(Hypertension. 1999;34:118-125.)
© 1999 American Heart Association, Inc.
Scientific Contributions |
Induction of Interleukin-6 Expression by Angiotensin II in Rat Vascular Smooth Muscle Cells
From the Research Institute of Angiocardiology and Cardiovascular Clinic, Kyushu University School of Medicine, Fukuoka, Japan.
Correspondence to Toshihiro Ichiki, MD, Research Institute of Angiocardiology and Cardiovascular Clinic, Kyushu University School of Medicine, 3-1-1 Maidashi, Higashi-ku, 812-8582 Fukuoka, Japan. E-mail ichiki{at}cardiol.med.kyushu-u.ac.jp
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract—Recent studies suggest that atherosclerosis is a kind of inflammatory process and that cytokine plays important roles in this process. Although it is generally accepted that angiotensin II (Ang II) plays an important role in atherogenesis, the role of Ang II in cytokine production has not been explored. In this report, we investigated the effect of Ang II on the production of interleukin-6 (IL-6), which is a multifunctional proinflammatory cytokine in rat vascular smooth muscle cells. Ang II significantly increased the expression of IL-6 mRNA and protein in a dose-dependent manner (10-10 to 10-6 mol/L). The expression of IL-6 mRNA induced by Ang II showed 2 peaks at 30 minutes and 12 to 24 hours after stimulation. The effect of Ang II on IL-6 release and mRNA expression was completely blocked by an Ang II type 1 receptor antagonist, CV11974; however, an Ang II type 2 receptor antagonist, PD123319, showed no effect. Chelating of intracellular Ca2+ with BAPTA-AM, inhibition of tyrosine kinase with genistein, and inhibition of mitogen-activated protein kinase kinase with PD98059 completely abolished the effect of Ang II. However, downregulation of protein kinase C by pretreatment with a phorbol ester for 24 hours or a specific protein kinase C inhibitor, calphostin C, did not affect the Ang II–induced expression of IL-6 mRNA. Deletion and mutational analysis of IL-6 gene promoter showed that cAMP-responsive element was important for Ang II–induced IL-6 gene expression. Gel mobility shift assay showed an increase of cAMP-responsive element binding protein by Ang II. These results provide new insights into Ang II signaling and the role of Ang II in the progression of inflammatory changes of blood vessels.
Key Words: angiotensin II • interleukins • protein kinases • cAMP-responsive element
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Atherosclerotic lesions contain elements of inflammatory reaction with fibroproliferative changes. An early atherosclerotic lesion consists largely of macrophages and T lymphocytes. With the advancement of the lesion, smooth muscle cells migrate, proliferate, and produce extracellular matrix components, presumably as part of a repair process of metabolic or physical injury and subsequent inflammation of blood vessels.1 The repair process after injury is associated with the induction of immediate early genes such as c-fos and c-jun, followed by the production of various kinds of growth factors and cytokines.
Angiotensin II (Ang II) is a multifunctional octapeptide that increases contraction of blood vessels and induces hypertrophy and hyperplasia of vascular smooth muscle cells (VSMC). There are 2 isoforms for Ang II receptor, which are designated as type 1 receptor (AT1R)2 3 and type 2 receptor (AT2R).4 5 Most of the cardiovascular effects of Ang II are ascribed to the AT1R. Ang II stimulates production of growth factors such as platelet-derived growth factor (PDGF) and transforming growth factor-ß (TGF-ß) and matrix components such as collagen and fibronectin through the AT1R in VSMC. Several lines of evidence have suggested the important roles of Ang II in vascular cell growth and tissue remodeling following hypertension, vascular injury, and atherosclerosis.6 7 8 9 10
Recent findings showed that the AT1R couples to many intracellular signal transduction pathways. In common with many other growth factors, Ang II causes a rapid induction of the growth-associated immediate early gene expression. Stimulation of AT1R by Ang II elicits tyrosine phosphorylation and activates the mitogen-activated protein kinase (MAPK) pathway.11 12 13 14 15 Understanding of the mechanism of these Ang II–stimulated signaling pathways is important because these signals eventually activate gene transcription of immediate early genes, growth factors, and extracellular matrix, resulting in hypertrophy or hyperplasia of VSMC.
Interleukin-6 (IL-6) has multiple biological activities, such as induction of B-cell differentiation, T-cell activation, induction of acute-phase protein such as C-reactive protein (CRP) and fibrinogen in the liver, and production of platelets.16 17 Ikeda et al18 showed that IL-6 increased the proliferation of VSMC in a PDGF-dependent manner. IL-6 is secreted from macrophages, T cells, endothelial cells, mesangial cells, and VSMC.18 19 20 21 22 In terms of VSMC, IL-6 is secreted by stimulation of interleukin-123 and PDGF.24 IL-6 mRNA was expressed in the atherosclerotic lesion of Watanabe heritable hyperlipidemic (WHHL) rabbits.25 The plasma level of IL-6 is elevated in patients with unstable angina.26 Although these studies suggest an important role of IL-6 in atherosclerosis, the mechanism and the source of IL-6 production are not understood. In addition, the effect of Ang II on IL-6 production has not been elucidated.
In this report we demonstrated that Ang II induced IL-6 expression in cultured rat VSMC through the AT1R. Deletion and mutational analysis of the promoter region of the IL-6 gene showed that cAMP-responsive element (CRE) plays an important role in Ang II–induced upregulation of IL-6 gene expression.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Reagents
DMEM and fetal bovine serum were purchased from GIBCO BRL. Ang II was purchased from Peptide Institute. PD98059, a MAPK kinase inhibitor, was obtained from Research Biochemicals International. Unless indicated otherwise, other chemical reagents were purchased from Wako Chemicals. [
-32P] dCTP was obtained from Dupont NEN.
Bovine serum albumin was purchased from Sigma. CV11974, a
specific AT1R antagonist, was
obtained from Takeda Chemical Industries, Ltd, and PD123319, a specific
AT2R antagonist, was obtained from
Warner-Lambert, Park Davis Co. Antibody against CRE binding protein
(CREB) was obtained from New England Biolabs Inc. Antibody against Stat
3 binding protein was obtained from Santa Cruz Inc.
