Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 1999;34:118-125

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Funakoshi, Y.
Right arrow Articles by Takeshita, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Funakoshi, Y.
Right arrow Articles by Takeshita, A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Related Collections
Right arrow ACE/Angiotension receptors
Right arrow Gene expression
Right arrow Mechanism of atherosclerosis/growth factors

(Hypertension. 1999;34:118-125.)
© 1999 American Heart Association, Inc.


Scientific Contributions

Induction of Interleukin-6 Expression by Angiotensin II in Rat Vascular Smooth Muscle Cells

Yuko Funakoshi; Toshihiro Ichiki; Kiyoko Ito; Akira Takeshita

From the Research Institute of Angiocardiology and Cardiovascular Clinic, Kyushu University School of Medicine, Fukuoka, Japan.

Correspondence to Toshihiro Ichiki, MD, Research Institute of Angiocardiology and Cardiovascular Clinic, Kyushu University School of Medicine, 3-1-1 Maidashi, Higashi-ku, 812-8582 Fukuoka, Japan. E-mail ichiki{at}cardiol.med.kyushu-u.ac.jp


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—Recent studies suggest that atherosclerosis is a kind of inflammatory process and that cytokine plays important roles in this process. Although it is generally accepted that angiotensin II (Ang II) plays an important role in atherogenesis, the role of Ang II in cytokine production has not been explored. In this report, we investigated the effect of Ang II on the production of interleukin-6 (IL-6), which is a multifunctional proinflammatory cytokine in rat vascular smooth muscle cells. Ang II significantly increased the expression of IL-6 mRNA and protein in a dose-dependent manner (10-10 to 10-6 mol/L). The expression of IL-6 mRNA induced by Ang II showed 2 peaks at 30 minutes and 12 to 24 hours after stimulation. The effect of Ang II on IL-6 release and mRNA expression was completely blocked by an Ang II type 1 receptor antagonist, CV11974; however, an Ang II type 2 receptor antagonist, PD123319, showed no effect. Chelating of intracellular Ca2+ with BAPTA-AM, inhibition of tyrosine kinase with genistein, and inhibition of mitogen-activated protein kinase kinase with PD98059 completely abolished the effect of Ang II. However, downregulation of protein kinase C by pretreatment with a phorbol ester for 24 hours or a specific protein kinase C inhibitor, calphostin C, did not affect the Ang II–induced expression of IL-6 mRNA. Deletion and mutational analysis of IL-6 gene promoter showed that cAMP-responsive element was important for Ang II–induced IL-6 gene expression. Gel mobility shift assay showed an increase of cAMP-responsive element binding protein by Ang II. These results provide new insights into Ang II signaling and the role of Ang II in the progression of inflammatory changes of blood vessels.


Key Words: angiotensin II • interleukins • protein kinases • cAMP-responsive element


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Atherosclerotic lesions contain elements of inflammatory reaction with fibroproliferative changes. An early atherosclerotic lesion consists largely of macrophages and T lymphocytes. With the advancement of the lesion, smooth muscle cells migrate, proliferate, and produce extracellular matrix components, presumably as part of a repair process of metabolic or physical injury and subsequent inflammation of blood vessels.1 The repair process after injury is associated with the induction of immediate early genes such as c-fos and c-jun, followed by the production of various kinds of growth factors and cytokines.

Angiotensin II (Ang II) is a multifunctional octapeptide that increases contraction of blood vessels and induces hypertrophy and hyperplasia of vascular smooth muscle cells (VSMC). There are 2 isoforms for Ang II receptor, which are designated as type 1 receptor (AT1R)2 3 and type 2 receptor (AT2R).4 5 Most of the cardiovascular effects of Ang II are ascribed to the AT1R. Ang II stimulates production of growth factors such as platelet-derived growth factor (PDGF) and transforming growth factor-ß (TGF-ß) and matrix components such as collagen and fibronectin through the AT1R in VSMC. Several lines of evidence have suggested the important roles of Ang II in vascular cell growth and tissue remodeling following hypertension, vascular injury, and atherosclerosis.6 7 8 9 10

Recent findings showed that the AT1R couples to many intracellular signal transduction pathways. In common with many other growth factors, Ang II causes a rapid induction of the growth-associated immediate early gene expression. Stimulation of AT1R by Ang II elicits tyrosine phosphorylation and activates the mitogen-activated protein kinase (MAPK) pathway.11 12 13 14 15 Understanding of the mechanism of these Ang II–stimulated signaling pathways is important because these signals eventually activate gene transcription of immediate early genes, growth factors, and extracellular matrix, resulting in hypertrophy or hyperplasia of VSMC.

Interleukin-6 (IL-6) has multiple biological activities, such as induction of B-cell differentiation, T-cell activation, induction of acute-phase protein such as C-reactive protein (CRP) and fibrinogen in the liver, and production of platelets.16 17 Ikeda et al18 showed that IL-6 increased the proliferation of VSMC in a PDGF-dependent manner. IL-6 is secreted from macrophages, T cells, endothelial cells, mesangial cells, and VSMC.18 19 20 21 22 In terms of VSMC, IL-6 is secreted by stimulation of interleukin-123 and PDGF.24 IL-6 mRNA was expressed in the atherosclerotic lesion of Watanabe heritable hyperlipidemic (WHHL) rabbits.25 The plasma level of IL-6 is elevated in patients with unstable angina.26 Although these studies suggest an important role of IL-6 in atherosclerosis, the mechanism and the source of IL-6 production are not understood. In addition, the effect of Ang II on IL-6 production has not been elucidated.

In this report we demonstrated that Ang II induced IL-6 expression in cultured rat VSMC through the AT1R. Deletion and mutational analysis of the promoter region of the IL-6 gene showed that cAMP-responsive element (CRE) plays an important role in Ang II–induced upregulation of IL-6 gene expression.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Reagents
DMEM and fetal bovine serum were purchased from GIBCO BRL. Ang II was purchased from Peptide Institute. PD98059, a MAPK kinase inhibitor, was obtained from Research Biochemicals International. Unless indicated otherwise, other chemical reagents were purchased from Wako Chemicals. [{alpha}-32P] dCTP was obtained from Dupont NEN. Bovine serum albumin was purchased from Sigma. CV11974, a specific AT1R antagonist, was obtained from Takeda Chemical Industries, Ltd, and PD123319, a specific AT2R antagonist, was obtained from Warner-Lambert, Park Davis Co. Antibody against CRE binding protein (CREB) was obtained from New England Biolabs Inc. Antibody against Stat 3 binding protein was obtained from Santa Cruz Inc.

Cell Culture
VSMC were isolated from the thoracic aorta of Sprague-Dawley rats as described previously27 and maintained in DMEM supplemented with 10% fetal bovine serum at 37°C in a humidified atmosphere of 95% air/5% CO2. Passages between 5 and 15 were used for the experiments. Cells were seeded in 6-cm tissue culture dishes or 24 well plates and cultured in DMEM with 10% fetal bovine serum for 4 days. Then the medium was changed to DMEM supplemented with 0.1% BSA. The cells were cultured for an additional 2 days and stimulated with Ang II for the indicated period.

