This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Makaritsis, K. P. Articles by Gavras, H. Search for Related Content PubMed PubMed Citation Articles by Makaritsis, K. P. Articles by Gavras, H. Related Collections Genetically altered mice Hypertension - basic studies

(Hypertension. 1999;34:403-407.)
© 1999 American Heart Association, Inc.

Scientific Contributions

Sympathoinhibitory Function of the _2A-Adrenergic Receptor Subtype

Konstantinos P. Makaritsis; Conrado Johns; Irene Gavras; John D. Altman; Diane E. Handy; Margaret R. Bresnahan; Haralambos Gavras

From the Hypertension and Atherosclerosis Section, Boston University School of Medicine (K.P.M., C.J., I.G., D.E.H., M.R.B., H.G.), Boston, Mass; and Howard Hughes Medical Institute, Stanford University (J.D.A.), Stanford, Calif.

Correspondence to Haralambos Gavras, MD, Chief, Hypertension and Atherosclerosis Section, Boston University School of Medicine, 715 Albany St, Boston, MA 02118. E-mail hgavras{at}bu.edu

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Abstract—Presynaptic ₂-adrenergic receptors (₂-AR) are distributed throughout the central nervous system and are highly concentrated in the brain stem, where they contribute to neural baroreflex control of blood pressure (BP). To explore the role of the _2A-AR subtype in this function, we compared BP and plasma norepinephrine and epinephrine levels in genetically engineered mice with deleted _2A-AR gene to their wild-type controls. At baseline, the _2A-AR gene knockouts (n=11) versus controls (n=10) had higher systolic BP (123±2.5 versus 115±2.5 mm Hg, P<0.05), heart rate (730±15 versus 600±18 b/min, P<0.001), and norepinephrine (1.005±0.078 versus 0.587±0.095 ng/mL, P<0.01), respectively. When submitted to subtotal nephrectomy and given 1% saline as drinking water, both _2A-AR gene knockouts (n=14) and controls (n=14) became hypertensive, but the former required 15.6±2.5 days versus 29.3±1.4 days for the controls (P<0.001). End-point systolic BP was similar for both at 155±2.1 versus 152±5.2 mm Hg, but norepinephrine and epinephrine levels were twice as high in the knockouts at 1.386±0.283 and 0.577±0.143 versus 0.712±0.110 and 0.255±0.032 ng/mL, respectively, P<0.05 for both. We conclude that the _2A-AR subtype exerts a sympathoinhibitory effect, and its loss leads to a hypertensive, hyperadrenergic state.

Key Words: adrenergic receptors • mice, knockout • hypertension, sodium-dependent • hyperadrenergic state

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
The sympathetic nervous system (SNS) is one of the major pressor systems involved in the regulation of blood pressure (BP). Aberrant function of various neuroendocrine components of the SNS contributes to abnormal BP in response to environmental stimuli, such as excessive sodium intake. Indeed, a large body of literature indicates that 1 of the mechanisms by which salt-loading raises BP is via activation of the central SNS, which leads to increased sympathetic outflow.^{1 2} Experimental studies in animals with pharmacological probes in vivo^{3 4 5} and radioligand techniques in vitro^{6 7} have suggested that salt-induced hypertension is associated with alterations in the functional characteristics of the ₂-adrenergic receptors (₂-AR) in the central nervous system (CNS). None of these methods, however, can differentiate among the ₂-AR subtypes (_2A, _2B, or ₂c) involved in this process.

Recently, genetically engineered mice that are deficient in each one of the ₂-AR subtypes became available.^{8 9} In our first series of experiments with these mice, we used animals deficient for the _2B-AR gene (+/-) and _2C-AR gene knockouts (-/-) compared with their wild-type counterparts (_2B +/+ and _2C +/+, respectively) to study the role of each subtype in determining salt-sensitivity. We found that the ability to develop hypertension in response to salt-loading requires a full complement of the _2B-AR subtype gene. Indeed, the _2B +/- mice failed to raise their BP after subtotal nephrectomy and dietary salt-loading for 5 weeks, whereas their wild-type counterparts became consistently hypertensive. On the contrary, knockout mice for the _2C subtype gene had the expected hypertensive response to chronic salt-loading and behaved no differently from their wild-type counterparts in this respect.¹⁰