Cell Culture
VSMC were isolated from the thoracic aorta of Sprague-Dawley
rats as described previously27 and maintained in DMEM
supplemented with 10% fetal bovine serum at 37°C in a humidified
atmosphere of 95% air/5% CO2. Passages between
5 and 15 were used for the experiments. Cells were seeded in 6-cm
tissue culture dishes or 24 well plates and cultured in DMEM with 10%
fetal bovine serum for 4 days. Then the medium was changed to DMEM
supplemented with 0.1% BSA. The cells were cultured for an additional
2 days and stimulated with Ang II for the indicated period.
Northern Blot Analysis
Total RNA was prepared by an acid
guanidinium-phenol-chloroform extraction method.28
Northern blot analysis was performed as described previously
except that 20 µg of total RNA was analyzed.29
The hybridized membrane was stripped by boiling in 0.5% SDS solution
and hybridized to a 32P-labeled 18S ribosomal RNA
probe to obtain a reference for the amount of applied RNA. The
radioactivity of hybridized bands of IL-6 or 18S ribosomal RNA was
quantified by a MacBAS bioimaging analyzer (FUJIFILM).
Deletion Mutants of Rat IL-6 Gene Promoter Region and Construction
of Luciferase Fusion DNA Construct
A genomic DNA clone encoding the rat IL-6 promoter
region30 was obtained by the polymerase chain reaction
technique with 5' primer (5' GTGGACAGAAAACCAGGGAC 3') and 3' primer (5'
CTGTTCCTGAAGGGCAGATG 3'). The product of polymerase chain reaction,
the IL-6 promoter region, was sequenced by the dideoxy chain
termination method (Thermo Sequenase cycle sequencing kit, Amersham)
after cloning into pBluescript (Stratagene). The promoter region of
IL-6 gene was digested with restriction endonucleases. The 5'-end of
the digested DNA fragments was blunted by Klenow enzyme or T4 DNA
polymerase, and the 3'-end was digested with XhoI, which is
located in the first exon of the rat IL-6 gene. Five deletion mutants
(from No. 1 to No. 5) were cloned into the
SmaI-XhoI site of pGL3 basic vector (Promega
Corporation). Site-directed mutagenesis was performed according to the
method of Higuchi et al.31 In the deletion mutant No.
1, the wild-type sequence of CRE, ATGACGTCA, was altered to
ATCGATCCA. Nucleotide sequences of the mutation
were confirmed by DNA sequencing.
Transfection of IL-6 Promoter-Luciferase Fusion DNA Construct
to VSMC
Confluent VSMC were split by trypsin/EDTA solution, and
5x105 cells were prepared in a 6-cm tissue
culture dish. After 48 hours, 5 µg of IL-6 promoter-luciferase fusion
DNA and 2 µg of ß-galactosidase gene driven by an SV40
promoter-enhancer sequence were introduced to VSMC by the DEAE dextran
method according to the manufacture's instructions (Promega
Corporation). After transfection, the cells were cultured in DMEM with
10% FCS for 24 hours, washed twice with phosphate-buffered saline, and
stimulated with 10-6 mol/L of Ang II for 24
hours in DMEM with 0.1% BSA. The luciferase activity was measured as
described previously.29 The ß-galactosidase activity in
the same sample was measured spectrophotometrically according to
Sambrook et al32 and used to normalize the luciferase
activity.
Quantification of Rat IL-6 by Sandwich ELISA
The medium of unstimulated or Ang II–stimulated VSMC was
collected and centrifuged at 12 000 rpm for 1 minute. The
supernatant was stored at -70°C until assay. ELISA for rat IL-6 was
performed with a Cytoscreen ELISA kit (BioSourse International)
according to the manufacture's instructions. Briefly, serial dilution
of recombinant rat IL-6 and test samples were applied to a microtiter
plate coated with an anti-rat IL-6 monoclonal antibody, and the
incubation was done at 37°C for 3 hours. The solution was discarded,
and wells were washed 4 times. Then biotinylated anti-rat IL-6 antibody
solution was added. After the incubation at room temperature for 30
minutes and washing 4 times, streptavidin–horseradish peroxidase was
added. After the incubation at room temperature for 30 minutes and
washing 4 times, a stabilized chromogen, tetramethylbenzidine, was
added. The plate was incubated at room temperature for 30 minutes in
the dark, and the color was read spectrophotometrically at 450 nm.
Preparation of Nuclear Extracts and Gel Mobility Shift
Assay
Nuclear extracts were prepared according to the methods
described by Dignam et al33 and Osborn et
al.34 Gel mobility shift assay was performed as described
previously.29 DNA probe (wild-type CRE:
5'-GCTAAATGACGTCACATT-3') was labeled with
32P. Ten micrograms of nuclear extracts was
incubated with 1x105 cpm of labeled DNA probe
and 2 µg of deoxyinosine-deoxycytidine heteropolymer in a buffer
containing 20 mmol/L HEPES, pH 7.9, 50 mmol/L KCl, 1
mmol/L MgCl2, 5 mmol/L dithiothreitol,
1 mmol/L EDTA, 4% glycerol, and 50 mg/L BSA for 30 minutes at
room temperature and electrophoresed on 5% acrylamide gel.
Wild-type CRE or mutant CRE (5'-GCTAAATCGATCCACATT-3') was
added as a competitor. After electrophoresis, gels were dried and
exposed to an x-ray film at -80°C.
Statistical Analysis
Statistical analyses were performed by 1-way or 2-way
ANOVA and multiple comparison (Fisher) test if appropriate. A
P value <0.05 was considered significant. Data were
expressed as mean±SE.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Ang II–Increased IL-6 Production
VSMC were stimulated with Ang II, and the protein level of IL-6 in the supernatant was measured by sandwich ELISA. As shown in Figure 1A, the protein level of IL-6 in the tissue culture medium of Ang II (10-7 mol/L)–stimulated VSMC was increased in a time-dependent manner. A small amount of IL-6 was detected in the supernatant of unstimulated VSMC after 24 hours. A significant increase of IL-6 in the supernatant of Ang II–stimulated VSMC was observed after 6 hours. Next we examined the effect of isoform-specific antagonist for Ang II receptor on the enhancement of IL-6 expression. CV11974 (10-5 mol/L), an AT1R-specific antagonist, inhibited the enhancement of IL-6 production by Ang II, but PD123319 (10-5 mol/L), an AT2R-specific antagonist, had no significant effect. These results suggest that Ang II stimulates IL-6 production through the AT1R in VSMC. At 24 hours of stimulation, Ang II dose dependently increased IL-6 production (Figure 1B).