Northern Blot Analysis
Total RNA was prepared by an acid guanidinium-phenol-chloroform extraction method.28 Northern blot analysis was performed as described previously except that 20 µg of total RNA was analyzed.29 The hybridized membrane was stripped by boiling in 0.5% SDS solution and hybridized to a 32P-labeled 18S ribosomal RNA probe to obtain a reference for the amount of applied RNA. The radioactivity of hybridized bands of IL-6 or 18S ribosomal RNA was quantified by a MacBAS bioimaging analyzer (FUJIFILM).

Deletion Mutants of Rat IL-6 Gene Promoter Region and Construction of Luciferase Fusion DNA Construct
A genomic DNA clone encoding the rat IL-6 promoter region30 was obtained by the polymerase chain reaction technique with 5' primer (5' GTGGACAGAAAACCAGGGAC 3') and 3' primer (5' CTGTTCCTGAAGGGCAGATG 3'). The product of polymerase chain reaction, the IL-6 promoter region, was sequenced by the dideoxy chain termination method (Thermo Sequenase cycle sequencing kit, Amersham) after cloning into pBluescript (Stratagene). The promoter region of IL-6 gene was digested with restriction endonucleases. The 5'-end of the digested DNA fragments was blunted by Klenow enzyme or T4 DNA polymerase, and the 3'-end was digested with XhoI, which is located in the first exon of the rat IL-6 gene. Five deletion mutants (from No. 1 to No. 5) were cloned into the SmaI-XhoI site of pGL3 basic vector (Promega Corporation). Site-directed mutagenesis was performed according to the method of Higuchi et al.31 In the deletion mutant No. 1, the wild-type sequence of CRE, ATGACGTCA, was altered to ATCGATCCA. Nucleotide sequences of the mutation were confirmed by DNA sequencing.

Transfection of IL-6 Promoter-Luciferase Fusion DNA Construct to VSMC
Confluent VSMC were split by trypsin/EDTA solution, and 5x105 cells were prepared in a 6-cm tissue culture dish. After 48 hours, 5 µg of IL-6 promoter-luciferase fusion DNA and 2 µg of ß-galactosidase gene driven by an SV40 promoter-enhancer sequence were introduced to VSMC by the DEAE dextran method according to the manufacture's instructions (Promega Corporation). After transfection, the cells were cultured in DMEM with 10% FCS for 24 hours, washed twice with phosphate-buffered saline, and stimulated with 10-6 mol/L of Ang II for 24 hours in DMEM with 0.1% BSA. The luciferase activity was measured as described previously.29 The ß-galactosidase activity in the same sample was measured spectrophotometrically according to Sambrook et al32 and used to normalize the luciferase activity.

Quantification of Rat IL-6 by Sandwich ELISA
The medium of unstimulated or Ang II–stimulated VSMC was collected and centrifuged at 12 000 rpm for 1 minute. The supernatant was stored at -70°C until assay. ELISA for rat IL-6 was performed with a Cytoscreen ELISA kit (BioSourse International) according to the manufacture's instructions. Briefly, serial dilution of recombinant rat IL-6 and test samples were applied to a microtiter plate coated with an anti-rat IL-6 monoclonal antibody, and the incubation was done at 37°C for 3 hours. The solution was discarded, and wells were washed 4 times. Then biotinylated anti-rat IL-6 antibody solution was added. After the incubation at room temperature for 30 minutes and washing 4 times, streptavidin–horseradish peroxidase was added. After the incubation at room temperature for 30 minutes and washing 4 times, a stabilized chromogen, tetramethylbenzidine, was added. The plate was incubated at room temperature for 30 minutes in the dark, and the color was read spectrophotometrically at 450 nm.

Preparation of Nuclear Extracts and Gel Mobility Shift Assay
Nuclear extracts were prepared according to the methods described by Dignam et al33 and Osborn et al.34 Gel mobility shift assay was performed as described previously.29 DNA probe (wild-type CRE: 5'-GCTAAATGACGTCACATT-3') was labeled with 32P. Ten micrograms of nuclear extracts was incubated with 1x105 cpm of labeled DNA probe and 2 µg of deoxyinosine-deoxycytidine heteropolymer in a buffer containing 20 mmol/L HEPES, pH 7.9, 50 mmol/L KCl, 1 mmol/L MgCl2, 5 mmol/L dithiothreitol, 1 mmol/L EDTA, 4% glycerol, and 50 mg/L BSA for 30 minutes at room temperature and electrophoresed on 5% acrylamide gel. Wild-type CRE or mutant CRE (5'-GCTAAATCGATCCACATT-3') was added as a competitor. After electrophoresis, gels were dried and exposed to an x-ray film at -80°C.

Statistical Analysis
Statistical analyses were performed by 1-way or 2-way ANOVA and multiple comparison (Fisher) test if appropriate. A P value <0.05 was considered significant. Data were expressed as mean±SE.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Ang II–Increased IL-6 Production
VSMC were stimulated with Ang II, and the protein level of IL-6 in the supernatant was measured by sandwich ELISA. As shown in Figure 1A, the protein level of IL-6 in the tissue culture medium of Ang II (10-7 mol/L)–stimulated VSMC was increased in a time-dependent manner. A small amount of IL-6 was detected in the supernatant of unstimulated VSMC after 24 hours. A significant increase of IL-6 in the supernatant of Ang II–stimulated VSMC was observed after 6 hours. Next we examined the effect of isoform-specific antagonist for Ang II receptor on the enhancement of IL-6 expression. CV11974 (10-5 mol/L), an AT1R-specific antagonist, inhibited the enhancement of IL-6 production by Ang II, but PD123319 (10-5 mol/L), an AT2R-specific antagonist, had no significant effect. These results suggest that Ang II stimulates IL-6 production through the AT1R in VSMC. At 24 hours of stimulation, Ang II dose dependently increased IL-6 production (Figure 1B).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 1. IL-6 in the supernatant of cultured rat VSMC. VSMC were grown confluent in 24 well plates and growth-arrested in DMEM with 0.1% BSA for 2 days. Then VSMC were stimulated with Ang II (AII), and production of IL-6 in the supernatant was measured by sandwich ELISA. A, VSMC were cultured with Ang II (10-7 mol/L) or without Ang II for the indicated periods. Two-way ANOVA showed that the time-dependent increase of IL-6 production was significantly higher in Ang II–stimulated VSMC than in control VSMC. VSMC were cultured with Ang II (10-7 mol/L) for 48 hours or stimulated with Ang II (10-7 mol/L) after pretreatment with either the AT1R antagonist CV119734 (10-5 mol/L) or the AT2R antagonist PD123319 (10-5 mol/L) for 30 minutes. B, VSMC were cultured with various concentrations of Ang II for 24 hours. Results are expressed as mean±SE (n=4).

Enhancement of IL-6 mRNA Expression by Ang II
We examined the time course of Ang II–induced IL-6 mRNA expression (Figure 2). Two species of IL-6 gene transcript were detected (Figure 2A). The most abundant transcript was {approx}1.3 kb in length, and the less abundant transcript was {approx}2.4 kb. The 2 IL-6 mRNA species are generated by an alternative polyadenylation.30 For the quantification of IL-6 mRNA, the radioactivities of both mRNA species were taken into account. As seen in Figure 2, a biphasic increase of IL-6 mRNA by Ang II was observed. The first peak was at 30 minutes after Ang II stimulation. Then the expression level of IL-6 mRNA was decreased, and the second peak was at 12 to 24 hours after Ang II stimulation.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 2. Time course of the expression of IL-6 mRNA induced by Ang II. VSMC were grown confluent and growth-arrested in DMEM with 0.1% BSA for 2 days. VSMC were stimulated with Ang II (10-6 mol/L) for the indicated periods. A, Twenty micrograms of total RNA per lane was electrophoresed and transferred to a nylon membrane. The blot was sequentially hybridized with cDNA probes for IL-6 and 18S rRNA. B, The radioactivities of the bands were measured by an imaging analyzer. The radioactivity of IL-6 mRNA was standardized by that of 18S rRNA mRNA. The ratio in the control was designated as 1. Results are expressed as mean±SE (n=4).