The present experiments were designed to explore the role of the _2A-AR subtype gene in normal BP regulation and in the hypertensive response to salt-loading by comparing _2A-AR gene knockouts (-/-) to their wild-type counterparts.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Animals
Mice with deletion of the _2A-AR subtype gene (-/-) and their wild-type controls (+/+) were used in these studies. The animals, 8 to 10 weeks old, weighed 21.8 to 30.7 g and were housed in the animal facility of our institution (Boston University School of Medicine) and given free access to food (Purina Certified Rodent Chow, 5002) and distilled water. In animals submitted to subtotal nephrectomy, drinking water was replaced with 1% saline.

Genotypes were determined by polymerase chain reaction from DNA that were isolated from the tail or spleen of the animals. To screen the _2A-AR line, MA.GF1 (CGCTCAAAGCTCCCCAAAAC), MA.GB1 (GCTTCAGGTTGTACTCGATGGC), and PGK.2 (TGAGACGTGCTACTTCCA-TTTGTC) primers were used to detect the intact _2A-AR gene (246 bp) or the interrupted _2A-AR gene (368 bp). Each 25-µL polymerase chain reaction contained 0.2 µmol/l each primer, 0.2 mmol/l each dNTP, 2 mmol/l Mg²⁺, 10 mmol/l Tris-HCl, pH 8.3, 50 mmol/l KCl, 0.025 U of AmpliTaq Gold (Perkin Elmer) and was incubated as follows: 95°C for 12 minutes followed by 30 cycles of 94°C for 30 seconds, 55^o for 30 seconds, and 75^o for 1 minute 30 seconds followed by 75^o for 5 minutes. Bands were separated on 3% to 4% NuSieve agarose gels. All experiments were conducted in accordance with the guidelines for the care and use of animals approved by the Boston University Medical Center.

Protocol 1
The first set of experiments was designed to determine whether deletion of the _2A-AR gene affects baseline BP, heart rate (HR), and sympathetic outflow in these animals. One group (n=11) of _2A-AR knockout mice (_2A-AR -/-) along with 1 group (n=10) of their wild-type counterparts (_2A-AR +/+) were used in this protocol. In both groups, control (baseline) tail-cuff systolic BP and HR measurements were obtained with a computerized tail-cuff system (BP 2000 Visitech Systems), as described elsewhere.¹⁰ The system has the ability to determine systolic BP and HR in 4 mice simultaneously and uses a photoelectric sensor to detect the cuff pressure at which blood flow to the tail is eliminated. Mice were trained for 5 consecutive days (each session consisted of 20 unrecorded measurements) to familiarize the animals to the tail-cuff apparatus. Subsequently, BP and HR measurements were recorded daily for another 5 consecutive days. Each session consisted of 20 measurements for each mouse daily and the mean BP and HR for the day were calculated.

Subsequently, tail-cuff BP was confirmed by direct measurement via arterial catheterization, as described elsewhere.¹¹ Arterial catheterization was performed in all animals under anesthesia induced by sodium pentobarbital (50 mg/kg IP). A modified polyethylene catheter (PE-50) was introduced into the right iliac artery for direct BP recording and was tunneled subcutaneously and exteriorized at the back of the animal's neck. Subsequently, the catheter was filled with heparin in 0.9% saline solution, sealed with heat, and attached to the animal's nape. After surgery, the animals were returned to their cages and allowed an overnight recovery period. On the following day, the arterial catheter was connected to a BP transducer attached to a recorder (model 220S, Gould Inc) for direct BP monitoring. Direct control (baseline) BP was recorded for 1 hour, and blood was then drawn from the arterial line for determination of control plasma catecholamine levels.