|
Enhancement of IL-6 mRNA Expression by Ang II
We examined the time course of Ang II–induced IL-6 mRNA
expression (Figure 2). Two species of
IL-6 gene transcript were detected (Figure 2A). The most
abundant transcript was 
1.3 kb in length, and the less abundant
transcript was 2.4 kb. The 2 IL-6 mRNA species are generated by an
alternative polyadenylation.30 For the quantification of
IL-6 mRNA, the radioactivities of both mRNA species were taken into
account. As seen in Figure 2, a biphasic increase of IL-6 mRNA
by Ang II was observed. The first peak was at 30 minutes after Ang II
stimulation. Then the expression level of IL-6 mRNA was decreased, and
the second peak was at 12 to 24 hours after Ang II stimulation.
|
VSMC were incubated with various concentrations of Ang II for 30 minutes. The expression of IL-6 mRNA by Ang II was increased dose dependently (Figure 3). We also examined the Ang II receptor responsible for IL-6 mRNA expression by using an isoform-specific antagonist. CV11974 completely abolished the IL-6 mRNA induction by Ang II; however, PD 123319 showed no effect (Figure 3). This result suggests that Ang II induces IL-6 mRNA expression through the AT1R and is consistent with the results of IL-6 protein production.
|
Intracellular Signals in Ang II–Induced IL-6 Expression
We examined the signaling pathway of Ang II important for
the induction of IL-6 gene expression (Figure 4). Protein kinase C (PKC)
activation35 and intracellular Ca2+
mobilization36 have been reported to be important signals
through the AT1R. VSMC were treated for 24 hours
with phorbol 12-myristate 13-acetate (PMA)
(10-6 mol/L) for downregulation of PKC activity
or pretreated with a PKC inhibitor, calphostin C
(10-6 mol/L, 30 minutes), and stimulated
with 10-6 mol/L of Ang II for 30 minutes.
Although prolonged exposure to PMA or calphostin C increased basal IL-6
mRNA expression, response to Ang II was not inhibited by these
treatments. Preincubation of VSMC with BAPTA-AM
(10-5 mol/L), an intracellular
Ca2+ chelator, for 30 minutes before Ang II
stimulation inhibited Ang II–induced IL-6 mRNA
expression. EGTA (10-2 mol/L, 30
minutes), an extracellular Ca2+ chelator, did not
inhibit Ang II–induced IL-6 mRNA expression. Basal and Ang II–induced
IL-6 mRNA expression was rather enhanced by preincubation with EGTA.
These results suggest that Ang II activates IL-6 gene
expression through an intracellular
Ca2+-dependent pathway. Tyrosine
phosphorylation and activation of MAPK are also
important signals of AT1R.37
Pretreatment with genistein (10-5 mol/L), which
inhibits tyrosine kinase, and PD98059 (10-5
mol/L), which inhibits activation of MAPK kinase, abolished the effect
of Ang II on the induction of IL-6 mRNA. These results suggest that Ang
II–induced tyrosine phosphorylation and MAPK
activation also play important roles in the activation of IL-6 gene
expression.
|
Promoter Activity of IL-6 Gene
To determine the promoter region responsible for the
induction of IL-6 gene expression by Ang II, deletion analysis
of the promoter region was performed. We constructed luciferase
expression vectors with various lengths of the promoter region of the
IL-6 gene (Figure 5A). Luciferase
activity was measured after 24 hours of Ang II
(10-6 mol/L) stimulation (Figure 5B). Ang
II stimulated luciferase activity by 2-fold in constructs of No. 1,
No. 2, and No. 3. The response to Ang II was not observed in the
construct that lacked the DNA segment between –581 and –150 bp (No.
4). In this DNA segment, several consensus cis DNA elements such as
glucocorticoid response element, AP-1, and CRE are present. Among
these elements, the AP-1 and the CRE (also known as a multiple response
element) were reported to be important for basal and
lipopolysaccharide-stimulated IL-6 gene
expression.38 Because downregulation of PKC by
prolonged exposure to PMA or a PKC inhibitor showed no
effect on Ang II–induced enhancement of IL-6 gene expression, we
assumed that the AP-1 site is not critical. Therefore, we introduced a
mutation into the CRE site. The luciferase activity of luciferase
expression plasmid driven by IL-6 gene promoter with mutation in the
CRE site was not enhanced by Ang II stimulation (Figure 6). This suggests that the CRE
site in the IL-6 gene promoter is essential for Ang II–induced
upregulation. We also examined the effect of PD98059 on IL-6 promoter
activity. Pretreatment with PD98059 strongly inhibited Ang II–induced
upregulation.
|
|
Induction of CREB by Ang II
Next we examined the DNA binding protein bound to the CRE
site using gel mobility shift assay (Figure 7). When nuclear extracts from Ang
II–stimulated VSMC were used, DNA binding protein (arrow 2) was
increased compared with unstimulated VSMC (lanes 1 to 3). Specificity
of the binding was confirmed by adding 100 times molar excess of
nonlabeled probe that eliminates this band (lane 4). When
oligonucleotide with mutation in the CRE site was added
as a competitor, this band did not fade (lane 5). When the antibody
against CREB was added (lane 6), the band was supershifted (the shifted
band is indicated by arrow 1). However, when an irrelevant antibody
(antibody against Stat 3) was added (lane 7), the band was not
supershifted. These results suggested that Ang II induces CREB bound to
the CRE site of the IL-6 gene promoter.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
We showed the following: (1) Ang II stimulated the expression of IL-6 through the AT1R in VSMC; (2) the induction of IL-6 expression by Ang II was dependent on intracellular Ca2+, tyrosine phosphorylation, and MAPK kinase and independent of PKC or extracellular Ca2+; (3) CRE in the promoter region of the IL-6 gene plays an important role in Ang II–induced upregulation.
Previous studies suggested that a Ca2+-dependent signaling mechanism plays an important role in Ang II–induced activation of MAPK through the AT1R.37 Chelation of intracellular Ca2+ by BAPTA-AM suppressed Ang II–induced IL-6 mRNA expression. In contrast, chelation of extracellular Ca2+ by EGTA itself enhanced IL-6 mRNA expression and did not inhibit Ang II–induced upregulation. Several reports showed that various Ca2+ channel blockers increased the expression of IL-6 mRNA in human VSMC,39 human mesangial cells,40 and peripheral blood mononuclear cells.41 EGTA may exert an effect similar to that of the Ca2+ channel blocker. However, the mechanism by which EGTA and Ca2+ channel blocker stimulate IL-6 gene expression remains unclear. Pretreatment with PD98059 or genistein completely inhibited Ang II–induced IL-6 expression. Recently, Eguchi et al37 showed that Ang II–induced MAPK activation is dependent on Ca2+/calmodulin-sensitive tyrosine phosphorylation. Our results were consistent with their results and suggest that the downstream signal(s) of MAPK is important for IL-6 gene activation by Ang II.