VSMC were incubated with various concentrations of Ang II for 30 minutes. The expression of IL-6 mRNA by Ang II was increased dose dependently (Figure 3). We also examined the Ang II receptor responsible for IL-6 mRNA expression by using an isoform-specific antagonist. CV11974 completely abolished the IL-6 mRNA induction by Ang II; however, PD 123319 showed no effect (Figure 3). This result suggests that Ang II induces IL-6 mRNA expression through the AT1R and is consistent with the results of IL-6 protein production.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 3. Dose-dependent expression of IL-6 mRNA expression by Ang II. VSMC were grown confluent and growth-arrested in DMEM medium with 0.1% BSA for 2 days. VSMC were cultured with various concentrations of Ang II (10-10 to 10-6 mol/L) or without Ang II for 30 minutes. To determine the Ang II receptor isoform responsible for IL-6 mRNA upregulation, VSMC were pretreated with either the AT1R antagonist CV11974 (10-5 mol/L) or the AT2R antagonist PD123319 (10-5 mol/L) for 30 minutes and then stimulated with Ang II (10-7 mol/L) for 30 minutes. A, Northern blot analysis was performed as in Figure 2A. B, The radioactivities of the bands were measured by an imaging analyzer. Results are expressed as mean±SE (n=4).

Intracellular Signals in Ang II–Induced IL-6 Expression
We examined the signaling pathway of Ang II important for the induction of IL-6 gene expression (Figure 4). Protein kinase C (PKC) activation35 and intracellular Ca2+ mobilization36 have been reported to be important signals through the AT1R. VSMC were treated for 24 hours with phorbol 12-myristate 13-acetate (PMA) (10-6 mol/L) for downregulation of PKC activity or pretreated with a PKC inhibitor, calphostin C (10-6 mol/L, 30 minutes), and stimulated with 10-6 mol/L of Ang II for 30 minutes. Although prolonged exposure to PMA or calphostin C increased basal IL-6 mRNA expression, response to Ang II was not inhibited by these treatments. Preincubation of VSMC with BAPTA-AM (10-5 mol/L), an intracellular Ca2+ chelator, for 30 minutes before Ang II stimulation inhibited Ang II–induced IL-6 mRNA expression. EGTA (10-2 mol/L, 30 minutes), an extracellular Ca2+ chelator, did not inhibit Ang II–induced IL-6 mRNA expression. Basal and Ang II–induced IL-6 mRNA expression was rather enhanced by preincubation with EGTA. These results suggest that Ang II activates IL-6 gene expression through an intracellular Ca2+-dependent pathway. Tyrosine phosphorylation and activation of MAPK are also important signals of AT1R.37 Pretreatment with genistein (10-5 mol/L), which inhibits tyrosine kinase, and PD98059 (10-5 mol/L), which inhibits activation of MAPK kinase, abolished the effect of Ang II on the induction of IL-6 mRNA. These results suggest that Ang II–induced tyrosine phosphorylation and MAPK activation also play important roles in the activation of IL-6 gene expression.



View larger version (41K):
[in this window]
[in a new window]
 
Figure 4. Effects of various inhibitors on Ang II–induced IL-6 mRNA expression. A, VSMC were pretreated with BAPTA-AM (10-5 mol/L) for 30 minutes, EGTA (10-2 mol/L) for 30 minutes, PMA (10-6 mol/L) for 24 hours, PD98059 (10-5 mol/L) for 30 minutes, genistein (10-4 mol/L) for 30 minutes, or calphostin C (10-6 mol/L) for 30 minutes. Then VSMC were stimulated with Ang II (10-6 mol/L) for 30 minutes. Northern blot analysis was performed as in Figure 2A. B, The radioactivities of the bands were measured by an imaging analyzer. Results are expressed as mean±SE (n=4).

Promoter Activity of IL-6 Gene
To determine the promoter region responsible for the induction of IL-6 gene expression by Ang II, deletion analysis of the promoter region was performed. We constructed luciferase expression vectors with various lengths of the promoter region of the IL-6 gene (Figure 5A). Luciferase activity was measured after 24 hours of Ang II (10-6 mol/L) stimulation (Figure 5B). Ang II stimulated luciferase activity by {approx}2-fold in constructs of No. 1, No. 2, and No. 3. The response to Ang II was not observed in the construct that lacked the DNA segment between –581 and –150 bp (No. 4). In this DNA segment, several consensus cis DNA elements such as glucocorticoid response element, AP-1, and CRE are present. Among these elements, the AP-1 and the CRE (also known as a multiple response element) were reported to be important for basal and lipopolysaccharide-stimulated IL-6 gene expression.38 Because downregulation of PKC by prolonged exposure to PMA or a PKC inhibitor showed no effect on Ang II–induced enhancement of IL-6 gene expression, we assumed that the AP-1 site is not critical. Therefore, we introduced a mutation into the CRE site. The luciferase activity of luciferase expression plasmid driven by IL-6 gene promoter with mutation in the CRE site was not enhanced by Ang II stimulation (Figure 6). This suggests that the CRE site in the IL-6 gene promoter is essential for Ang II–induced upregulation. We also examined the effect of PD98059 on IL-6 promoter activity. Pretreatment with PD98059 strongly inhibited Ang II–induced upregulation.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 5. Deletion analysis of IL-6 gene promoter. A, As illustrated (top), there are various consensus cis DNA elements such as glucocorticoid-responsive element (GRE) (-559 to -554 bp and -444 to -439 bp), AP-1 (-237 to -232 bp), CRE (-156 to -149 bp), NF-IL6 (binding site for NF-IL6, -147 to -137 bp), NF-{kappa}B (binding site for NF-{kappa}B, -62 to -44 bp), and TATA box (-18 to -13 bp). Five deletion mutants of the IL-6 gene promoter were prepared by digestion with restriction endonucleases and fused to a luciferase gene (Luc). B, Five micrograms of each deletion mutant of promoter-luciferase fusion DNA construct was introduced into cultured VSMC by the DEAE dextran method. Twenty-four hours after transfection, the culture medium was changed to DMEM with 0.1% BSA, and VSMC were cultured without or with Ang II (10-6 mol/L) for an additional 24 hours. Cell lysates were extracted, and luciferase activities were measured. The luciferase activity was standardized by the ß-galactosidase activity expressed by cotransfected LacZ gene expression plasmid (2 µg). The normalized luciferase activity in unstimulated construct No. 1 was designated as 1.0, and relative luciferase activity is shown. Date are shown as mean±SE of 9 independent assays.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 6. Role of CRE site and MAPK in Ang II–induced IL-6 promoter activity. A, Five micrograms of wild-type promoter-luciferase fusion DNA (-1039) or mutant promoter-luciferase fusion DNA (-1039 with mutation in CRE site) was introduced to VSMC by the DEAE dextran method. B, Twenty-four hours after transfection, the culture medium was changed to DMEM with 0.1% BSA, and VSMC pretreated with or without PD98059 (10-5 mol/L) were stimulated with Ang II (10-6 mol/L) for 24 hours. Cell lysates were extracted, and luciferase activity was measured. Luciferase activity was standardized by the ß-galactosidase activity expressed by cotransfected LacZ gene expression plasmid (2 µg). Data are shown as mean±SE of 9 independent assays. The normalized luciferase activity in VSMC without Ang II stimulation was designated as 1.0. **P<0.05 versus Ang II (-).