Protocol 2
The second set of experiments explored the role of the _2A-AR in salt-induced hypertension. One group (n=14) of _2A-AR knockout mice (_2A-AR -/-) and 1 group (n=14) of their wild-type counterparts (_2A-AR +/+) were used in these studies. Mice were submitted to subtotal nephrectomy, given 1% saline as drinking water, and handled as described elsewhere.¹⁰

Tail-cuff systolic BP and HR measurements were obtained 3 times a week, and mice were followed for a maximum period of 35 days or until they became hypertensive, ie, their tail-cuff systolic BP reached 150 mm Hg or an increase by 40 mm Hg from baseline was recorded and sustained for 3 consecutive days. The BP and HR measurements of the last 3 days were averaged, and the mean was considered as the end-point tail-cuff BP and HR for the animal. The end-point tail-cuff BP was confirmed by direct measurement via arterial catheterization at the end of the protocol, as described elsewhere.¹¹ Direct end-point BP was recorded for 1 hour, and blood was then drawn from the arterial line for determination of plasma catecholamine and creatinine levels.

Determination of Plasma Catecholamine and Creatinine Levels
For assay of plasma catecholamine levels, 100 µL of blood was drawn slowly from the arterial line. EGTA (90 mg/mL), reduced glutathione (60 mg/mL) solution RPN 532 (Amersham Life Sciences), was used as anticoagulant and antioxidant, as recommended for the BioTrak Catecholamine Research Assay System TRK 995 (Amersham Life Sciences), which was used for norepinephrine and epinephrine measurement. Mouse plasma (10 to 20 µL) was diluted to 50 µL with sterile water to produce the 50 µL vol needed in the assay (with subsequent correction for dilution in calculation) and with 20 pg of each catecholamine standard to determine recovery. The assay is sensitive to 2 pg norepinephrine or epinephrine per tube. Plasma creatinine was measured on blood samples (500 µL) drawn into heparinized tubes from the arterial line, with a commercially available colorimetric kit from Sigma Diagnostics.

Statistical Analysis
All data are presented as mean±SEM. Student's t test for paired and unpaired data was used, as appropriate. The Mann-Whitney Rank Sum test was used for nonparametric data. Differences at P<0.05 were considered to be significant.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Protocol 1
Figure 1 presents baseline data obtained by the tail-cuff method and direct arterial catheterization in 8- to 10-week-old _2A-AR -/- mice and their wild-type counterparts. Figures 1A and 1B show that tail-cuff BP and HR were significantly higher in the _2A-AR -/- mice at 123±2.5 mm Hg and 730±15 bpm, respectively, than their wild-type (+/+) counterparts at 115±2.5 mm Hg and 600±18 bpm, respectively. Consistent with the tail-cuff measurements, direct mean arterial pressure (Figure 1C) was significantly higher in the _2A-AR knockout mice than their wild-type counterparts.

View larger version (13K): [in this window] [in a new window]   Figure 1. Control tail-cuff and intraarterial measurements for each group of mice. Open bars denote wild-type (+/+) mice and closed bars denote the knockout (-/-) mice. A, Control tail-cuff BP; B, Control tail-cuff HR; and C, Control direct mean arterial pressure in both groups. *P<0.05, ** P<0.001 between knockout mice and their wild-type counterparts.

Control plasma catecholamine levels in both groups are shown in Figure 2. Plasma norepinephrine levels were significantly higher in the _2A-AR -/- group at 1.005±0.078 versus 0.587±0.095 ng/mL in the +/+, whereas plasma epinephrine levels were not different between the 2 groups at 0.356±0.090 versus 0.267±0.048 ng/mL, respectively.

View larger version (12K): [in this window] [in a new window]   Figure 2. Control plasma catecholamine levels for each group of mice. NE indicates norepinephrine; Epi, epinephrine. *P<0.01 between knockout mice and their wild-type counterparts. Bar symbols as in Figure 1.

Protocol 2
Figure 3 summarizes data obtained from subtotally nephrectomized salt-fed mice in both groups. Figure 3A shows that baseline (ie, before surgery) tail-cuff BP was higher in the _2A-AR -/- mice versus the wild-type group, with numbers similar to those of protocol 1. However, both groups became hypertensive after subtotal nephrectomy and salt-loading, which resulted in comparable end-point BP measurements (155±2.1 and 152±5.2 mm Hg, respectively). Figure 3B shows that tail-cuff HR was higher at baseline in the _2A-AR -/- mice (697±11 versus 609±12 bpm in +/+), but end-point HR was not different between the 2 groups. A significant increase in BP and HR from baseline was observed in both groups after subtotal nephrectomy and 1% saline (paired t test, P<0.001). As shown in Figure 3C, direct mean arterial pressure at end point was comparable in both _2A-AR -/- and _2A-AR +/+ mice.