There are several important regulatory cis DNA elements such as
AP-1, CRE, nuclear factor–IL-6 (NF-IL6), and nuclear factor-
B
(NF-B) in the promoter region of the IL-6 gene. These promoter
elements are conserved among species such as mouse,42
rat,30 and human43 and regulate IL-6 gene
expression in a cell type–specific manner. AP-1, NF-B, and NF-IL6
are required for IL-6 gene expression in monocytes.38
NF-B is sufficient for expression in the T-cell line.44
However, regulatory elements important for expression in VSMC have not
been investigated. Although the basal expression of IL-6 mRNA in
quiescent VSMC is very weak, deletion analysis showed that the
DNA segment between -150 and –27 bp is important for basal expression
because luciferase activity was greatly reduced by deletion of this DNA
segment (Figure 5; compare the luciferase activity of No. 5
construct with that of No. 4). In this DNA segment, NF-B, NF-IL6,
and GATA are present and probably are important for the basal
expression of IL-6 gene in VSMC. In terms of the response to Ang II,
the DNA segment between –581 and –150 bp is essential. Mutational
analysis showed that the CRE site in this DNA segment is
essential for the response to Ang II. However, transcription factors
are known to activate gene transcription in a cooperative
manner. Therefore, the cooperation of CREB with other transcription
factors such as AP-1, NF-IL6, or NF-B may play a role, and this
possibility is not excluded in this study. Recently, Xing et
al45 reported that MAPK-activated
p90rsk2 phosphorylates and
activates CREB. Because Ang II–induced activation of IL-6 gene
transcription is inhibited by a MAPK kinase inhibitor, it
is possible that Ang II activates the
MAPK-p90rsk2-CREB pathway and upregulates IL-6
gene transcription.
It is known that protein kinase A, the calmodulin-dependent protein kinases,46 p90rsk2, and MAPK-activated protein kinase-247 phosphorylate CREB at serine-133, which is a key regulatory site controlling transcriptional activity in the response to a variety of extracellular signals, including growth factors and neurotropins. However, Chawla et al48 reported a dissociation between CREB phosphorylation on serine-133 and CRE-dependent transcription. Therefore, at this point it is not clear that increased binding of CREB by gel mobility shift assay correlates with activation of CRE-dependent transcription of IL-6 gene promoter.
We observed a biphasic increase of IL-6 mRNA by Ang II, as shown in Figure 2. Because Ang II induces production of many growth factors in VSMC, we assumed that the second peak was induced by Ang II–induced growth factors. To test this possibility, VSMC were incubated with cycloheximide (10-8 mol/L, 30 minutes), which is a protein synthesis inhibitor, and incubated with or without 10-6 mol/L of Ang II for 30 minutes or 24 hours. Cycloheximide increased basal mRNA expression at 30 minutes or 24 hours. The induction of IL-6 mRNA by cycloheximide has been reported.41 The response to Ang II in the presence of cycloheximide was preserved at both incubation periods, suggesting that the IL-6 mRNA expression by Ang II dose not require de novo protein synthesis (data not shown).
Previous studies have shown that IL-6 increases the number of platelets in the circulation17 and IL-6 activates platelets through arachidonic acid metabolism in vitro.49 Burstein50 reported that IL-6 increased plasma fibrinogen and decreased free protein S concentration. These IL-6–induced modifications of platelet and the coagulant phase of the clotting mechanism may lead to pathological thrombosis and instability of plaque. In an experimental model, Ikeda et al25 reported that IL-6 gene transcript was expressed in the atherosclerotic plaque of WHHL rabbit. However, the role of Ang II in the expression of IL-6 in WHHL rabbit was not defined. Recently, Nickenig et al51 reported that LDL increased AT1R mRNA in VSMC by increasing its stability and resulted in the elevation of functional response to Ang II. Thus, it is possible that AT1R in the WHHL rabbit plays a pivotal role in the induction of IL-6 transcript in atheromatous plaque.
Although it is not clear from this study that Ang II regulates IL-6 production in vivo, inhibition of Ang II–induced IL-6 production may be one of the mechanism by which an angiotensin-converting enzyme inhibitor or an AT1R antagonist prevents neointimal formation in the balloon injury model of atherosclerosis. Our data clearly showed the role of Ang II in IL-6 production in VSMC, suggesting that Ang II may mediate the inflammatory process in blood vessels.
|
Acknowledgments |
|---|
This study was supported in part by grants from Kaibara Morikazu Science Promotion Foundation, Fukuoka, Japan; Kimura Memorial Heart Foundation Research Grant for 1996, Kurume, Japan; Uehara Memorial Foundation, Tokyo, Japan; and Japan Heart Foundation Grant for Research on Hypertension and Vascular Metabolism.
Received February 8, 1999; first decision March 9, 1999; accepted March 16, 1999.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature. 1993;362:801–809.[Medline] [Order article via Infotrieve]
2. Sasaki K, Yamano Y, Bardhan S, Iwai N, Murray JJ, Hasegawa M, Matsuda Y, Inagami T. Cloning and expression of a complementary DNA encoding a bovine adrenal angiotensin II type-1 receptor. Nature. 1991;351:230–233.[Medline] [Order article via Infotrieve]
3. Murphy TJ, Alexander RW, Griendling KK, Runge MS, Bernstein KE. Isolation of a cDNA encoding the vascular type-1 angiotensin II receptor. Nature. 1991;351:233–236.[Medline] [Order article via Infotrieve]
4.
Mukoyama M, Nakajima M, Horiuchi M, Sasamura H, Pratt
RE, Dzau VJ. Expression cloning of type 2 angiotensin II
receptor reveals a unique class of seven-transmembrane receptors.
J Biol Chem. 1993;268:24539–24542.
5.
Kambayashi Y, Bardhan S, Takahashi K, Tsuzuki S, Inui
H, Hamakubo T, Inagami T. Molecular cloning of a novel
angiotensin II receptor isoform involved in phosphotyrosine
phosphatase inhibition. J Biol Chem. 1993;268:24543–24546.
6.
