rats were individually housed in metabolic cages for collection of 24-hour urine for urinary Na+ and K+ assay by flame photometry. Systolic blood pressure was measured by the tail-cuff method.2 At the time of killing, blood was collected for assay of plasma renin activity, Ang II, and corticosterone with the use of radioimmunoassay kits. The cross-reactivity versus Ang I of the anti–Ang II antibodies used in this study was 13.6%. The heart and the kidney were removed and left ventricle (LV) plus septum was separated from the right ventricle (RV). Tissue samples were frozen in liquid nitrogen and stored at -80°C until use.
Collagen Morphometry
Equatorial sections (5 µm) were cut in a cryostat at
-20°C and stained with the collagen-specific Sirius red stain, as
previously described.2 Images were digitized on a
Macintosh IIfx by a gray level camera mounted on Leica x10 binoculars.
Total collagen was quantified by Optilab 2.6.1 image analysis
software (Graftek, Velizy, France).
RNA Extraction and Assay
Total RNA was purified according to Chomczynski and
Sacchi,16 resuspended in water, and stored at -70°C
until use. Samples were then analyzed by Northern and slot
blots as previously described2 6 ; 20 µg of RNA was used
for Northern blots and 1, 2, 4, and 10 µg of RNA for slot blots.
Membranes were hybridized at 42°C with rat collagen
1 (I) and 1 (III)
cDNA probes, and then with rat ribosomal 18S RNA
oligonucleotide for normalization of collagen signals.
Radioactive signals were analyzed by a computer-based imaging
system (Bas 1000, Fuji).
Quantitative Reverse Transcriptase Polymerase Chain
Reaction
The sequences of antisense and sense primers (Bioprobe, Paris,
France) for AT1 were 5'GCACAATCGCCATAATTATCC3'
(extending from base 719 through base 739 of the coding sequence) and
5'CACCTATGTAAGATCGCTTC3' (extending from base 295 through base 314 of
the coding sequence). The expected size of the reverse transcriptase
polymerase chain reaction (RT-PCR) product was 444 bp. For
preparation of internal standards, the AT1 PCR
product was subcloned into a pCR II-vector (TA cloning Kit,
Invitrogen, Paris, France), and a 93-bp fragment was removed after
double digestion with AccI and SspI restriction
enzymes, providing a 351-bp PCR fragment. The internal standard
AT1 RNA was then synthesized by in vitro
transcription with T7 RNA polymerase after linearization with
HindIII. The transcription reactions were performed in the
presence of labeled UTP as a precursor, and the concentration of each
transcript was determined after measurement of the radioactivity
incorporated into RNA product. Total RNA was then RT-PCR amplified
as previously detailed.17 Radioactive signals were
analyzed on the Fuji Bas 1000 imaging system.
Quantitative Autoradiography of
AT1
Binding analysis of AT1 was
performed on 20-µm equatorial transverse sections of rat cardiac
ventricles with the use of 0.5 nmol/L
(125I-Sar1-Ile8)-Ang II, as previously
described.17 To identify AT1
receptors, incubations were also made in the presence of the
AT2 antagonist PD 123319 at 10
µmol/L, and signals were analyzed on the Fuji Bas 1000
imaging system.
Statistical Analysis
Results are expressed as mean±SEM and differences between
groups evaluated by ANOVA comparison with the Scheffé test. A
value of P<0.05 was considered statistically
significant.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Anatomic, Urinary, and Plasma Data
As shown in the Table, systolic blood pressure increased by 26% (P<0.001) after 1 month of Aldo-salt treatment, with a marked decrease in body weight and a 51% (P<0.001) increase in heart weight–to–body weight ratio. In Aldo-salt–treated rats, addition of spironolactone (20 mg/kg per day) or losartan (10 mg/kg per day) had no effect on these parameters. The kidney–to–body weight ratio was also elevated by Aldo-salt treatment, and this renal hypertrophy was partially blocked by spironolactone. Aldo-salt treatment produced a marked increase in urine volume and Na+/K+ ratio. Both parameters were further increased in the spironolactone group compared with Aldo-salt alone, whereas losartan had no effect. Plasma renin activity, plasma Ang II, and corticosterone concentrations were markedly decreased at 1 month of Aldo-salt treatment, and neither spironolactone nor losartan altered these changes. Although no change in plasma potassium was seen in the Aldo-salt group, both spironolactone and losartan decreased plasma potassium.