Induction of CREB by Ang II
Next we examined the DNA binding protein bound to the CRE site using gel mobility shift assay (Figure 7). When nuclear extracts from Ang II–stimulated VSMC were used, DNA binding protein (arrow 2) was increased compared with unstimulated VSMC (lanes 1 to 3). Specificity of the binding was confirmed by adding 100 times molar excess of nonlabeled probe that eliminates this band (lane 4). When oligonucleotide with mutation in the CRE site was added as a competitor, this band did not fade (lane 5). When the antibody against CREB was added (lane 6), the band was supershifted (the shifted band is indicated by arrow 1). However, when an irrelevant antibody (antibody against Stat 3) was added (lane 7), the band was not supershifted. These results suggested that Ang II induces CREB bound to the CRE site of the IL-6 gene promoter.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 7. Gel mobility shift analysis of nuclear protein of VSMC. Nuclear protein from unstimulated (lane 1) or Ang II (lanes 2 to 7)–stimulated VSMC and 32P-labeled DNA (wild-type CRE) probe were mixed and incubated as described in Methods. Nuclear extracts from VSMC stimulated with Ang II for 15 minutes (lanes 2, 6, and 7) and for 30 minutes (lanes 3 to 5) were used. One hundred times molar excess of unlabeled CRE oligonucleotide (lane 4) and unlabeled mutant (mut) CRE oligonucleotide (lane 5) were added to the reaction mixture. Antibodies (Ab) for CREB (lane 6) or Stat 3 (lane 7) were added to the reaction mixture. Then the mixture was electrophoresed in an acrylamide gel. Arrow 2 indicates specific binding, because this band was eliminated by 100 times molar excess of unlabeled wild-type CRE oligonucleotide and supershifted by the addition of CREB antibody. The same results were obtained in other independent experiments (n=3); a representative autoradiography is shown.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
We showed the following: (1) Ang II stimulated the expression of IL-6 through the AT1R in VSMC; (2) the induction of IL-6 expression by Ang II was dependent on intracellular Ca2+, tyrosine phosphorylation, and MAPK kinase and independent of PKC or extracellular Ca2+; (3) CRE in the promoter region of the IL-6 gene plays an important role in Ang II–induced upregulation.

Previous studies suggested that a Ca2+-dependent signaling mechanism plays an important role in Ang II–induced activation of MAPK through the AT1R.37 Chelation of intracellular Ca2+ by BAPTA-AM suppressed Ang II–induced IL-6 mRNA expression. In contrast, chelation of extracellular Ca2+ by EGTA itself enhanced IL-6 mRNA expression and did not inhibit Ang II–induced upregulation. Several reports showed that various Ca2+ channel blockers increased the expression of IL-6 mRNA in human VSMC,39 human mesangial cells,40 and peripheral blood mononuclear cells.41 EGTA may exert an effect similar to that of the Ca2+ channel blocker. However, the mechanism by which EGTA and Ca2+ channel blocker stimulate IL-6 gene expression remains unclear. Pretreatment with PD98059 or genistein completely inhibited Ang II–induced IL-6 expression. Recently, Eguchi et al37 showed that Ang II–induced MAPK activation is dependent on Ca2+/calmodulin-sensitive tyrosine phosphorylation. Our results were consistent with their results and suggest that the downstream signal(s) of MAPK is important for IL-6 gene activation by Ang II.

There are several important regulatory cis DNA elements such as AP-1, CRE, nuclear factor–IL-6 (NF-IL6), and nuclear factor-{kappa}B (NF-{kappa}B) in the promoter region of the IL-6 gene. These promoter elements are conserved among species such as mouse,42 rat,30 and human43 and regulate IL-6 gene expression in a cell type–specific manner. AP-1, NF-{kappa}B, and NF-IL6 are required for IL-6 gene expression in monocytes.38 NF-{kappa}B is sufficient for expression in the T-cell line.44 However, regulatory elements important for expression in VSMC have not been investigated. Although the basal expression of IL-6 mRNA in quiescent VSMC is very weak, deletion analysis showed that the DNA segment between -150 and –27 bp is important for basal expression because luciferase activity was greatly reduced by deletion of this DNA segment (Figure 5; compare the luciferase activity of No. 5 construct with that of No. 4). In this DNA segment, NF-{kappa}B, NF-IL6, and GATA are present and probably are important for the basal expression of IL-6 gene in VSMC. In terms of the response to Ang II, the DNA segment between –581 and –150 bp is essential. Mutational analysis showed that the CRE site in this DNA segment is essential for the response to Ang II. However, transcription factors are known to activate gene transcription in a cooperative manner. Therefore, the cooperation of CREB with other transcription factors such as AP-1, NF-IL6, or NF-{kappa}B may play a role, and this possibility is not excluded in this study. Recently, Xing et al45 reported that MAPK-activated p90rsk2 phosphorylates and activates CREB. Because Ang II–induced activation of IL-6 gene transcription is inhibited by a MAPK kinase inhibitor, it is possible that Ang II activates the MAPK-p90rsk2-CREB pathway and upregulates IL-6 gene transcription.

It is known that protein kinase A, the calmodulin-dependent protein kinases,46 p90rsk2, and MAPK-activated protein kinase-247 phosphorylate CREB at serine-133, which is a key regulatory site controlling transcriptional activity in the response to a variety of extracellular signals, including growth factors and neurotropins. However, Chawla et al48 reported a dissociation between CREB phosphorylation on serine-133 and CRE-dependent transcription. Therefore, at this point it is not clear that increased binding of CREB by gel mobility shift assay correlates with activation of CRE-dependent transcription of IL-6 gene promoter.

We observed a biphasic increase of IL-6 mRNA by Ang II, as shown in Figure 2. Because Ang II induces production of many growth factors in VSMC, we assumed that the second peak was induced by Ang II–induced growth factors. To test this possibility, VSMC were incubated with cycloheximide (10-8 mol/L, 30 minutes), which is a protein synthesis inhibitor, and incubated with or without 10-6 mol/L of Ang II for 30 minutes or 24 hours. Cycloheximide increased basal mRNA expression at 30 minutes or 24 hours. The induction of IL-6 mRNA by cycloheximide has been reported.41 The response to Ang II in the presence of cycloheximide was preserved at both incubation periods, suggesting that the IL-6 mRNA expression by Ang II dose not require de novo protein synthesis (data not shown).