Rakugi H, Jacob HJ, Krieger JE, Ingelfinger JR, Pratt
RE. Vascular injury induces angiotensinogen gene expression
in the media and neointima. Circulation. 1993;87:283–290.
7.
deBlois D, Viswanathan M, Su JE, Clowes AW, Saavedra
JM, Schwartz SM. Smooth muscle DNA replication in response to
angiotensin II is regulated differently in the
neointima and media at different times after balloon injury
in the rat carotid artery: role of AT1 receptor expression.
Arterioscler Thromb Vasc Biol. 1996;16:1130–1137.
8.
Powell JS, Clozel JP, Muller RK, Kuhn H, Hefti
F, Hosang M, Baumgartner HR. Inhibitors of
angiotensin-converting enzyme prevent myointimal
proliferation after vascular injury. Science. 1989;245:186–188.
9. Kauffman RF, Bean JS, Zimmerman KM, Brown RF, Steinberg MI. Losartan, a nonpeptide angiotensin II (Ang II) receptor antagonist, inhibits neointima formation following balloon injury to rat carotid arteries. Life Sci. 1991;49:PL223–PL228.[Medline] [Order article via Infotrieve]
10. Prescott MF, Webb RL, Reidy MA. Angiotensin-converting enzyme inhibitor versus angiotensin II, AT1 receptor antagonist: effects on smooth muscle cell migration and proliferation after balloon catheter injury. Am J Pathol. 1991;139:1291–1296.[Abstract]
11.
Huckle WR, Prokop CA, Dy RC, Herman B, Earp S.
Angiotensin II stimulates protein-tyrosine
phosphorylation in a calcium-dependent manner.
Mol Cell Biol. 1990;10:6290–6298.
12.
Molloy CJ, Taylor DS, Weber H. Angiotensin
II stimulation of rapid protein tyrosine
phosphorylation and protein kinase activation in rat
aortic smooth muscle cells. J Biol Chem. 1993;268:7338–7345.
13. Duff JL, Berk BC, Corson MA. Angiotensin II stimulates the pp44 and pp42 mitogen-activated protein kinases in cultured rat aortic smooth muscle cells. Biochem Biophys Res Commun. 1992;188:257–264.[Medline] [Order article via Infotrieve]
14.
Tsuda T, Kawahara Y, Ishida Y, Koide M, Shii K,
Yokoyama M. Angiotensin II stimulates two myelin basic
protein/microtubule-associated protein 2 kinases in cultured vascular
smooth muscle cells. Circ Res. 1992;71:620–630.
15.
Taubman MB, Rollins BJ, Poon M, Marmur J, Green RS,
Berk BC, Nadal-Ginard B. JE mRNA accumulates rapidly in aortic injury
and in platelet-derived growth factor–stimulated vascular smooth
muscle cells. Circ Res. 1992;70:314–325.
16. Le J, Vilcek L. Interleukin 6: a multifunctional cytokine regulating immune reactions and the acute phase protein response. Lab Invest. 1998;61:588–602.[Medline] [Order article via Infotrieve]
17. Williams N, Bertoncello I, Jackson H, Arnold J, Kavnoudias H. The role of interleukin 6 in megakaryocyte formation, megakaryocyte development and platelet production. Ciba Found Symp.. 1992;167:160–170; discussion 170–173.[Medline] [Order article via Infotrieve]
18.
Ikeda U, Ikeda M, Oohara T, Oguchi A, Kamitani T,
Tsuruya Y, Kano S. Interleukin 6 stimulates growth of vascular smooth
muscle cells in a PDGF-dependent manner. Am J Physiol. 1991;260:H1713–H1717.
19.
Onozaki K, Akiyama Y, Okano A, Hirano T, Kishimoto T,
Hashimoto T, Yoshizawa K, Taniyama T. Synergistic regulatory effects of
interleukin 6 and interleukin 1 on the growth and differentiation of
human and mouse myeloid leukemic cell lines. Cancer Res. 1989;49:3602–3607.
20. Loppnow H, Libby P. Adult human vascular endothelial cells express the IL6 gene differentially in response to LPS or IL1. Cell Immunol. 1989;122:493–503.[Medline] [Order article via Infotrieve]
21. Loppnow H, Libby P. Proliferating or interleukin 1-activated human vascular smooth muscle cells secrete copious interleukin 6. J Clin Invest. 1990;85:731–738.
22. Moriyama T, Fujibayashi M, Fujiwara Y, Kaneko T, Xia C, Imai E, Kamada T, Ando A, Ueda N. Angiotensin II stimulates interleukin-6 release from cultured mouse mesangial cells. J Am Soc Nephrol. 1995;6:95–101.[Abstract]
23. Loppnow H, Libby P. Functional significance of human vascular smooth muscle cell-derived interleukin 1 in paracrine and autocrine regulation pathways. Exp Cell Res. 1992;198:283–290.[Medline] [Order article via Infotrieve]
24.
Roth M, Nauck M, Tamm M, Perruchoud AP, Ziesche R,
Block LH. Intracellular interleukin 6 mediates platelet-derived
growth factor-induced proliferation of nontransformed cells. Proc
Natl Acad Sci U S A. 1995;92:1312–1316.
25. Ikeda U, Ikeda M, Seino Y, Takahashi M, Kano S, Shimada K. Interleukin 6 gene transcripts are expressed in atherosclerotic lesions of genetically hyperlipidemic rabbits. Atherosclerosis. 1992;92:213–218.[Medline] [Order article via Infotrieve]
26.
Biasucci LM, Vitelli A, Liuzzo G, Altamura S, Caligiuri
G, Monaco C, Rebuzzi AG, Ciliberto G, Maseri A. Elevated levels of
interleukin-6 in unstable angina. Circulation. 1996;94:874–877.
27. Inui H, Kitami Y, Tani M, Kondo T, Inagami T. Differences in signal transduction between platelet-derived growth factor (PDGF) alpha and beta receptors in vascular smooth muscle cells: PDGF-BB is a potent mitogen, but PDGF-AA promotes only protein synthesis without activation of DNA synthesis [published correction appears in J Biol Chem. 1995;270:10358]. J Biol Chem. 1994;269:30546–30552.
28. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–159.[Medline] [Order article via Infotrieve]
29.
Ichiki T, Usui M, Kato M, Funakoshi Y, Ito K, Egashira
K, Takeshita A. Downregulation of angiotensin II type 1
receptor gene transcription by nitric oxide. Hypertension. 1998;31:342–348.
30.