|
Collagen Morphometry and Gene Expression
Histological examination of the hearts (Figure 1A) showed typical cardiac alterations
including interstitial and perivascular fibrosis as
previously described after Aldo-salt treatment.6
Quantification of total collagen volume fraction after Sirius red
staining showed a 2-fold elevation (P<0.001) in the
Aldo-salt group that was totally prevented by spironolactone or
losartan (Figure 1B). In parallel, the levels of
collagen I and III mRNA in the LV were analyzed by Northern
blot (Figure 2A) and quantified by slot
blot. Aldo-salt treatment similarly induced a 2-fold increase
(P<0.001) of both collagen I and III mRNA levels (Figure 2, B and C, respectively), again totally prevented by either
spironolactone or losartan.
|
|
AT1 Autoradiography
As illustrated in Figure 3A, AT1 binding was uniformly distributed throughout
the ventricular myocardium of control
(sham-operated) rats. No specific change in distribution was found with
any treatment. AT1 density was elevated by 41%
(P<0.01) in the ventricular
myocardium of Aldo-salt–treated rats (Figure 3B).
Spironolactone treatment completely prevented the increase of
AT1 density, and losartan-treated rats
showed a decrease in density compared with sham-operated levels.
|
AT1 mRNA Determination
Figure 4A shows typical RT-PCR
analysis of AT1 mRNA in both ventricles
of the rat heart. With the use of quantitative RT-PCR, we found that
Aldo-salt treatment induced a 3-fold increase in LV
AT1 mRNA level compared with sham-operated rats
(1.28±0.13 vs 0.46±0.07 mol/g total RNA, P<0.001) (Figure 4B) and a 1.5-fold increase in RV AT1 mRNA
level (0.43±0.03 vs 0.27±0.02 mol/g total RNA, P<0.001)
(Figure 4C). The Aldo-induced increase of LV
AT1 mRNA level was not altered either by
spironolactone or losartan; in contrast, the increase of RV
AT1 mRNA level was totally prevented by both
spironolactone and losartan.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The main results of this study on the rat heart are that (1) high-dose losartan prevents Aldo-salt–induced fibrosis and upregulation of collagen types I and III mRNA, (2) 1-month Aldo-salt treatment increases AT1 density and AT1 mRNA accumulation, and (3) spironolactone and losartan prevent the Aldo-salt-induced increase in AT1 density independent of blood pressure and plasma concentration of Ang II.
Role of AT1 in Aldo-Salt Cardiac Fibrosis
We have previously shown in this model of hypertension that
cardiac collagen type I and III mRNA levels increase at approximately
15 days of treatment. Such a delay favors an indirect control of Aldo
on collagen gene expression and suggests intermediate
steps.6 The main result of the present work is that
chronic high-dose losartan administration totally prevented not
only elevation in collagen accumulation but also the rise of collagen I
and III mRNAs. In this model, elevation of collagen mRNA levels
precedes that of protein.6 Taken together, these results
suggest the involvement of Ang II by the AT1
receptor in Aldo-salt–induced cardiac fibrosis.