View larger version (16K): [in this window] [in a new window]   Figure 3. Tail-cuff and intraarterial measurements at baseline and end point for each group of mice. A and B, Tail-cuff BP and HR, respectively, at baseline and end point. C, Direct mean arterial pressure at end point. *P<0.01, **P<0.001 between knockout mice and their wild-type counterparts. Bar symbols as in Figure 1.

Figure 4 shows end-point plasma catecholamine levels in both groups. Plasma norepinephrine and epinephrine levels were significantly higher in the _2A-AR -/- mice at 1.386±0.283 and 0.577±0.143 ng/mL, respectively, than their wild-type (+/+) counterparts at 0.712±0.110 and 0.255±0.032 ng/mL.

View larger version (12K): [in this window] [in a new window]   Figure 4. End-point plasma catecholamine levels for each group of mice. NE indicates norepinephrine; and Epi, epinephrine. *P<0.05 between knockout mice and their wild-type counterparts. Bar symbols as in Figure 1.

Table 1 shows that no difference existed between the knockout mice (-/-) and their wild-type counterparts (+/+) in regard to body weight at baseline and end point or ratio of remnant kidney weight to body weight at end point. Mean plasma creatinine levels were comparable in both groups and indicated that the residual renal function was similar in both knockout and wild-type animals. After subtotal nephrectomy and 1% saline, however, the _2A-AR -/- mice became hypertensive faster than their wild-type counterparts (15.6±2.5 versus 29.3±1.4 days, respectively; P<0.001).

View this table: [in this window] [in a new window]   Table 1. Changes in Body Weight, Ratio of Remnant Kidney Weight to Body Weight, Days on 1% NaCl and Plasma Creatinine Levels in Subtotally Nephrectomized Mice on 1% NaCl

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
Several lines of evidence over the years have supported the notion that ₂-AR in the CNS exert a sympathoinhibitory effect. This has been exploited clinically by the development of pharmacological agents with ₂-agonistic properties (eg, clonidine) that suppress the central SNS and produce a sustained antihypertensive action.¹² However, existing ₂-agonists are nonselective for ₂-AR subtypes. Genetic targeting of each one of the ₂-AR gene subtypes has now produced evidence that suggests that the long-recognized sympathoinhibitory effect of central presynaptic ₂-AR may be a function of the _2A-AR subtype.^{13 14} These receptors are abundantly distributed throughout the CNS, but highly concentrated in the brain stem,¹⁵ which is known to be the center of neural baroreflex control.^{16 17} Indeed, introduction of minute amounts of hypertonic saline directly into certain brain stem nuclei, such as the nucleus tractus solitarii, produces long-lasting systemic hypertensive responses¹⁸ and a hyperadrenergic state that can be explained by temporary reversal of this sympathoinhibitory effect.

The present experiments corroborate and extend these findings by demonstrating heightened sympathetic activity in _2A-AR gene knockout mice under various conditions: at baseline, 8 to 10 week old _2A-AR gene knockout mice already displayed significantly higher BPs and HRs, accompanied by about twice as high levels of circulating norepinephrine, in comparison to their genetically intact counterparts. After subtotal nephrectomy and dietary salt-loading, it took an average of 2 weeks for the _2A -/- mice to become hypertensive, as opposed to >4 weeks for the _2A +/+ mice. However, by end point, both groups had similar BP and HR levels, which indicated that removal of the SNS restraining effect of the _2A-AR hastened the development of salt-induced hypertension without altering the magnitude of the final response. Furthermore, at end point, both norepinephrine and epinephrine levels in the _2A -/- mice were twice as high as those of the _2A +/+. Consistent with these data is the recent finding that ₂-AR agonists, which normally produce a hypotensive effect via central sympathoinhibition, were unable to produce such hypotensive effect in _2A-AR knockouts.¹⁹ This suggests that the _2A-AR is the major presynaptic receptor subtype that regulates norepinephrine release from sympathetic neurons, although a residual presynaptic ₂-mediated effect was still detectable in _2A-AR knockouts, evidently contributed by one of the other subtypes.