Previous studies have shown that IL-6 increases the number of platelets in the circulation17 and IL-6 activates platelets through arachidonic acid metabolism in vitro.49 Burstein50 reported that IL-6 increased plasma fibrinogen and decreased free protein S concentration. These IL-6–induced modifications of platelet and the coagulant phase of the clotting mechanism may lead to pathological thrombosis and instability of plaque. In an experimental model, Ikeda et al25 reported that IL-6 gene transcript was expressed in the atherosclerotic plaque of WHHL rabbit. However, the role of Ang II in the expression of IL-6 in WHHL rabbit was not defined. Recently, Nickenig et al51 reported that LDL increased AT1R mRNA in VSMC by increasing its stability and resulted in the elevation of functional response to Ang II. Thus, it is possible that AT1R in the WHHL rabbit plays a pivotal role in the induction of IL-6 transcript in atheromatous plaque.

Although it is not clear from this study that Ang II regulates IL-6 production in vivo, inhibition of Ang II–induced IL-6 production may be one of the mechanism by which an angiotensin-converting enzyme inhibitor or an AT1R antagonist prevents neointimal formation in the balloon injury model of atherosclerosis. Our data clearly showed the role of Ang II in IL-6 production in VSMC, suggesting that Ang II may mediate the inflammatory process in blood vessels.


*    Acknowledgments
 
This study was supported in part by grants from Kaibara Morikazu Science Promotion Foundation, Fukuoka, Japan; Kimura Memorial Heart Foundation Research Grant for 1996, Kurume, Japan; Uehara Memorial Foundation, Tokyo, Japan; and Japan Heart Foundation Grant for Research on Hypertension and Vascular Metabolism.

Received February 8, 1999; first decision March 9, 1999; accepted March 16, 1999.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature. 1993;362:801–809.[Medline] [Order article via Infotrieve]

2. Sasaki K, Yamano Y, Bardhan S, Iwai N, Murray JJ, Hasegawa M, Matsuda Y, Inagami T. Cloning and expression of a complementary DNA encoding a bovine adrenal angiotensin II type-1 receptor. Nature. 1991;351:230–233.[Medline] [Order article via Infotrieve]

3. Murphy TJ, Alexander RW, Griendling KK, Runge MS, Bernstein KE. Isolation of a cDNA encoding the vascular type-1 angiotensin II receptor. Nature. 1991;351:233–236.[Medline] [Order article via Infotrieve]

4. Mukoyama M, Nakajima M, Horiuchi M, Sasamura H, Pratt RE, Dzau VJ. Expression cloning of type 2 angiotensin II receptor reveals a unique class of seven-transmembrane receptors. J Biol Chem. 1993;268:24539–24542.[Abstract/Free Full Text]

5. Kambayashi Y, Bardhan S, Takahashi K, Tsuzuki S, Inui H, Hamakubo T, Inagami T. Molecular cloning of a novel angiotensin II receptor isoform involved in phosphotyrosine phosphatase inhibition. J Biol Chem. 1993;268:24543–24546.[Abstract/Free Full Text]

6. Rakugi H, Jacob HJ, Krieger JE, Ingelfinger JR, Pratt RE. Vascular injury induces angiotensinogen gene expression in the media and neointima. Circulation. 1993;87:283–290.[Abstract/Free Full Text]

7. deBlois D, Viswanathan M, Su JE, Clowes AW, Saavedra JM, Schwartz SM. Smooth muscle DNA replication in response to angiotensin II is regulated differently in the neointima and media at different times after balloon injury in the rat carotid artery: role of AT1 receptor expression. Arterioscler Thromb Vasc Biol. 1996;16:1130–1137.[Abstract/Free Full Text]

8. Powell JS, Clozel JP, Muller RK, Kuhn H, Hefti F, Hosang M, Baumgartner HR. Inhibitors of angiotensin-converting enzyme prevent myointimal proliferation after vascular injury. Science. 1989;245:186–188.[Abstract/Free Full Text]

9. Kauffman RF, Bean JS, Zimmerman KM, Brown RF, Steinberg MI. Losartan, a nonpeptide angiotensin II (Ang II) receptor antagonist, inhibits neointima formation following balloon injury to rat carotid arteries. Life Sci. 1991;49:PL223–PL228.[Medline] [Order article via Infotrieve]

10. Prescott MF, Webb RL, Reidy MA. Angiotensin-converting enzyme inhibitor versus angiotensin II, AT1 receptor antagonist: effects on smooth muscle cell migration and proliferation after balloon catheter injury. Am J Pathol. 1991;139:1291–1296.[Abstract]

11. Huckle WR, Prokop CA, Dy RC, Herman B, Earp S. Angiotensin II stimulates protein-tyrosine phosphorylation in a calcium-dependent manner. Mol Cell Biol. 1990;10:6290–6298.[Abstract/Free Full Text]

12. Molloy CJ, Taylor DS, Weber H. Angiotensin II stimulation of rapid protein tyrosine phosphorylation and protein kinase activation in rat aortic smooth muscle cells. J Biol Chem. 1993;268:7338–7345.[Abstract/Free Full Text]

13. Duff JL, Berk BC, Corson MA. Angiotensin II stimulates the pp44 and pp42 mitogen-activated protein kinases in cultured rat aortic smooth muscle cells. Biochem Biophys Res Commun. 1992;188:257–264.[Medline] [Order article via Infotrieve]

14. Tsuda T, Kawahara Y, Ishida Y, Koide M, Shii K, Yokoyama M. Angiotensin II stimulates two myelin basic protein/microtubule-associated protein 2 kinases in cultured vascular smooth muscle cells. Circ Res. 1992;71:620–630.[Abstract/Free Full Text]

15. Taubman MB, Rollins BJ, Poon M, Marmur J, Green RS, Berk BC, Nadal-Ginard B. JE mRNA accumulates rapidly in aortic injury and in platelet-derived growth factor–stimulated vascular smooth muscle cells. Circ Res. 1992;70:314–325.[Abstract/Free Full Text]

16. Le J, Vilcek L. Interleukin 6: a multifunctional cytokine regulating immune reactions and the acute phase protein response. Lab Invest. 1998;61:588–602.[Medline] [Order article via Infotrieve]

17. Williams N, Bertoncello I, Jackson H, Arnold J, Kavnoudias H. The role of interleukin 6 in megakaryocyte formation, megakaryocyte development and platelet production. Ciba Found Symp.. 1992;167:160–170; discussion 170–173.[Medline] [Order article via Infotrieve]

18. Ikeda U, Ikeda M, Oohara T, Oguchi A, Kamitani T, Tsuruya Y, Kano S. Interleukin 6 stimulates growth of vascular smooth muscle cells in a PDGF-dependent manner. Am J Physiol. 1991;260:H1713–H1717.[Abstract/Free Full Text]

19. Onozaki K, Akiyama Y, Okano A, Hirano T, Kishimoto T, Hashimoto T, Yoshizawa K, Taniyama T. Synergistic regulatory effects of interleukin 6 and interleukin 1 on the growth and differentiation of human and mouse myeloid leukemic cell lines. Cancer Res. 1989;49:3602–3607.[Abstract/Free Full Text]

20. Loppnow H, Libby P. Adult human vascular endothelial cells express the IL6 gene differentially in response to LPS or IL1. Cell Immunol. 1989;122:493–503.[Medline] [Order article via Infotrieve]

21. Loppnow H, Libby P. Proliferating or interleukin 1-activated human vascular smooth muscle cells secrete copious interleukin 6. J Clin Invest. 1990;85:731–738.