Such a result is at variance from previous studies showing that captopril1 and losartan18 did not prevent cardiac fibrosis in the same model. There are several possibilities that might explain this discrepancy. (1) angiotensin-converting enzyme (ACE) inhibition decreases not only Ang II synthesis but also bradykinin degradation. Bradykinin modulates fibroblast collagen,19 and blockade of bradykinin B2 receptors by HOE-140 completely prevents Ang II–induced cardiac fibrosis.20 Given the increased cardiac bradykinin receptors described in Aldo-salt excess,21 these observations may explain that cardiac fibrosis develops despite ACE blockade. (2) In the present study, rats were treated for 4 weeks with 10 mg/kg per day of losartan, that is, at a 3.3-fold higher dose than that used by Young and Funder.18 As it is known that cardiac ACE binding is increased in Aldo-treated rats21 with increased cardiac Ang II formation as a probable consequence and that cardiac AT1 binding is also increased as reported here and as published previously by Sun and colleagues,15 it is likely that a high dose of AT1 inhibitor is required to prevent Ang II action. Diminished cardiac fibrosis by AT1 blockade has been also observed in models of hypertension in which the circulating renin-angiotensin system is not activated, as in the stroke-prone spontaneously hypertensive rat strain22 or in deoxycorticosterone (DOCA)-salt treatment.23
The increase of AT1 density is consistent with a potentiation of Ang II effects. For example, in smooth muscle, the consequence of increased Ang II receptor density is to strongly enhance Ang II hypertrophy.24 Similarly, in cardiomyocytes from DOCA-salt–treated rats, the increased AT1 density is associated with an increased intracellular calcium response to Ang II.25 Hence, the rise of cardiac AT1 density seen in the Aldo-salt model might potentiate the well-described fibrogenic effect of Ang II.4 5 22 26
Aldosterone and Cardiac AT1
Receptors
These results raise the question of the mechanism whereby Aldo
increases the density of AT1. Lowering the plasma
concentrations of potassium or Ang II, or increased glucocorticoid
levels, has been shown in a variety of models to increase Ang II
receptor density.27 28 29 It seems unlikely that these
factors are involved here because (1) the plasma concentration of
corticosterone fell in all groups, (2) plasma potassium was unchanged
in the Aldo-salt group, and (3) Ang II binding normalized in the
spironolactone and losartan groups despite plasma
concentrations of Ang II remaining low. Direct effects of
mineralocorticoids on Ang II receptor density have been demonstrated in
vitro in cultured vascular smooth muscle cells in which
DOCA8 or Aldo9 increase Ang II receptor
density in a time- and concentration-dependent manner. Despite the
differences in target tissue, the decrease of elevated
AT1 levels by spironolactone reported here
suggests that the cardiac action of Aldo through mineralocorticoid
receptors is to increase the level of AT1.
Mechanisms of Control of AT1 mRNA
Recent sequence analysis of AT1 gene has
evidenced the presence of several glucocorticoid-responsive elements in
the promoter region.30 It has been shown that the
mineralocorticoid receptor–Aldo complex is able to bind to GRE
sequences to activate the transcription of genes containing
these regulatory elements.31 One hypothesis tested in this
study is that Aldo-salt treatment stimulates cardiac AT1
gene expression, resulting in increased AT1
density, with quantitative RT-PCR performed on RNA prepared separately
from the LV and the RV. Aldo-salt treatment induced increases in both
cardiac Ang II binding and AT1 receptor mRNA. In
all groups, AT1 binding was homogenously
distributed throughout the ventricular
myocardium. However, in the spironolactone and
losartan groups, levels of LV AT1 mRNA
remained elevated in sharp contrast to RV AT1
mRNA and cardiac Ang II binding, which returned to control levels. In
addition, AT1 mRNA levels were increased 3-fold
in LV and only 1.5-fold in RV with Aldo-salt, again suggesting a
differential response of ventricles in terms of regulation of
AT1 mRNA. One possible explanation of these
results is that AT1 gene expression may be under the control
of both Aldo and hemodynamic factors. The doses of
spironolactone and losartan were chosen to have no effect on
hypertension, so that the LV but not the RV remained exposed to
increased hemodynamic load in all treatment groups. The
consequences of chronic Aldo-salt induced hypertension on cardiac
structure have been previously described, and both marked
hypertrophy and upregulation of atrial
natriuretic peptide are consistently observed in
LV, not in RV.1 2 3 On this hypothesis, blockade of
Aldo action by spironolactone or losartan results in decreased
AT1 mRNAs in RV, which remain elevated in LV
in response to hemodynamic factors. This idea is
consistent with previous studies indicating that mechanical
factors trigger the increase of AT1 mRNA level in
ventricles during hemodynamic overload.32
Moreover, an increase of AT1 receptors primarily
caused by increased AT1 gene transcription is seen in
neonatal rat cardiac myocytes subjected to stretch.33
Even though conclusions from neonatal isolated cells cannot be
extrapolated to the in vivo situation, they are further evidence that
cardiac AT1 gene expression may be modified by
hemodynamic overload. In the same vein, control
AT1 mRNA concentrations were 1.7-fold higher in
LV than RV. The reason of this difference is unknown; it may reflect
metabolic differences between the RV and the LV under very
different conditions of work and load.
