| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Hypertension. 1999;34:514-519.)
© 1999 American Heart Association, Inc.
Scientific Contributions |
Pathophysiological Roles of Endothelin-1 in Dahl Salt-Sensitive Hypertension
From the Department of Pharmacology, Tsukuba Research Institute, Banyu Pharmaceutical Co Ltd (T.I., H.O., M.O., N.K., R.N., T.K., M.N.); Cardiovascular Division, Department of Internal Medicine, Institute of Clinical Medicine, University of Tsukuba (S.M., T.M.), Ibaraki, Japan; and Department of Cardiovascular Pharmacology, Merck Research Laboratories (P.K.S.S.), West Point, Penn.
Correspondence to Masaru Nishikibe, PhD, Department of Pharmacology, Development Research Laboratories, Tsukuba Research Institute, Banyu Pharmaceutical Co Ltd, Okubo 3, Tsukuba, Ibaraki 300-2611, Japan. E-mail niskbems{at}banyu.co.jp
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract—The purpose of the present experiment was to study the pathophysiological roles of endothelin-1 (ET-1) in salt-sensitive hypertension with the use of Dahl salt-sensitive (DS) and salt-resistant (DR) rats. PreproET-1 mRNA expression was determined by reverse transcription–polymerase chain reaction. In the kidney, expression of preproET-1 mRNA was greater in DS rats on a normal salt diet compared with DR rats of the same age. In DS rats, the level of preproET-1 mRNA expression in kidney had a significant correlation with systolic blood pressure. The expression of preproET-1 mRNA in aorta and kidney was increased by 3-week high salt intake in DS rats but not in DR rats. Expression of preproET-1 mRNA and ET-1 levels in left ventricle was exaggerated by high salt intake in DS rats. However, there was no significant difference in plasma ET-1 levels between DS and DR rats regardless of salt intake. Pressor response curves for ET-1 in DS rats with or without high salt intake were significantly shifted to the left compared with those in DR rats. A single oral dose (3 to 10 mg/kg) of J-104132 (L-753 037), a potent, orally active mixed endothelin A and B (ETA/ETB) receptor antagonist, reduced blood pressure to normotensive levels in DS rats with high salt intake, and its action was maintained for
24 hours. In DS rats with
normal salt intake, J-104132 (10 mg/kg) slightly but significantly
decreased blood pressure. DR rats did not show obvious depressor
responses to J-104132 (10 mg/kg) regardless of salt intake. These
results suggest that ET-1 acts as one of the
pathophysiological factors in the development and
maintenance of salt-sensitive hypertension, and a mixed
ETA/ETB receptor antagonist could
be useful in the treatment for salt-sensitive hypertension.
Key Words: endothelin • hypertension • rats, Dahl • kidney • receptors, endothelin
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Endothelin-1 (ET-1) is known to have not only potent vasoconstrictive action but also mitogenic action on smooth muscle.1 2 With regard to salt-sensitive hypertension, Ferri et al3 recently demonstrated elevated plasma and urinary ET-1 levels in salt-sensitive hypertensive patients. Infusion of ET-1 with high salt intake but not with normal salt intake caused sustained hypertension in conscious rats.4 These results suggested that ET-1 may be involved in salt-sensitive hypertension.
Dahl salt-sensitive (DS) rats are genetically predisposed to hypertension, and an excess of dietary salt intake markedly enhances the development of hypertension in this model.5 The DS rat is therefore considered an animal model for salt-sensitive hypertension. Although the mechanism for the salt sensitivity and maintenance of hypertension with high salt ingestion in this strain has not been fully understood, abnormality in renal function is one of early changes before and during the course of hypertension.6 Similar to hypertension developed in DS rats, the salt-sensitive volume-loaded type of hypertension, such as that in deoxycorticosterone acetate (DOCA)–salt hypertensive rats, showed increased expression of preproET-1 mRNA in aorta, mesenteric artery, and kidney.7 In the kidney, ET-1 is not only a potent vasoconstrictor in renal vasculature8 but also causes mesangial cell contraction,9 which results in decreases in glomerular filtration rate and natriuresis.10 11 Therefore, the physiological actions of ET-1 are complex, and enhanced activation of this system could contribute to the renal and vascular pathophysiology of salt-sensitive hypertension.