These findings can be compared with those obtained on mice with complete or partial deletion of the other 2 ₂-AR gene subtypes¹⁰ : homozygous _2C-AR gene knockout mice had normal BP at baseline, and after partial nephrectomy and dietary salt-loading, they developed hypertension to the same degree and in the same time frame as their wild-type controls, which indicated that the _2C-AR subtype has no function relevant to salt-sensitivity and/or BP elevation. On the contrary, mice deficient in the _2B-AR gene subtype, as mentioned earlier, were unable to raise their BP after subtotal nephrectomy and salt-loading. These findings indicated that the _2B-AR subtype is the one responsible for the development of salt-induced hypertension, although they did not provide information as to whether its role is central (ie, related to central SNS activation) or peripheral (ie, related to alterations in vascular tone or renal handling of sodium).

In combination, the data suggest that the central _2A-AR is the component mainly responsible for the known tonic sympathoinhibitory function of the presynaptic ₂-AR of the CNS, because its loss leads to a hypertensive, hyperadrenergic state, whereas the _2B-AR is necessary for the hypertensive response to salt-loading. The pathophysiological implications of these findings are extremely important and may be directly applicable to optimizing the treatment of hypertension, chronic heart failure, anxiety disorders, and other conditions characterized by a hyperadrenergic state. Available pharmacological tools are nonselective; thus, a desirable action is inevitably accompanied by undesirable side effects (eg, the antihypertensive and bradycardic effect of clonidine cannot be separated from the drowsiness and impotence). Identification of the exact ₂-AR subtype responsible for other specific ₂-AR–mediated functions, such as mental alertness, sexual arousal, and other functions, may permit the development of corrective interventions or pharmacological tools designed to selectively alter 1 function without adversely affecting others.

	Acknowledgments

 
This work was supported by the Hypertension SCOR Grant P50 HL-55001. The authors are indebted to Dr. Brian K. Kobilka from Stanford University for kindly supplying the breeder genetically engineered mice.

Received April 6, 1999; first decision April 27, 1999; accepted May 5, 1999.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Gavras H. How does salt raise BP? A hypothesis. Hypertension.. 1986;8:83–88.[Abstract/Free Full Text]

2. Gavras H, Gavras I. Salt-induced hypertension: the interactive role of vasopressin and of the sympathetic nervous system. J Hypertens. 1989;7:601–606.[Medline] [Order article via Infotrieve]

3. Kohlmann O Jr, Gavras I, Biollaz J, Biollaz B, Gavras H. Sodium chloride–induced partial inhibition in vivo of ₂-adrenoceptor agonist function. J Hypertens. 1985;3:269–274.[Medline] [Order article via Infotrieve]

4. Koepke JP, Jones S, DiBona GF. Sodium responsiveness of central ₂-adrenergic receptors in spontaneously hypertensive rats. Hypertension. 1988;11:326–333.[Abstract/Free Full Text]

5. Klangkalya B, Sripairojthikoon W, Oparil S, Wyss JM. High NaCl diet increases anterior hypothalamic ₂-adrenoceptors in SHR. Brain Res. 1988;451:77–84.[Medline] [Order article via Infotrieve]

6. Tsai BS, Lefkowitz J. Agonist-specific effects of monovalent and divalent cations on adenylate cyclase-coupled alpha adrenergic receptors in rabbit platelets. Mol Pharmacol. 1978;14:540–548.[Abstract/Free Full Text]

7. Bresnahan MR, Gavras I, Hatinoglou S, Muller RE, Gavras H. Central -adrenoceptors during the development of hypertension in rats on high- and low-salt intake. J Hypertens. 1986;4:719–726.[Medline] [Order article via Infotrieve]

8. Link RE, Stevens MS, Kulatunga M, Scheinin M, Barsh GS, Kobilka BK. Targeted inactivation of the gene encoding the mouse _2C-adrenoceptor homology. Mol Pharmacol. 1995;48:48–55.[Abstract]

9. Link RE, Desai K, Hein L, Stevens ME, Chruscinski A, Bernstein D, Barsh GS, Kobilka BK. Cardiovascular regulation in mice lacking ₂-adrenergic receptor subtypes b and c. Science. 1996;273:803–805.[Abstract]