These observations support the hypothesis that AT1 mRNA is upregulated by Aldo and is maintained elevated in the LV by hemodynamic factors. The differential response of the mRNA and of protein to blockade of either Aldo or Ang II action suggests that the regulation of AT1 receptors is more complex than anticipated and that posttranscriptional control may play an important modulatory role.
Mineralocorticoids and Fibrosis
Mechanisms for cardiac fibrosis seen in mineralocorticoid-salt
excess are still uncertain. Previous results have shown that Aldo-salt
or DOCA-salt cardiac fibrosis may be prevented or reduced by several
classes of inhibitors, making it difficult to postulate a
simple mechanism of fibrosis development. One of the essential
contributions of this work is to emphasize the existence of a
connection between the actions of Aldo and Ang II leading to increased
responsiveness of cardiac cells to Ang II. The growth-promoting effect
of Ang II has been well described, and it may thus participate in the
stimulation of myofibroblast proliferation observed at sites of
fibrosis in Aldo-salt–treated or Ang II–treated
animals.34 Ang II–induced intracellular calcium increase
may also be involved in this process because the calcium channel
blocker mibefradil prevents Aldo-induced or Ang II–induced cardiac
fibrosis.34 Increased cardiac bradykinin receptor binding
is seen in Aldo-salt excess,21 and blockade of bradykinin
B2 receptors prevents the Ang II–induced cardiac
fibrosis20 ; the postulated pathway of bradykinin action is
also through stimulation of myofibroblast proliferation, possibly
mediated by prostaglandin release.20 The
intervention of other fibrogenic hormones such as endothelin-1 in
Aldo-salt cardiac fibrosis is also likely, given that it is
overexpressed in the endothelium of coronary
arteries and endocardium of DOCA-salt–treated rats,35 and
the endothelin antagonist bosentan decreases cardiac
fibrosis in the same model.36
|
Acknowledgments |
|---|
This study was supported by grants from INSERM. Jean-Sebastien Silvestre is the recipient of a fellowship from the Ministère de la Recherche et de l'Enseignement Supérieur. The authors thank Dr Alain Carayon for Ang II assays, Dr Bernard Levy for helpful discussions, and Dr Bernard Prendergast for help in preparing the manuscript. They also thank Thierry Dakhli for animal handling.
Received July 14, 1998; first decision August 3, 1998; accepted December 2, 1998.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
- Brilla CG, Matsubara LS, Weber KT. Anti-aldosterone treatment and the prevention of myocardial fibrosis in primary and secondary hyperaldosteronism. J Mol Cell Cardiol. 1993;25:563–575.[Medline] [Order article via Infotrieve]
-
Robert V, Thiem NV, Cheav SL, Mouas C, Swynghedauw B,
Delcayre C. Increased cardiac types I and III collagen mRNAs in
aldosterone-salt hypertension. Hypertension. 1994;24:30–36.
[Abstract/Free Full Text] - Young M, Fullerton M, Dilley R, Funder JW. Mineralocorticoids, hypertension and cardiac fibrosis. J Clin Invest. 1994;93:2578–2583.
- Brilla CG, Zhou G, Matsubara LS, Weber KT. Collagen metabolism in cultured adult rat cardiac fibroblasts: response to angiotensin II and aldosterone. J Mol Cell Cardiol. 1995;28:809–820.