Recently, several ET receptor antagonists demonstrated antihypertensive effects in DS rats.12 13 Although these results supported the hypothesis that ET-1 has pathophysiological roles in salt-sensitive hypertension of DS rats, there was no direct measurement of production of ET-1 in various tissues and no relationship between the level of ET-1 in various tissues and development of hypertension in DS rats.
Therefore, we sought to evaluate further the pathophysiological role of ET-1 in salt-sensitive hypertension with the use of Dahl rats. To assess the production of ET-1 in vivo, we determined the expression of preproET-1 mRNA in the aorta, heart, and kidney reverse transcription–polymerase chain reaction (PCR) and measured plasma and heart ET-1 levels in DS and Dahl salt-resistant (DR) rats with and without high-salt intake for 3 weeks. Blood pressure responses to ET-1 in Dahl rats with or without high salt intake were investigated to assess the vascular reactivity to ET-1 in vivo. Finally, the antihypertensive efficacy of a new orally active endothelin receptor antagonist, J-104132 (L-753 037), was evaluated in DS and DR rats. J-104132 is a potent mixed endothelin A and B (ETA/ETB) receptor antagonist with a long duration of activity14 and was used to determine the overall role of in vivo ET-1 in salt-sensitive hypertension by full blockade of both ET receptors.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Animals
All experimental procedures were performed according to the institutional guidelines for animal welfare. Male DS and DR rats were purchased from Seac Yoshitomi Ltd, Fukuoka, Japan. They were fed a normal pelleted animal chow (CE-2, containing 0.3% sodium, CLEA Japan Inc) ad libitum during the quarantine and acclimatization periods (at least 1 week). For salt intake, some of the rats were placed on a diet containing 8% NaCl (MF supplemented with 8% sodium chloride, Oriental Yeast Co, Ltd) for
3 weeks from 7 to 8 weeks of age. The remaining
rats were fed normal animal chow.
Determination of PreproET-1 mRNA in Aorta, Kidney, and Left
Ventricle
Systolic blood pressure was measured in DS and DR rats
with or without salt intake by a tail-cuff method (BP-98A,
Softron). The thoracic aorta, left kidney, and left ventricle
were dissected under anesthesia with an injection of sodium
pentobarbital (50 mg/kg IP), weighed, immediately frozen in liquid
nitrogen, and stored at -80°C until determination of preproET-1
mRNA. The expression of preproET-1 mRNA was analyzed by reverse
transcription–PCR according to our previous reports.15
The expressions of GAPDH mRNA for the kidney and ß-actin mRNA for the
aorta were also determined as internal controls. Total tissue RNA was
isolated by the acid guanidinium thiocyanate method with ISOGEN (Nippon
Gene Ltd). For the elimination of genomic DNA, the obtained RNA was
treated with DNaseI (TaKaRa Ltd) and was extracted again by ISOGEN. The
RNA concentration was measured spectrophotometrically at 260 nm.
Total RNA (5 µg) was reverse transcribed by the First-Strand cDNA Synthesis Kit (Life Sciences, Inc) with oligo(dT)12–18 primer according to the manufacturer's method.
The obtained cDNA was diluted in a 1:10 ratio, and 1 µL was used for PCR. Each PCR reaction contained 10 mmol/L Tris-HCl (pH 8.3), 50 mmol/L KCl, 1.5 mmol/L MgCl2, 200 µmol/L of each dNTP, 0.5 µmol/L of each gene-specific primer, and 0.025 U/µL Taq polymerase (TaKaRa Ltd). The gene-specific primers were synthesized according to the published cDNA sequences.16 17 The sequences of the oligonucleotides were as follows: preproET-1 (sense): 5'TCTTCTCTCTGCTGTTTGTG3'; preproET-1 (antisense): 5'TAGTTTTCTTCCCTCCACC3'; GAPDH (sense): 5'GCCATCAACGACCCCTTCATTG3'; and GAPDH (antisense): 5'TGCCAGTGAGCTTCCCGTTC3'.