10. Makaritsis KP, Handy DE, Johns C, Kobilka B, Gavras I, Gavras H. Role of the _2B-adrenergic receptor in the development of salt-induced hypertension. Hypertension. 1999;33:14–17.[Abstract/Free Full Text]

11. Johns C, Gavras I, Handy DE, Salomao A, Gavras H. Models of experimental hypertension in mice. Hypertension. 1996;28:1064–1069.[Abstract/Free Full Text]

12. Onesti G, Schwartz AM, Kim KE, Schwartz C, Brest AN. Pharmacodynamic effects of a new antihypertensive drug, Catapress (ST-155). Circulation. 1969;39:219–228.[Abstract/Free Full Text]

13. MacMillan LB, Hein L, Smith MS, Piascik MT, Limbird LE. Central hypotensive effect of the _2a-adrenergic receptor subtype. Science. 1996;273:801–803.[Abstract]

14. MacDonald E, Kobilka Bk, Scheinin M. Gene targeting: homing in on ₂-adrenoceptor-subtype function. Trends Pharmacol Sci. 1997;18:211–219.[Medline] [Order article via Infotrieve]

15. Tavares A, Handy DE, Bogdanova NN, Rosene DL, Gavras H. Localization of _2A- and _2B-adrenergic receptor subtypes in brain. Hypertension. 1996;27(pt 1):449–455.

16. Hökfelt T, Fuxe K, Goldstein M, Johansson O. Evidence of adrenaline neurons in the rat brain. Acta Physiol Scand. 1973;89:286–288.[Medline] [Order article via Infotrieve]

17. Nathan MA, Reis DJ. Chronic labile hypertension produced by lesion of the nucleus tractus solatarii in the cat. Circ Res. 1977;40:72–81.[Abstract/Free Full Text]

18. Gavras H, Bain GT, Bland L, Vlahakos D, Gavras I. Hypertensive response to saline microinjection in the area of the nucleus tractus solitarii of the rat. Brain Res. 1985;343:113–119.[Medline] [Order article via Infotrieve]

19. Altman JD, Trendelenburg AU, MacMillan L, Bernstein D, Limbird L, Starke K, Kobilka BK, Hein L. Abnormal regulation of the sympathetic nervous system in _2A-adrenergic receptor knockout mice. Mol Pharmacol.. 1999;56:154–161.[Abstract/Free Full Text]

This article has been cited by other articles:

				D. V. Menon, Z. Wang, P. J. Fadel, D. Arbique, D. Leonard, J.-L. Li, R. G. Victor, and W. Vongpatanasin Central Sympatholysis as a Novel Countermeasure for Cocaine-Induced Sympathetic Activation and Vasoconstriction in Humans J. Am. Coll. Cardiol., August 14, 2007; 50(7): 626 - 633. [Abstract] [Full Text] [PDF]

				K. Masuo, T. Katsuya, Y. Fu, H. Rakugi, T. Ogihara, and M. L. Tuck Lys418Asn Polymorphism of the {alpha}2-Adrenoceptor Gene Relates to Serum Uric Acid Levels But Not to Insulin Sensitivity Hypertension, July 1, 2005; 46(1): 144 - 150. [Abstract] [Full Text] [PDF]

				J. C. Finley Jr., M. O'Leary, D. Wester, S. MacKenzie, N. Shepard, S. Farrow, and W. Lockette A genetic polymorphism of the {alpha}2-adrenergic receptor increases autonomic responses to stress J Appl Physiol, June 1, 2004; 96(6): 2231 - 2239. [Abstract] [Full Text] [PDF]

				J. Tank, J. Jordan, A. Diedrich, M. Obst, R. Plehm, F. C. Luft, and V. Gross Clonidine Improves Spontaneous Baroreflex Sensitivity in Conscious Mice Through Parasympathetic Activation Hypertension, May 1, 2004; 43(5): 1042 - 1047. [Abstract] [Full Text] [PDF]

				N. Peng, B. D. Chambless, S. Oparil, and J. M. Wyss {alpha}2A-Adrenergic Receptors Mediate Sympathoinhibitory Responses to Atrial Natriuretic Peptide in the Mouse Anterior Hypothalamic Nucleus Hypertension, March 1, 2003; 41(3): 571 - 575. [Abstract] [Full Text] [PDF]