Northemann W, Braciak TA, Hattori M, Lee F, Fey GH.
Structure of the rat interleukin 6 gene and its expression in
macrophage-derived cells. J Biol Chem. 1989;264:16072–16082.
31.
Higuchi R, Krummel B, Saiki RK. A general method of in
vitro preparation and specific mutagenesis of DNA fragments: study of
protein and DNA interactions. Nucl Acid Res. 1988;16:7351–7367.
32. Sambrook J, Fritisch E, Maniatis T. Molecular Cloning. New York, NY: Cold Spring Harbor Laboratory Press; 1989:66–67.
33.
Dignam JD, Lebovitz RM, Roeder RG. Accurate
transcription initiation by RNA polymerase II in a soluble extract from
isolated mammalian nuclei. Nucl Acid Res. 1983;11:1475–1489.
34.
Osborn L, Kunkel S, Nabel G. Tumor necrosis factor
alpha and interleukin 1 stimulate the human immunodeficiency virus
enhancer by activation of the nuclear factor kappa B. Proc Natl
Acad Sci U S A. 1989;86:2336–2340.
35. Nishizuka Y. The molecular heterogeneity of protein kinase C and its implications for cellular regulation. Nature. 1988;334:661–665.[Medline] [Order article via Infotrieve]
36. Berridge MJ. Inositol trisphosphate and diacylglycerol: two interacting second messengers. Ann Rev Biochem. 1987;56:159–193.[Medline] [Order article via Infotrieve]
37.
Eguchi S, Matsumoto T, Motley ED, Utsunomiya H, Inagami
T. Identification of an essential signaling cascade for
mitogen-activated protein kinase activation by
angiotensin II in cultured rat vascular smooth muscle
cells: possible requirement of Gq-mediated p21ras activation coupled to
a Ca2+/calmodulin-sensitive tyrosine kinase. J
Biol Chem. 1996;271:14169–14175.
38.
Dendorfer U, Oettgen P, Libermann TA. Multiple
regulatory elements in the interleukin-6 gene mediate induction by
prostaglandins, cyclic AMP, and lipopolysaccharide.
Mol Cell Biol. 1994;14:4443–4454.
39. Rodler S, Roth M, Nauck M, Tamm M, Block LH. Ca(2+)-channel blockers modulate the expression of interleukin-6 and interleukin-8 genes in human vascular smooth muscle cells. J Mol Cell Cardiol. 1995;27:2295–2302.[Medline] [Order article via Infotrieve]
40.
Roth M, Keul R, Emmons LR, Horl WH, Block LH.
Manidipine regulates the transcription of cytokine genes.
Proc Natl Acad Sci U S A. 1992;89:4071–4075.
41. Walz G, Zanker B, Barth C, Wieder KJ, Clark SC, Strom TB. Transcriptional modulation of human IL-6 gene expression by verapamil. J Immunol. 1990;144:4242–4248.[Abstract]
42.
Isshiki H, Akira S, Tanabe O, Nakajima T, Shimamoto T,
Hirano T, Kishimoto T. Constitutive and interleukin-1 (IL-1)-inducible
factors interact with the IL-1-responsive element in the IL-6 gene.
Mol Cell Biol. 1990;10:2757–2764.
43.
Sanceau J, Kaisho T, Hirano T, Wietzerbin J.
Triggering of the human interleukin-6 gene by interferone-G and tumor
necrosis factor-a in monocytic cells involves cooperation between
interferone regulatory factor-1, NF-kB, and Sp1 transcription factors.
J Biol Chem. 1995;270:27920–27931.
44.
Mori N, Shirakawa F, Shimizu H, Murakami S, Oda S,
Yamamoto K, Eto S. Transcriptional regulation of the human
interleukin-6 gene promoter in human T-cell leukemia virus type
I-infected T-cell lines: evidence for the involvement of NF-kappa B.
Blood. 1994;84:2904–2911.
45. Xing J, Ginty DD, Greenberg ME. Coupling of the RAS-MAPK pathway to gene activation by RSK2, a growth factor-regulated CREB kinase. Science. 1996;273:959–963.[Abstract]
46.
Sheng M, Thompson MA, Greenberg ME. CREB: a
Ca(2+)-regulated transcription factor phosphorylated by
calmodulin-dependent kinases. Science. 1991;252:1427–1430.
47. Tan Y, Rouse J, Zhang A, Cariati S, Cohen P, Comb MJ. FGF and stress regulate CREB and ATF-1 via a pathway involving p38 MAP kinase and MAPKAP kinase-2. EMBO J. 1996;15:4629–4642.[Medline] [Order article via Infotrieve]
48.
Chawla S, Hardingham GE, Quinn DR, Bading H. CBP: a
signal-regulated transcriptional coactivator controlled by
nuclear calcium and CaM kinase IV. Science. 1998;281:1505–1509.
49. Oleksowicz L, Mrowiec Z, Zuckerman D, Isaacs R, Dutcher J, Puszkin E. Platelet activation induced by interleukin-6: evidence for a mechanism involving arachidonic acid metabolism. Thromb Haemost. 1994;72:302–308.[Medline] [Order article via Infotrieve]
50. Burstein SA. Effects of interleukin 6 on megakaryocytes and on canine platelet function. Stem Cells. 1994;12:386–393.[Medline] [Order article via Infotrieve]
51.
Nickenig G, Sachinidis A, Michaelsen F, Bohm M, Seewald
S, Vetter H. Upregulation of vascular angiotensin II
receptor gene expression by low-density lipoprotein in vascular smooth
muscle cells. Circulation. 1997;95:473–478.