The reaction cycles of PCR were performed in the range that demonstrates a linear correlation between the amount of cDNA and the yield of PCR products.15 The PCR products were found to be of the expected size as shown by 1.2% agarose gel electrophoresis. The PCR products were electrophoresed on 1.2% agarose gels, stained with ethidium bromide, visualized by UV transilluminator, and photographed. The photographs were scanned by a scanner (CanoScan 600, Canon Ltd). The PCR products were quantified by a computer with MacBAS software (FUJI FILM Ltd) according to our previous report.15
Determination of ET-1 Levels of Left Ventricle
The level of ET-1 in the left ventricle was determined as
described in our previous reports.15 18 The tissue samples
were identical to those that were used in the assay of preproET-1 mRNA
levels. In brief, each tissue sample was homogenized with a
Polytron homogenizer for 60 seconds in 10 volumes of 1
mol/L acetic acid that contained 10 µg/mL pepstatin (Peptide
Institute) and immediately boiled for 10 minutes. The supernatant was
stored at -80°C until use. The supernatant was subjected to a
sandwich enzyme immunoassay for ET-1. A sandwich enzyme immunoassay for
ET-1 was performed with the use of immobilized mouse
monoclonal antibody AwETN40, which recognizes the N-terminal portion of
ET-1, and peroxidase-labeled rabbit anti–ET-1 C-terminal peptide
(15–21) Fab.15 18
Determination of Plasma ET-1
The animals were anesthetized with an injection of
sodium pentobarbital (50 mg/kg IP) and were placed in the dorsal
position. The right jugular vein and the abdominal aorta (through the
left femoral artery) were cannulated with a polyurethane tube (MRE-033,
0.83 mm ODx0.35 mm ID, Micro-Renathane, Braintree
Scientific, Inc) filled with normal saline.
After direct blood pressure determination, 4 mL of venous blood was
drawn from the chronic indwelling catheter in the jugular vein, and the
blood sample was placed into an ice-chilled tube (Neotube, Nipro) that
contained EDTA-3K (3 mg/mL) and aprotinin (Trasylol, Bayer, 300 U/mL of
blood). After centrifugation (3000 rpm, 10 minutes,
4°C), the plasma was separated and stored at -40°C until ET-1
measurement.
To remove proteins from the plasma and to protect against the effects of hemolysis, 250 µL of each plasma sample and 1 mL of 95% of ethanol were mixed and centrifuged (12 000 rpm for 10 minutes at room temperature). The supernatant was separated and evaporated with ethanol by a centrifugal concentrator (VC-96N, TAITEC). The pellet was redissolved in 250 µL of assay buffer, and the concentration of ET-1 was measured by the ET-1 enzyme-linked immunosorbent assay method with commercially available kits (Biomedica Gruppe).
Pressor and Depressor Responses to Exogenous ET-1
The rats, which were fed with normal or 8% NaCl diet for 3
weeks, were anesthetized with an injection of sodium
pentobarbital (50 mg/kg IP) and were instrumented with a vascular
cannula. The cannula was inserted into the lower abdominal aorta via
the left femoral artery for the measurement of mean blood pressure. In
addition, rats were also instrumented with a venous cannula for
injection of ET-1. After surgery, the rats were returned to individual
cages and allowed free access to food and water. The next day, the
implanted arterial cannula was connected to a pressure
transducer (DX-100, Ohmeda Pte Ltd) through a cannula swivel (375,
Instech Laboratories, Inc). The signal from the pressure transducer was
amplified by a blood pressure amplifier (AP-641G, Nihon Kohden) and
recorded on a thermal array recorder (RTA-1200 mol/L, Nihon
Kohden). ET-1 (Peptide Institute) was cumulatively injected in
ascending order of dose with an interval of 0.5 to 2 hours through the
tube inserted in the vein. Bolus injection of ET-1 causes an initial
transient depressor response followed by a sustained pressor response.
Peak depressor and pressor responses were measured in each animal.