-
Fullerton M, Funder JW. Aldosterone and
cardiac fibrosis: in vitro studies. Cardiovasc Res. 1994;28:1863–1867.
[Abstract/Free Full Text] -
Robert V, Silvestre JS, Charlemagne D, Sabri A, Trouve
P, Wassef M, Swynghedauw B, Delcayre C. Biological determinants of
aldosterone-induced cardiac fibrosis in rats.
Hypertension. 1995;26:971–978.
[Abstract/Free Full Text] - Douglas JG, Brown JP. Effect of prolonged low dose infusion of angiotensin II and aldosterone on rat smooth muscle and adrenal angiotensin II receptors. Endocrinology. 1982;111:988–992.[Medline] [Order article via Infotrieve]
-
Schiffrin EL, Gutkowska J, Genest J. Effect of
angiotensin II and deoxycorticosterone infusion on vascular
angiotensin II receptors in rat. Am J
Physiol. 1984;246:H608–H614.
[Abstract/Free Full Text] - Schiffrin EL, Franks DJ, Gutkowska J. Effect of aldosterone on vascular angiotensin II receptors in the rat. Can J Physiol Pharmacol. 1985;63:1522–1527.[Medline] [Order article via Infotrieve]
-
Ullian ME, Schelling JR, Limas ST.
Aldosterone enhances angiotensin II receptor
binding and inositol phosphate response. Hypertension. 1992;20:67–73.
[Abstract/Free Full Text] -
Hatakeyama H, Miyamori I, Fujita T, Takeda Y, Takeda R,
Yamamoto H. Vascular aldosterone. J Biol
Chem. 1994;269:24316–24320.
[Abstract/Free Full Text] - Matsubara H, Kanasaki M, Murasawa S, Tsukaguchi Y, Nio Y, Inada M. Differential gene expression and regulation of angiotensin II receptor subtypes in rat cardiac fibroblasts and cardiomyocytes in culture. J Clin Invest. 1994;93:1592–1601.
- Levy BI, Benessiano J, Henrion D, Caputo L, Heymes C, Duriez M, Poitevin P, Samuel JL. Chronic blockade of AT2-subtype receptors prevents the effect of angiotensin II on the rat vascular structure. J Clin Invest. 1996;98:418–425.[Medline] [Order article via Infotrieve]
-
Sabri A, Levy BI, Poitevin P, Caputo L, Faggin E,
Marotte F, Rappaport L, Samuel JL. Differential roles of
AT1 and AT2 receptor
subtypes in vascular trophic and phenotypic changes in response to
stimulation with angiotensin II. Arterioscler Thromb
Vasc Biol. 1997;17:257–264.
[Abstract/Free Full Text] - Sun Y, Weber KT. Ang II and aldosterone receptor binding in rat heart and kidney: response to chronic angiotensin II or aldosterone. J Lab Clin Med. 1993;122:404–411.[Medline] [Order article via Infotrieve]
- Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–159.[Medline] [Order article via Infotrieve]
-
Heymes C, Silvestre JS, Llorens-Cortes C, Chevalier B,
Marotte F, Levy BI, Swynghedauw B, Samuel JL. Cardiac senescence is
associated with enhanced expression of angiotensin II
receptor subtypes. Endocrinology. 1998;139:2579–2587.
[Abstract/Free Full Text] -
Young MJ, Funder JW. The renin-angiotensin
system in experimental mineralocorticoid-salt-induced cardiac fibrosis.
Am J Physiol. 1996;271:E883–E888.
[Free Full Text] -
Goldstein RH, Polgar P. The effect and interaction of
bradykinin and prostaglandins on protein and collagen
production by lung fibroblasts. J Biol Chem. 1982;257:8630–8633.