This article has been cited by other articles:
 |
|
 |
|
  K. R. Chava, M. Karpurapu, D. Wang, M. Bhanoori, V. Kundumani-Sridharan, Q. Zhang, T. Ichiki, W. C. Glasgow, and G. N. Rao CREB-Mediated IL-6 Expression Is Required for 15(S)-Hydroxyeicosatetraenoic Acid-Induced Vascular Smooth Muscle Cell Migration Arterioscler Thromb Vasc Biol, June 1, 2009; 29(6): 809 - 815. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Tian, R. Miyazaki, T. Ichiki, I. Imayama, K. Inanaga, H. Ohtsubo, K. Yano, K. Takeda, and K. Sunagawa Inhibition of Tumor Necrosis Factor-{alpha}-Induced Interleukin-6 Expression by Telmisartan Through Cross-Talk of Peroxisome Proliferator-Activated Receptor-{gamma} With Nuclear Factor {kappa}B and CCAAT/Enhancer-Binding Protein-{beta} Hypertension, May 1, 2009; 53(5): 798 - 804. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Sriramula, M. Haque, D. S.A. Majid, and J. Francis Involvement of Tumor Necrosis Factor-{alpha} in Angiotensin II-Mediated Effects on Salt Appetite, Hypertension, and Cardiac Hypertrophy Hypertension, May 1, 2008; 51(5): 1345 - 1351. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. I. Schrader, D. A. Kinzenbaw, A. W. Johnson, F. M. Faraci, and S. P. Didion IL-6 Deficiency Protects Against Angiotensin II Induced Endothelial Dysfunction and Hypertrophy Arterioscler Thromb Vasc Biol, December 1, 2007; 27(12): 2576 - 2581. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Sahar, M. A. Reddy, C. Wong, L. Meng, M. Wang, and R. Natarajan Cooperation of SRC-1 and p300 With NF-{kappa}B and CREB in Angiotensin II-Induced IL-6 Expression in Vascular Smooth Muscle Cells Arterioscler Thromb Vasc Biol, July 1, 2007; 27(7): 1528 - 1534. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. E. Marik and J. Varon Hypertensive Crises: Challenges and Management Chest, June 1, 2007; 131(6): 1949 - 1962. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Gadonski, B. B. D. LaMarca, E. Sullivan, W. Bennett, D. Chandler, and J. P. Granger Hypertension Produced by Reductions in Uterine Perfusion in the Pregnant Rat: Role of Interleukin 6 Hypertension, October 1, 2006; 48(4): 711 - 716. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Fukuyama, T. Ichiki, I. Imayama, H. Ohtsubo, H. Ono, Y. Hashiguchi, A. Takeshita, and K. Sunagawa Thyroid Hormone Inhibits Vascular Remodeling Through Suppression of cAMP Response Element Binding Protein Activity Arterioscler Thromb Vasc Biol, September 1, 2006; 26(9): 2049 - 2055. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Douillette, A. Bibeau-Poirier, S.-P. Gravel, J.-F. Clement, V. Chenard, P. Moreau, and M. J. Servant The Proinflammatory Actions of Angiotensin II Are Dependent on p65 Phosphorylation by the I{kappa}B Kinase Complex J. Biol. Chem., May 12, 2006; 281(19): 13275 - 13284. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Juretic, P. Garcia-Huidobro, J. A. Iturrieta, E. Jaimovich, and N. Riveros Depolarization-induced slow Ca2+ transients stimulate transcription of IL-6 gene in skeletal muscle cells Am J Physiol Cell Physiol, May 1, 2006; 290(5): C1428 - C1436. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. P. Granger An emerging role for inflammatory cytokines in hypertension Am J Physiol Heart Circ Physiol, March 1, 2006; 290(3): H923 - H924. [Full Text] [PDF]
|
|
|
|
|
|
T. Ichiki Role of cAMP Response Element Binding Protein in Cardiovascular Remodeling: Good, Bad, or Both? Arterioscler Thromb Vasc Biol, March 1, 2006; 26(3): 449 - 455. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. L. Lee, L. C. Sturgis, H. Labazi, J. B. Osborne Jr., C. Fleming, J. S. Pollock, M. Manhiani, J. D. Imig, and M. W. Brands Angiotensin II hypertension is attenuated in interleukin-6 knockout mice Am J Physiol Heart Circ Physiol, March 1, 2006; 290(3): H935 - H940. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Obara, H. Kurose, and N. Nakahata Thromboxane A2 Promotes Interleukin-6 Biosynthesis Mediated by an Activation of Cyclic AMP-Response Element-Binding Protein in 1321N1 Human Astrocytoma Cells Mol. Pharmacol., September 1, 2005; 68(3): 670 - 679. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Nesher, G. Uretzky, S. Insler, P. Nataf, I. Frolkis, E. Pineau, E. Cantoni, G. Bolotin, M. Vardi, D. Pevni, et al. Thermo-wrap technology preserves normothermia better than routine thermal care in patients undergoing off-pump coronary artery bypass and is associated with lower immune response and lesser myocardial damage J. Thorac. Cardiovasc. Surg., June 1, 2005; 129(6): 1371 - 1378. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P.-C. Lee, I-C. Ho, and T.-C. Lee Oxidative Stress Mediates Sodium Arsenite-Induced Expression of Heme Oxygenase-1, Monocyte Chemoattractant Protein-1, and Interleukin-6 in Vascular Smooth Muscle Cells Toxicol. Sci., May 1, 2005; 85(1): 541 - 550. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. J. H. van den Born, U. P.F. Honnebier, R. P. Koopmans, and G. A. van Montfrans Microangiopathic Hemolysis and Renal Failure in Malignant Hypertension Hypertension, February 1, 2005; 45(2): 246 - 251. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Ono, T. Ichiki, K. Fukuyama, N. Iino, S. Masuda, K. Egashira, and A. Takeshita cAMP-Response Element-Binding Protein Mediates Tumor Necrosis Factor-{alpha}-Induced Vascular Smooth Muscle Cell Migration Arterioscler Thromb Vasc Biol, September 1, 2004; 24(9): 1634 - 1639. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. L. Lee, R. Leite, C. Fleming, J. S. Pollock, R. C. Webb, and M. W. Brands Hypertensive Response to Acute Stress Is Attenuated in Interleukin-6 Knockout Mice Hypertension, September 1, 2004; 44(3): 259 - 263. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Wassmann, M. Stumpf, K. Strehlow, A. Schmid, B. Schieffer, M. Bohm, and G. Nickenig Interleukin-6 Induces Oxidative Stress and Endothelial Dysfunction by Overexpression of the Angiotensin II Type 1 Receptor Circ. Res., March 5, 2004; 94(4): 534 - 541. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Tokunou, R. Shibata, H. Kai, T. Ichiki, T. Morisaki, K. Fukuyama, H. Ono, N. Iino, S. Masuda, H. Shimokawa, et al. Apoptosis Induced by Inhibition of Cyclic AMP Response Element-Binding Protein in Vascular Smooth Muscle Cells Circulation, September 9, 2003; 108(10): 1246 - 1252. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Ichiki, T. Tokunou, K. Fukuyama, N. Iino, S. Masuda, and A. Takeshita Cyclic AMP Response Element-Binding Protein Mediates Reactive Oxygen Species-Induced c-fos Expression Hypertension, August 1, 2003; 42(2): 177 - 183. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. G. Deng, B. Martin-McNulty, D. A. Sukovich, A. Freay, M. Halks-Miller, T. Thinnes, D. J. Loskutoff, P. Carmeliet, W. P. Dole, and Y.-X. Wang Urokinase-Type Plasminogen Activator Plays a Critical Role in Angiotensin II-Induced Abdominal Aortic Aneurysm Circ. Res., March 21, 2003; 92(5): 510 - 517. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Fukuyama, T. Ichiki, K. Takeda, T. Tokunou, N. Iino, S. Masuda, M. Ishibashi, K. Egashira, H. Shimokawa, K. Hirano, et al. Downregulation of Vascular Angiotensin II Type 1 Receptor by Thyroid Hormone Hypertension, March 1, 2003; 41(3): 598 - 603. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Castoldi, C. R. T. di Gioia, F. Pieruzzi, C. D'Orlando, W. M. M. van de Greef, G. Busca, G. Sperti, and A. Stella ANG II increases TIMP-1 expression in rat aortic smooth muscle cells in vivo Am J Physiol Heart Circ Physiol, February 1, 2003; 284(2): H635 - H643. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Takata, Y. Kitami, Z.-H. Yang, M. Nakamura, T. Okura, and K. Hiwada Vascular Inflammation Is Negatively Autoregulated by Interaction Between CCAAT/Enhancer-Binding Protein-{delta} and Peroxisome Proliferator-Activated Receptor-{gamma} Circ. Res., September 6, 2002; 91(5): 427 - 433. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Sakurai, S. Alam, G. Pagan-Mercado, F. Hickman, J.-Y. Tsai, P. Zelenka, and S. Sato Retinal Capillary Pericyte Proliferation and c-Fos mRNA Induction by Prostaglandin D2 through the cAMP Response Element Invest. Ophthalmol. Vis. Sci., August 1, 2002; 43(8): 2774 - 2781. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Funakoshi, T. Ichiki, K. Takeda, T. Tokuno, N. Iino, and A. Takeshita Critical Role of cAMP-response Element-binding Protein for Angiotensin II-induced Hypertrophy of Vascular Smooth Muscle Cells J. Biol. Chem., May 17, 2002; 277(21): 18710 - 18717. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Ichiki, K. Takeda, T. Tokunou, N. Iino, K. Egashira, H. Shimokawa, K. Hirano, H. Kanaide, and A. Takeshita Downregulation of Angiotensin II Type 1 Receptor by Hydrophobic 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase Inhibitors in Vascular Smooth Muscle Cells Arterioscler Thromb Vasc Biol, December 1, 2001; 21(12): 1896 - 1901. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Tokunou, T. Ichiki, K. Takeda, Y. Funakoshi, N. Iino, H. Shimokawa, K. Egashira, and A. Takeshita Thrombin Induces Interleukin-6 Expression Through the cAMP Response Element in Vascular Smooth Muscle Cells Arterioscler Thromb Vasc Biol, November 1, 2001; 21(11): 1759 - 1763. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-X. Wang, B. Martin-McNulty, A. D. Freay, D. A. Sukovich, M. Halks-Miller, W.-W. Li, R. Vergona, M. E. Sullivan, J. Morser, W. P. Dole, et al. Angiotensin II Increases Urokinase-Type Plasminogen Activator Expression and Induces Aneurysm in the Abdominal Aorta of Apolipoprotein E-Deficient Mice Am. J. Pathol., October 1, 2001; 159(4): 1455 - 1464. [Abstract] [Full Text]
|
|
|
|
|
|
Y. Funakoshi, T. Ichiki, H. Shimokawa, K. Egashira, K. Takeda, K. Kaibuchi, M. Takeya, T. Yoshimura, and A. Takeshita Rho-Kinase Mediates Angiotensin II-Induced Monocyte Chemoattractant Protein-1 Expression in Rat Vascular Smooth Muscle Cells Hypertension, July 1, 2001; 38(1): 100 - 104. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Takeda, T. Ichiki, T. Tokunou, N. Iino, S. Fujii, A. Kitabatake, H. Shimokawa, and A. Takeshita Critical Role of Rho-Kinase and MEK/ERK Pathways for Angiotensin II-Induced Plasminogen Activator Inhibitor Type-1 Gene Expression Arterioscler Thromb Vasc Biol, May 1, 2001; 21(5): 868 - 873. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. L. Abbott, J. R. Loss II, A. M. Robida, and T. J. Murphy Evidence That Galpha q-Coupled Receptor-Induced Interleukin-6 mRNA in Vascular Smooth Muscle Cells Involves the Nuclear Factor of Activated T Cells Mol. Pharmacol., November 1, 2000; 58(5): 946 - 953. [Abstract] [Full Text]
|
|
|
|
|
|
E. Mervaala, D. N. Muller, J.-K. Park, R. Dechend, F. Schmidt, A. Fiebeler, M. Bieringer, V. Breu, D. Ganten, H. Haller, et al. Cyclosporin A Protects Against Angiotensin II-Induced End-Organ Damage in Double Transgenic Rats Harboring Human Renin and Angiotensinogen Genes Hypertension, January 1, 2000; 35(1): 360 - 366. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sano, K. Fukuda, H. Kodama, J. Pan, M. Saito, J. Matsuzaki, T. Takahashi, S. Makino, T. Kato, and S. Ogawa Interleukin-6 Family of Cytokines Mediate Angiotensin II-induced Cardiac Hypertrophy in Rodent Cardiomyocytes J. Biol. Chem., September 15, 2000; 275(38): 29717 - 29723. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Takeda, T. Ichiki, T. Tokunou, N. Iino, and A. Takeshita 15-Deoxy-Delta 12,14-prostaglandin J2 and Thiazolidinediones Activate the MEK/ERK Pathway through Phosphatidylinositol 3-Kinase in Vascular Smooth Muscle Cells J. Biol. Chem., December 21, 2001; 276(52): 48950 - 48955. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sano, K. Fukuda, T. Sato, H. Kawaguchi, M. Suematsu, S. Matsuda, S. Koyasu, H. Matsui, K. Yamauchi-Takihara, M. Harada, et al. ERK and p38 MAPK, but not NF-{kappa}B, Are Critically Involved in Reactive Oxygen Species-Mediated Induction of IL-6 by Angiotensin II in Cardiac Fibroblasts Circ. Res., October 12, 2001; 89(8): 661 - 669. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||