				M. Brede, F. Wiesmann, R. Jahns, K. Hadamek, C. Arnolt, S. Neubauer, M. J. Lohse, and L. Hein Feedback Inhibition of Catecholamine Release by Two Different {alpha}2-Adrenoceptor Subtypes Prevents Progression of Heart Failure Circulation, November 5, 2002; 106(19): 2491 - 2496. [Abstract] [Full Text] [PDF]

				C. Plut, C. Ribiere, Y. Giudicelli, and J.-P. Dausse Gender Differences in Hypothalamic Tyrosine Hydroxylase and alpha 2-Adrenoceptor Subtype Gene Expression in Cafeteria Diet-Induced Hypertension and Consequences of Neonatal Androgenization J. Pharmacol. Exp. Ther., August 1, 2002; 302(2): 525 - 531. [Abstract] [Full Text] [PDF]

				M. Philipp, M. Brede, and L. Hein Physiological significance of alpha 2-adrenergic receptor subtype diversity: one receptor is not enough Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2002; 283(2): R287 - R295. [Abstract] [Full Text] [PDF]

				B. J. A. Janssen and J. F. M. Smits Autonomic control of blood pressure in mice: basic physiology and effects of genetic modification Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2002; 282(6): R1545 - R1564. [Abstract] [Full Text] [PDF]

				M. Khalid, Y. Giudicelli, and J.-P. Dausse An Up-Regulation of Renal alpha 2A-Adrenoceptors Is Associated with Resistance to Salt-Induced Hypertension in Sabra Rats J. Pharmacol. Exp. Ther., December 1, 2001; 299(3): 928 - 933. [Abstract] [Full Text] [PDF]

				X. X. Li, M. Bek, L. D. Asico, Z. Yang, D. K. Grandy, D. S. Goldstein, M. Rubinstein, G. M. Eisner, and P. A. Jose Adrenergic and Endothelin B Receptor-Dependent Hypertension in Dopamine Receptor Type-2 Knockout Mice Hypertension, September 1, 2001; 38(3): 303 - 308. [Abstract] [Full Text] [PDF]

				X.-J. Du Sympathoadrenergic mechanisms in functional regulation and development of cardiac hypertrophy and failure: findings from genetically engineered mice Cardiovasc Res, June 1, 2001; 50(3): 443 - 453. [Full Text] [PDF]

				J. W. Kable, L. C. Murrin, and D. B. Bylund In Vivo Gene Modification Elucidates Subtype-Specific Functions of alpha 2-Adrenergic Receptors J. Pharmacol. Exp. Ther., April 1, 2000; 293(1): 1 - 7. [Abstract] [Full Text]

				K. P. Makaritsis, C. Johns, I. Gavras, and H. Gavras Role of {alpha}2-Adrenergic Receptor Subtypes in the Acute Hypertensive Response to Hypertonic Saline Infusion in Anephric Mice Hypertension, February 1, 2000; 35(2): 609 - 613. [Abstract] [Full Text] [PDF]

				K. M. Small, S. L. Forbes, K. M. Brown, and S. B. Liggett An Asn to Lys Polymorphism in the Third Intracellular Loop of the Human alpha 2A-Adrenergic Receptor Imparts Enhanced Agonist-promoted Gi Coupling J. Biol. Chem., December 1, 2000; 275(49): 38518 - 38523. [Abstract] [Full Text] [PDF]

				M. J. Zuscik, D. Chalothorn, D. Hellard, C. Deighan, A. McGee, C. J. Daly, D. J. J. Waugh, S. A. Ross, R. J. Gaivin, A. J. Morehead, et al. Hypotension, Autonomic Failure, and Cardiac Hypertrophy in Transgenic Mice Overexpressing the alpha 1B-Adrenergic Receptor J. Biol. Chem., April 20, 2001; 276(17): 13738 - 13743. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Makaritsis, K. P. Articles by Gavras, H. Search for Related Content PubMed PubMed Citation Articles by Makaritsis, K. P. Articles by Gavras, H. Related Collections Genetically altered mice Hypertension - basic studies