22. Moriyama T, Fujibayashi M, Fujiwara Y, Kaneko T, Xia C, Imai E, Kamada T, Ando A, Ueda N. Angiotensin II stimulates interleukin-6 release from cultured mouse mesangial cells. J Am Soc Nephrol. 1995;6:95–101.[Abstract]

23. Loppnow H, Libby P. Functional significance of human vascular smooth muscle cell-derived interleukin 1 in paracrine and autocrine regulation pathways. Exp Cell Res. 1992;198:283–290.[Medline] [Order article via Infotrieve]

24. Roth M, Nauck M, Tamm M, Perruchoud AP, Ziesche R, Block LH. Intracellular interleukin 6 mediates platelet-derived growth factor-induced proliferation of nontransformed cells. Proc Natl Acad Sci U S A. 1995;92:1312–1316.[Abstract/Free Full Text]

25. Ikeda U, Ikeda M, Seino Y, Takahashi M, Kano S, Shimada K. Interleukin 6 gene transcripts are expressed in atherosclerotic lesions of genetically hyperlipidemic rabbits. Atherosclerosis. 1992;92:213–218.[Medline] [Order article via Infotrieve]

26. Biasucci LM, Vitelli A, Liuzzo G, Altamura S, Caligiuri G, Monaco C, Rebuzzi AG, Ciliberto G, Maseri A. Elevated levels of interleukin-6 in unstable angina. Circulation. 1996;94:874–877.[Abstract/Free Full Text]

27. Inui H, Kitami Y, Tani M, Kondo T, Inagami T. Differences in signal transduction between platelet-derived growth factor (PDGF) alpha and beta receptors in vascular smooth muscle cells: PDGF-BB is a potent mitogen, but PDGF-AA promotes only protein synthesis without activation of DNA synthesis [published correction appears in J Biol Chem. 1995;270:10358]. J Biol Chem. 1994;269:30546–30552.

28. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–159.[Medline] [Order article via Infotrieve]

29. Ichiki T, Usui M, Kato M, Funakoshi Y, Ito K, Egashira K, Takeshita A. Downregulation of angiotensin II type 1 receptor gene transcription by nitric oxide. Hypertension. 1998;31:342–348.[Abstract/Free Full Text]

30. Northemann W, Braciak TA, Hattori M, Lee F, Fey GH. Structure of the rat interleukin 6 gene and its expression in macrophage-derived cells. J Biol Chem. 1989;264:16072–16082.[Abstract/Free Full Text]

31. Higuchi R, Krummel B, Saiki RK. A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucl Acid Res. 1988;16:7351–7367.[Abstract/Free Full Text]

32. Sambrook J, Fritisch E, Maniatis T. Molecular Cloning. New York, NY: Cold Spring Harbor Laboratory Press; 1989:66–67.

33. Dignam JD, Lebovitz RM, Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucl Acid Res. 1983;11:1475–1489.[Abstract/Free Full Text]

34. Osborn L, Kunkel S, Nabel G. Tumor necrosis factor alpha and interleukin 1 stimulate the human immunodeficiency virus enhancer by activation of the nuclear factor kappa B. Proc Natl Acad Sci U S A. 1989;86:2336–2340.[Abstract/Free Full Text]

35. Nishizuka Y. The molecular heterogeneity of protein kinase C and its implications for cellular regulation. Nature. 1988;334:661–665.[Medline] [Order article via Infotrieve]

36. Berridge MJ. Inositol trisphosphate and diacylglycerol: two interacting second messengers. Ann Rev Biochem. 1987;56:159–193.[Medline] [Order article via Infotrieve]

37. Eguchi S, Matsumoto T, Motley ED, Utsunomiya H, Inagami T. Identification of an essential signaling cascade for mitogen-activated protein kinase activation by angiotensin II in cultured rat vascular smooth muscle cells: possible requirement of Gq-mediated p21ras activation coupled to a Ca2+/calmodulin-sensitive tyrosine kinase. J Biol Chem. 1996;271:14169–14175.[Abstract/Free Full Text]

38. Dendorfer U, Oettgen P, Libermann TA. Multiple regulatory elements in the interleukin-6 gene mediate induction by prostaglandins, cyclic AMP, and lipopolysaccharide. Mol Cell Biol. 1994;14:4443–4454.[Abstract/Free Full Text]

39. Rodler S, Roth M, Nauck M, Tamm M, Block LH. Ca(2+)-channel blockers modulate the expression of interleukin-6 and interleukin-8 genes in human vascular smooth muscle cells. J Mol Cell Cardiol. 1995;27:2295–2302.[Medline] [Order article via Infotrieve]

40. Roth M, Keul R, Emmons LR, Horl WH, Block LH. Manidipine regulates the transcription of cytokine genes. Proc Natl Acad Sci U S A. 1992;89:4071–4075.[Abstract/Free Full Text]

41. Walz G, Zanker B, Barth C, Wieder KJ, Clark SC, Strom TB. Transcriptional modulation of human IL-6 gene expression by verapamil. J Immunol. 1990;144:4242–4248.[Abstract]

42. Isshiki H, Akira S, Tanabe O, Nakajima T, Shimamoto T, Hirano T, Kishimoto T. Constitutive and interleukin-1 (IL-1)-inducible factors interact with the IL-1-responsive element in the IL-6 gene. Mol Cell Biol. 1990;10:2757–2764.[Abstract/Free Full Text]

43. Sanceau J, Kaisho T, Hirano T, Wietzerbin J. Triggering of the human interleukin-6 gene by interferone-G and tumor necrosis factor-a in monocytic cells involves cooperation between interferone regulatory factor-1, NF-kB, and Sp1 transcription factors. J Biol Chem. 1995;270:27920–27931.[Abstract/Free Full Text]

44. Mori N, Shirakawa F, Shimizu H, Murakami S, Oda S, Yamamoto K, Eto S. Transcriptional regulation of the human interleukin-6 gene promoter in human T-cell leukemia virus type I-infected T-cell lines: evidence for the involvement of NF-kappa B. Blood. 1994;84:2904–2911.[Abstract/Free Full Text]

45. Xing J, Ginty DD, Greenberg ME. Coupling of the RAS-MAPK pathway to gene activation by RSK2, a growth factor-regulated CREB kinase. Science. 1996;273:959–963.[Abstract]

46. Sheng M, Thompson MA, Greenberg ME. CREB: a Ca(2+)-regulated transcription factor phosphorylated by calmodulin-dependent kinases. Science. 1991;252:1427–1430.[Abstract/Free Full Text]

47. Tan Y, Rouse J, Zhang A, Cariati S, Cohen P, Comb MJ. FGF and stress regulate CREB and ATF-1 via a pathway involving p38 MAP kinase and MAPKAP kinase-2. EMBO J. 1996;15:4629–4642.[Medline] [Order article via Infotrieve]

48. Chawla S, Hardingham GE, Quinn DR, Bading H. CBP: a signal-regulated transcriptional coactivator controlled by nuclear calcium and CaM kinase IV. Science. 1998;281:1505–1509.[Abstract/Free Full Text]

49. Oleksowicz L, Mrowiec Z, Zuckerman D, Isaacs R, Dutcher J, Puszkin E. Platelet activation induced by interleukin-6: evidence for a mechanism involving arachidonic acid metabolism. Thromb Haemost. 1994;72:302–308.[Medline] [Order article via Infotrieve]

50. Burstein SA. Effects of interleukin 6 on megakaryocytes and on canine platelet function. Stem Cells. 1994;12:386–393.[Abstract]