[Abstract/Free Full Text] - Sigusch HH, Campbell SE, Weber KT. Angiotensin II-induced myocardial fibrosis in rats: role of nitric oxide, prostaglandins and bradykinin. Cardiovasc Res. 1996;31:546–554.[Medline] [Order article via Infotrieve]
- Sun Y, Ratajska A, Weber KT. Bradykinin receptor and tissue ACE binding in myocardial fibrosis: response to chronic angiotensin II or aldosterone administration in rats. J Mol Cell Cardiol. 1995;27:813–822.[Medline] [Order article via Infotrieve]
- Fornes P, Richer C, Vacher E, Bruneval P, Giudicelli JF. Losartan's protective effects in stroke prone spontaneously hypertensive rats persist durably after treatment withdrawal. J Cardiovasc Pharmacol. 1993;22:305–313.[Medline] [Order article via Infotrieve]
-
Kim S, Ohta K, Hamaguchi A, Omura T, Yukimura T, Miura
K, Inada Y, Wada T, Ishimura Y, Chatani F, Iwao H. Role of
angiotensin II in renal injury of deoxycorticosterone
acetate-salt hypertensive rats. Hypertension. 1994;24:195–204.
[Abstract/Free Full Text] -
Ullian ME, Walsh LG, Morinelli TA. Potentiation of
angiotensin II action by corticosteroids in
vascular tissue. Cardiovasc Res. 1996;32:266–273.
[Abstract/Free Full Text] -
Fareh J, Touyz RM, Schiffrin EL, Thibault G. Cardiac
type-1 angiotensin II receptor status in
deoxycorticosterone acetate-salt hypertension in rats.
Hypertension. 1997;30:1253–1259.
[Abstract/Free Full Text] -
Nicoletti A, Heudes D, Hinglais N, Appay MD, Philippe
M, Sassy-Prignet C, Bariety J, Michel JB. Left ventricular
fibrosis in renovascular hypertensive rats: effect of losartan
and spironolactone. Hypertension. 1995;26:101–111.
[Abstract/Free Full Text] -
Linas ST, Marzec-Calvert R, Ullian ME. K depletion
alters angiotensin II receptor expression in vascular
smooth muscle cells. Am J Physiol. 1990;258:C849–C854.
[Abstract/Free Full Text] - Gunther S, Gimbrone MA, Alexander RW. Regulation by angiotensin II of its receptors in resistance blood vessels. Nature (London). 1980;287:230–232.[Medline] [Order article via Infotrieve]
- Della Bruna R, Ries S, Himmelstoss C, Kurtz A. Expression of cardiac angiotensin II AT1 receptor genes in rat hearts is regulated by steroids but not by angiotensin II. J Hypertens. 1995;13:763–769.[Medline] [Order article via Infotrieve]
-
Guo DF, Uno S, Ishihata A, Nakamura N, Inagami T.
Identification of a cis-acting glucocorticoid responsive element in the
rat angiotensin II type 1A promoter. Circ Res. 1995;77:249–257.
[Abstract/Free Full Text] -
Pearce D, Yamamoto KR. Mineralocorticoid and
glucocorticoid receptor activities distinguished by nonreceptor factors
at a composite response element. Science. 1993;259:1161–1165.
[Abstract/Free Full Text] -
Suzuki J, Matsubara H, Urakami M, Inada M. Rat
angiotensin II (type 1A) receptor mRNA regulation and
subtype expression in myocardial growth and hypertrophy.
Circ Res. 1993;73:439–447.
[Abstract/Free Full Text] -
Kijima K, Matsubara H, Murasawa S, Maruyama K, Mori Y,
Okhubo N, Komuro I, Yazaki Y, Iwasaka T, Inada M. Mechanical stretch
induces enhanced expression of angiotensin II receptor
subtypes in neonatal rat cardiac myocytes. Circ Res. 1996;79:887–897.
[Abstract/Free Full Text] - Ramires FJA, Sun Y, Weber KT. Myocardial fibrosis associated with aldosterone or angiotensin II administration: attenuation by calcium channel blockade. J Mol Cell Cardiol. 1998;30:475–483.[Medline] [Order article via Infotrieve]
- Lariviere R, Deng LY, Day R, Sventek P, Thibault G, Schiffrin EL. Increased endothelin-1 gene expression in the endothelium of coronary arteries and endocardium in the DOCA-salt hypertensive rat. J Mol Cell Cardiol. 1995;27:2123–2131.[Medline] [Order article via Infotrieve]
- Karam H, Heudes D, Hess P, Gonzales MF, Loffler BM, Clozel M, Clozel JP. Respective role of humoral factors and blood pressure in cardiac remodeling of DOCA hypertensive rats. Cardiovasc Res. 1996;31:287–295.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
 |
|
 |
|
  J. Diez Effects of Aldosterone on the Heart: Beyond Systemic Hemodynamics? Hypertension, September 1, 2008; 52(3): 462 - 464. [Full Text] [PDF]
|
|
|
|
 |
|
 A.C. Montezano, G.E. Callera, A. Yogi, Y. He, R.C. Tostes, G. He, E.L. Schiffrin, and R.M. Touyz Aldosterone and Angiotensin II Synergistically Stimulate Migration in Vascular Smooth Muscle Cells Through c-Src-Regulated Redox-Sensitive RhoA Pathways Arterioscler. Thromb. Vasc. Biol., August 1, 2008; 28(8): 1511 - 1518. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Yamada, M. Kushibiki, T. Osanai, H. Tomita, and K. Okumura Vasoconstrictor effect of aldosterone via angiotensin II type 1 (AT1) receptor: possible role of AT1 receptor dimerization Cardiovasc Res, July 1, 2008; 79(1): 169 - 178. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z.-H. Zhang, Y. Yu, Y.-M. Kang, S.-G. Wei, and R. B. Felder Aldosterone acts centrally to increase brain renin-angiotensin system activity and oxidative stress in normal rats Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H1067 - H1074. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. J. Brown Aldosterone and Vascular Inflammation Hypertension, February 1, 2008; 51(2): 161 - 167. [Full Text] [PDF]
|
|
|
|
|
|
S. A. Cooper, A. Whaley-Connell, J. Habibi, Y. Wei, G. Lastra, C. Manrique, S. Stas, and J. R. Sowers Renin-angiotensin-aldosterone system and oxidative stress in cardiovascular insulin resistance Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2009 - H2023. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Stas, A. Whaley-Connell, J. Habibi, L. Appesh, M. R. Hayden, P. R. Karuparthi, M. Qazi, E. M. Morris, S. A. Cooper, C. D. Link, et al. Mineralocorticoid Receptor Blockade Attenuates Chronic Overexpression of the Renin-Angiotensin-Aldosterone System Stimulation of Reduced Nicotinamide Adenine Dinucleotide Phosphate Oxidase and Cardiac Remodeling Endocrinology, August 1, 2007; 148(8): 3773 - 3780. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Mejia-Vilet, V. Ramirez, C. Cruz, N. Uribe, G. Gamba, and N. A. Bobadilla Renal ischemia-reperfusion injury is prevented by the mineralocorticoid receptor blocker spironolactone Am J Physiol Renal Physiol, July 1, 2007; 293(1): F78 - F86. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Wong, F. E. Brennan, M. J. Young, P. J. Fuller, and T. J. Cole A Direct Effect of Aldosterone on Endothelin-1 Gene Expression in Vivo Endocrinology, April 1, 2007; 148(4): 1511 - 1517. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Hirono, T. Yoshimoto, N. Suzuki, T. Sugiyama, M. Sakurada, S. Takai, N. Kobayashi, M. Shichiri, and Y. Hirata Angiotensin II Receptor Type 1-Mediated Vascular Oxidative Stress and Proinflammatory Gene Expression in Aldosterone-Induced Hypertension: The Possible Role of Local Renin-Angiotensin System Endocrinology, April 1, 2007; 148(4): 1688 - 1696. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Frias, M. C. Rebsamen, C. Gerber-Wicht, and U. Lang Prostaglandin E2 activates Stat3 in neonatal rat ventricular cardiomyocytes: A role in cardiac hypertrophy Cardiovasc Res, January 1, 2007; 73(1): 57 - 65. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Luther, J. V. Gainer, L. J. Murphey, C. Yu, D. E. Vaughan, J. D. Morrow, and N. J. Brown Angiotensin II Induces Interleukin-6 in Humans Through a Mineralocorticoid Receptor-Dependent Mechanism Hypertension, December 1, 2006; 48(6): 1050 - 1057. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Johar, A. C. Cave, A. Narayanapanicker, D. J. Grieve, and A. M. Shah Aldosterone mediates angiotensin II-induced interstitial cardiac fibrosis via a Nox2-containing NADPH oxidase FASEB J, July 1, 2006; 20(9): 1546 - 1548. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Nehme, N. Mercier, C. Labat, A. Benetos, M. E Safar, C. Delcayre, and P. Lacolley Differences Between Cardiac and Arterial Fibrosis and Stiffness in Aldosterone-Salt Rats: Effect of Eplerenone Journal of Renin-Angiotensin-Aldosterone System, March 1, 2006; 7(1): 31 - 39. [Abstract] [PDF]
|
|
|
|
 |
|
 T. R. Marcy and T. L. Ripley Aldosterone antagonists in the treatment of heart failure Am. J. Health Syst. Pharm., January 1, 2006; 63(1): 49 - 58. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. J. Fuller and M. J. Young Mechanisms of Mineralocorticoid Action Hypertension, December 1, 2005; 46(6): 1227 - 1235. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Ishizawa, Y. Izawa, H. Ito, C. Miki, K. Miyata, Y. Fujita, Y. Kanematsu, K. Tsuchiya, T. Tamaki, A. Nishiyama, et al. Aldosterone Stimulates Vascular Smooth Muscle Cell Proliferation Via Big Mitogen-Activated Protein Kinase 1 Activation Hypertension, October 1, 2005; 46(4): 1046 - 1052. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L.-J. Min, M. Mogi, J.-M. Li, J. Iwanami, M. Iwai, and M. Horiuchi Aldosterone and Angiotensin II Synergistically Induce Mitogenic Response in Vascular Smooth Muscle Cells Circ. Res., September 2, 2005; 97(5): 434 - 442. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Ma, F. Albornoz, C. Yu, D. W. Byrne, D. E. Vaughan, and N. J. Brown Differing Effects of Mineralocorticoid Receptor-Dependent and -Independent Potassium-Sparing Diuretics on Fibrinolytic Balance Hypertension, August 1, 2005; 46(2): 313 - 320. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Fraccarollo, P. Galuppo, I. Schmidt, G. Ertl, and J. Bauersachs Additive amelioration of left ventricular remodeling and molecular alterations by combined aldosterone and angiotensin receptor blockade after myocardial infarction Cardiovasc Res, July 1, 2005; 67(1): 97 - 105. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Xiao, J. R. Puddefoot, S. Barker, and G. P. Vinson Mechanism for Aldosterone Potentiation of Angiotensin II-Stimulated Rat Arterial Smooth Muscle Cell Proliferation Hypertension, September 1, 2004; 44(3): 340 - 345. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J E Macdonald, N Kennedy, and A D Struthers Effects of spironolactone on endothelial function, vascular angiotensin converting enzyme activity, and other prognostic markers in patients with mild heart failure already taking optimal treatment Heart, July 1, 2004; 90(7): 765 - 770. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Wang, S. Clement, G. Gabbiani, J.-D. Horisberger, M. Burnier, B. C. Rossier, and E. Hummler Chronic hyperaldosteronism in a transgenic mouse model fails to induce cardiac remodeling and fibrosis under a normal-salt diet Am J Physiol Renal Physiol, June 1, 2004; 286(6): F1178 - F1184. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Michel, M.-L. Ambroisine, M. Duriez, C. Delcayre, B. I. Levy, and J.-S. Silvestre Aldosterone Enhances Ischemia-Induced Neovascularization Through Angiotensin II-Dependent Pathway Circulation, April 27, 2004; 109(16): 1933 - 1937. [Abstract] [Full Text] [PDF]
|
|
|