51. Nickenig G, Sachinidis A, Michaelsen F, Bohm M, Seewald S, Vetter H. Upregulation of vascular angiotensin II receptor gene expression by low-density lipoprotein in vascular smooth muscle cells. Circulation. 1997;95:473–478.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. R. Chava, M. Karpurapu, D. Wang, M. Bhanoori, V. Kundumani-Sridharan, Q. Zhang, T. Ichiki, W. C. Glasgow, and G. N. Rao
CREB-Mediated IL-6 Expression Is Required for 15(S)-Hydroxyeicosatetraenoic Acid-Induced Vascular Smooth Muscle Cell Migration
Arterioscler. Thromb. Vasc. Biol., June 1, 2009; 29(6): 809 - 815.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
Q. Tian, R. Miyazaki, T. Ichiki, I. Imayama, K. Inanaga, H. Ohtsubo, K. Yano, K. Takeda, and K. Sunagawa
Inhibition of Tumor Necrosis Factor-{alpha}-Induced Interleukin-6 Expression by Telmisartan Through Cross-Talk of Peroxisome Proliferator-Activated Receptor-{gamma} With Nuclear Factor {kappa}B and CCAAT/Enhancer-Binding Protein-{beta}
Hypertension, May 1, 2009; 53(5): 798 - 804.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
S. Sriramula, M. Haque, D. S.A. Majid, and J. Francis
Involvement of Tumor Necrosis Factor-{alpha} in Angiotensin II-Mediated Effects on Salt Appetite, Hypertension, and Cardiac Hypertrophy
Hypertension, May 1, 2008; 51(5): 1345 - 1351.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
L. I. Schrader, D. A. Kinzenbaw, A. W. Johnson, F. M. Faraci, and S. P. Didion
IL-6 Deficiency Protects Against Angiotensin II Induced Endothelial Dysfunction and Hypertrophy
Arterioscler. Thromb. Vasc. Biol., December 1, 2007; 27(12): 2576 - 2581.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S. Sahar, M. A. Reddy, C. Wong, L. Meng, M. Wang, and R. Natarajan
Cooperation of SRC-1 and p300 With NF-{kappa}B and CREB in Angiotensin II-Induced IL-6 Expression in Vascular Smooth Muscle Cells
Arterioscler. Thromb. Vasc. Biol., July 1, 2007; 27(7): 1528 - 1534.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
P. E. Marik and J. Varon
Hypertensive Crises: Challenges and Management
Chest, June 1, 2007; 131(6): 1949 - 1962.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
G. Gadonski, B. B. D. LaMarca, E. Sullivan, W. Bennett, D. Chandler, and J. P. Granger
Hypertension Produced by Reductions in Uterine Perfusion in the Pregnant Rat: Role of Interleukin 6
Hypertension, October 1, 2006; 48(4): 711 - 716.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. Fukuyama, T. Ichiki, I. Imayama, H. Ohtsubo, H. Ono, Y. Hashiguchi, A. Takeshita, and K. Sunagawa
Thyroid Hormone Inhibits Vascular Remodeling Through Suppression of cAMP Response Element Binding Protein Activity
Arterioscler. Thromb. Vasc. Biol., September 1, 2006; 26(9): 2049 - 2055.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Douillette, A. Bibeau-Poirier, S.-P. Gravel, J.-F. Clement, V. Chenard, P. Moreau, and M. J. Servant
The Proinflammatory Actions of Angiotensin II Are Dependent on p65 Phosphorylation by the I{kappa}B Kinase Complex
J. Biol. Chem., May 12, 2006; 281(19): 13275 - 13284.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
N. Juretic, P. Garcia-Huidobro, J. A. Iturrieta, E. Jaimovich, and N. Riveros
Depolarization-induced slow Ca2+ transients stimulate transcription of IL-6 gene in skeletal muscle cells
Am J Physiol Cell Physiol, May 1, 2006; 290(5): C1428 - C1436.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. P. Granger
An emerging role for inflammatory cytokines in hypertension
Am J Physiol Heart Circ Physiol, March 1, 2006; 290(3): H923 - H924.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. Ichiki
Role of cAMP Response Element Binding Protein in Cardiovascular Remodeling: Good, Bad, or Both?
Arterioscler. Thromb. Vasc. Biol., March 1, 2006; 26(3): 449 - 455.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
D. L. Lee, L. C. Sturgis, H. Labazi, J. B. Osborne Jr., C. Fleming, J. S. Pollock, M. Manhiani, J. D. Imig, and M. W. Brands
Angiotensin II hypertension is attenuated in interleukin-6 knockout mice
Am J Physiol Heart Circ Physiol, March 1, 2006; 290(3): H935 - H940.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
Y. Obara, H. Kurose, and N. Nakahata
Thromboxane A2 Promotes Interleukin-6 Biosynthesis Mediated by an Activation of Cyclic AMP-Response Element-Binding Protein in 1321N1 Human Astrocytoma Cells
Mol. Pharmacol., September 1, 2005; 68(3): 670 - 679.
[Abstract] [Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
N. Nesher, G. Uretzky, S. Insler, P. Nataf, I. Frolkis, E. Pineau, E. Cantoni, G. Bolotin, M. Vardi, D. Pevni, et al.
Thermo-wrap technology preserves normothermia better than routine thermal care in patients undergoing off-pump coronary artery bypass and is associated with lower immune response and lesser myocardial damage
J. Thorac. Cardiovasc. Surg., June 1, 2005; 129(6): 1371 - 1378.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
P.-C. Lee, I-C. Ho, and T.-C. Lee
Oxidative Stress Mediates Sodium Arsenite-Induced Expression of Heme Oxygenase-1, Monocyte Chemoattractant Protein-1, and Interleukin-6 in Vascular Smooth Muscle Cells
Toxicol. Sci., May 1, 2005; 85(1): 541 - 550.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
B. J. H. van den Born, U. P.F. Honnebier, R. P. Koopmans, and G. A. van Montfrans
Microangiopathic Hemolysis and Renal Failure in Malignant Hypertension
Hypertension, February 1, 2005; 45(2): 246 - 251.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
H. Ono, T. Ichiki, K. Fukuyama, N. Iino, S. Masuda, K. Egashira, and A. Takeshita
cAMP-Response Element-Binding Protein Mediates Tumor Necrosis Factor-{alpha}-Induced Vascular Smooth Muscle Cell Migration
Arterioscler. Thromb. Vasc. Biol., September 1, 2004; 24(9): 1634 - 1639.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
D. L. Lee, R. Leite, C. Fleming, J. S. Pollock, R. C. Webb, and M. W. Brands
Hypertensive Response to Acute Stress Is Attenuated in Interleukin-6 Knockout Mice
Hypertension, September 1, 2004; 44(3): 259 - 263.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Wassmann, M. Stumpf, K. Strehlow, A. Schmid, B. Schieffer, M. Bohm, and G. Nickenig
Interleukin-6 Induces Oxidative Stress and Endothelial Dysfunction by Overexpression of the Angiotensin II Type 1 Receptor
Circ. Res., March 5, 2004; 94(4): 534 - 541.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
T. Tokunou, R. Shibata, H. Kai, T. Ichiki, T. Morisaki, K. Fukuyama, H. Ono, N. Iino, S. Masuda, H. Shimokawa, et al.
Apoptosis Induced by Inhibition of Cyclic AMP Response Element-Binding Protein in Vascular Smooth Muscle Cells
Circulation, September 9, 2003; 108(10): 1246 - 1252.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
T. Ichiki, T. Tokunou, K. Fukuyama, N. Iino, S. Masuda, and A. Takeshita
Cyclic AMP Response Element-Binding Protein Mediates Reactive Oxygen Species-Induced c-fos Expression
Hypertension, August 1, 2003; 42(2): 177 - 183.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
G. G. Deng, B. Martin-McNulty, D. A. Sukovich, A. Freay, M. Halks-Miller, T. Thinnes, D. J. Loskutoff, P. Carmeliet, W. P. Dole, and Y.-X. Wang
Urokinase-Type Plasminogen Activator Plays a Critical Role in Angiotensin II-Induced Abdominal Aortic Aneurysm
Circ. Res., March 21, 2003; 92(5): 510 - 517.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
K. Fukuyama, T. Ichiki, K. Takeda, T. Tokunou, N. Iino, S. Masuda, M. Ishibashi, K. Egashira, H. Shimokawa, K. Hirano, et al.
Downregulation of Vascular Angiotensin II Type 1 Receptor by Thyroid Hormone
Hypertension, March 1, 2003; 41(3): 598 - 603.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
G. Castoldi, C. R. T. di Gioia, F. Pieruzzi, C. D'Orlando, W. M. M. van de Greef, G. Busca, G. Sperti, and A. Stella
ANG II increases TIMP-1 expression in rat aortic smooth muscle cells in vivo
Am J Physiol Heart Circ Physiol, February 1, 2003; 284(2): H635 - H643.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Y. Takata, Y. Kitami, Z.-H. Yang, M. Nakamura, T. Okura, and K. Hiwada
Vascular Inflammation Is Negatively Autoregulated by Interaction Between CCAAT/Enhancer-Binding Protein-{delta} and Peroxisome Proliferator-Activated Receptor-{gamma}
Circ. Res., September 6, 2002; 91(5): 427 - 433.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
S. Sakurai, S. Alam, G. Pagan-Mercado, F. Hickman, J.-Y. Tsai, P. Zelenka, and S. Sato
Retinal Capillary Pericyte Proliferation and c-Fos mRNA Induction by Prostaglandin D2 through the cAMP Response Element
Invest. Ophthalmol. Vis. Sci., August 1, 2002; 43(8): 2774 - 2781.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Funakoshi, T. Ichiki, K. Takeda, T. Tokuno, N. Iino, and A. Takeshita
Critical Role of cAMP-response Element-binding Protein for Angiotensin II-induced Hypertrophy of Vascular Smooth Muscle Cells
J. Biol. Chem., May 17, 2002; 277(21): 18710 - 18717.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. Ichiki, K. Takeda, T. Tokunou, N. Iino, K. Egashira, H. Shimokawa, K. Hirano, H. Kanaide, and A. Takeshita
Downregulation of Angiotensin II Type 1 Receptor by Hydrophobic 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase Inhibitors in Vascular Smooth Muscle Cells
Arterioscler. Thromb. Vasc. Biol., December 1, 2001; 21(12): 1896 - 1901.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. Tokunou, T. Ichiki, K. Takeda, Y. Funakoshi, N. Iino, H. Shimokawa, K. Egashira, and A. Takeshita
Thrombin Induces Interleukin-6 Expression Through the cAMP Response Element in Vascular Smooth Muscle Cells
Arterioscler. Thromb. Vasc. Biol., November 1, 2001; 21(11): 1759 - 1763.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Y.-X. Wang, B. Martin-McNulty, A. D. Freay, D. A. Sukovich, M. Halks-Miller, W.-W. Li, R. Vergona, M. E. Sullivan, J. Morser, W. P. Dole, et al.
Angiotensin II Increases Urokinase-Type Plasminogen Activator Expression and Induces Aneurysm in the Abdominal Aorta of Apolipoprotein E-Deficient Mice
Am. J. Pathol., October 1, 2001; 159(4): 1455 - 1464.
[Abstract] [Full Text]


Home page
HypertensionHome page
Y. Funakoshi, T. Ichiki, H. Shimokawa, K. Egashira, K. Takeda, K. Kaibuchi, M. Takeya, T. Yoshimura, and A. Takeshita
Rho-Kinase Mediates Angiotensin II-Induced Monocyte Chemoattractant Protein-1 Expression in Rat Vascular Smooth Muscle Cells
Hypertension, July 1, 2001; 38(1): 100 - 104.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. Takeda, T. Ichiki, T. Tokunou, N. Iino, S. Fujii, A. Kitabatake, H. Shimokawa, and A. Takeshita
Critical Role of Rho-Kinase and MEK/ERK Pathways for Angiotensin II-Induced Plasminogen Activator Inhibitor Type-1 Gene Expression
Arterioscler. Thromb. Vasc. Biol., May 1, 2001; 21(5): 868 - 873.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
K. L. Abbott, J. R. Loss II, A. M. Robida, and T. J. Murphy
Evidence That Galpha q-Coupled Receptor-Induced Interleukin-6 mRNA in Vascular Smooth Muscle Cells Involves the Nuclear Factor of Activated T Cells
Mol. Pharmacol., November 1, 2000; 58(5): 946 - 953.
[Abstract] [Full Text]


Home page
HypertensionHome page
E. Mervaala, D. N. Muller, J.-K. Park, R. Dechend, F. Schmidt, A. Fiebeler, M. Bieringer, V. Breu, D. Ganten, H. Haller, et al.
Cyclosporin A Protects Against Angiotensin II-Induced End-Organ Damage in Double Transgenic Rats Harboring Human Renin and Angiotensinogen Genes
Hypertension, January 1, 2000; 35(1): 360 - 366.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Sano, K. Fukuda, H. Kodama, J. Pan, M. Saito, J. Matsuzaki, T. Takahashi, S. Makino, T. Kato, and S. Ogawa
Interleukin-6 Family of Cytokines Mediate Angiotensin II-induced Cardiac Hypertrophy in Rodent Cardiomyocytes
J. Biol. Chem., September 15, 2000; 275(38): 29717 - 29723.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Takeda, T. Ichiki, T. Tokunou, N. Iino, and A. Takeshita
15-Deoxy-Delta 12,14-prostaglandin J2 and Thiazolidinediones Activate the MEK/ERK Pathway through Phosphatidylinositol 3-Kinase in Vascular Smooth Muscle Cells
J. Biol. Chem., December 21, 2001; 276(52): 48950 - 48955.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. Sano, K. Fukuda, T. Sato, H. Kawaguchi, M. Suematsu, S. Matsuda, S. Koyasu, H. Matsui, K. Yamauchi-Takihara, M. Harada, et al.
ERK and p38 MAPK, but not NF-{kappa}B, Are Critically Involved in Reactive Oxygen Species-Mediated Induction of IL-6 by Angiotensin II in Cardiac Fibroblasts
Circ. Res., October 12, 2001; 89(8): 661 - 669.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Funakoshi, Y.
Right arrow Articles by Takeshita, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Funakoshi, Y.
Right arrow Articles by Takeshita, A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Related Collections
Right arrow ACE/Angiotension receptors
Right arrow Gene expression
Right arrow Mechanism of atherosclerosis/growth factors