Effects of Acute ETA/ETB Receptors Blockade
on Blood Pressure
The DS and DR rats with or without 3-week salt intake had a
femoral arterial cannula implanted. After overnight
recovery, mean arterial pressure (MAP) was read from the
digital output before treatment and 15, 30, 45, 60, 75, 90, 105, 120,
150, 180, 210, 240, 300, 360, 420, and 480 minutes and 24 hours after
treatment of drugs. J-104132 (Banyu Pharmaceutical Co Ltd) was
dissolved in a small amount of 0.1N NaOH solution (adjusted to pH 7.0
to 7.4 with 0.1N HCl solution) and was then made to a target volume
with distilled water. The concentration of the drugs was adjusted to
keep the administration volume constant at 5 mL/kg.
Statistical Methods
Values are given as mean±SEM. Statistical differences
were evaluated by 1-way or repeated-measures ANOVA as appropriate, and
post hoc comparison was done with Dunnett's multiple comparison test
(for comparison with 1 control) or Tukey's multiple comparison test
(for comparison between groups). The linear correlation between
preproET-1 expression and blood pressure was ascertained by the least
squares method. P<0.05 was considered statistically
significant. ED50 was determined by the sigmoid
curve fitting to log dose-response data.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Expression of PreproET-1 mRNA in Aorta, Kidney, and Left Ventricle
Blood pressure, body weight, and tissue weight in the study animals are summarized in the Table. Ingestion of a high-salt diet increased not only blood pressure but also tissue weight in DS rats. However, these parameters were not affected by salt intake in DR rats. Systolic blood pressure of DS rats with a normal diet was slightly higher than that of DR rats with normal and high salt intake.
|
Figure 1 shows the preproET-1 mRNA levels in aorta, kidney, and left ventricle in DS and DR rats with or without 3-week high-salt intake. In aorta, preproET-1 mRNA expression was 1.4-fold greater in DS than in DR rats, but this difference did not reach statistical significance. However, with salt intake, preproET-1 mRNA was significantly greater in DS than in DR rats. The magnitude of expression of preproET-1 mRNA in the kidney was 2-fold greater in DS than in DR rats with normal salt intake. High salt intake increased expression of preproET-1 mRNA in kidney of DS but not DR rats. In left ventricle, preproET-1 mRNA levels were comparable between DS and DR rats when they were given a normal sodium diet, whereas high salt intake enhanced the expression of mRNA in DS rats but not in DR rats.
|
) and high
(
) salt intake. The magnitude of expression of preproET-1 mRNA was
expressed as the ratio of preproET-1 mRNA to ß-actin mRNA for the
aorta (A) and left ventricle (C) and to GAPDH mRNA for the kidney (B).
Each group consisted of 6 rats. a, P<0.05, significant
difference from DR rats with normal salt intake; b,
P<0.05, significant difference from DR rats with normal
salt intake and DR rats with high salt intake.A positive linear correlation existed between systolic blood pressure and the magnitude of expressed preproET-1 mRNA in kidney (r=0.831, P=0.0008) but not in aorta (r=0.4417, P=0.151) and left ventricle (r=0.396, P=0.202) in DS rats with high and normal salt intake (Figure 2). However, no such relationship was found in DR rats, except that of a weak negative linear correlation between systolic blood pressure and expression of preproET-1 mRNA in aorta (r=0.644, P=0.024).
|
) rats with or without high salt intake. A significant
linear correlation was obtained between preproET-1 mRNA and SBP in DS
rats (r=0.831, P<0.05) but not in DR
rats (r=0.276).
Plasma and Left Ventricle ET-1 Levels
There were no significant differences in plasma ET-1 levels
between groups (2.32 to 2.85 fmol/mL). ET-1 contents in left ventricle
are shown in the Table. There were no differences in ET-1 levels
between DS and DR rats with normal salt intake; however, 3-week
high-salt intake increased ET-1 levels in DS rats but not in DR rats.
This result was of the same amplitude as those shown in preproET-1 mRNA
assay in left ventricular preparation (Figure 1C),
and there was a significant correlation between ET-1 peptide levels and
preproET-1 mRNA levels (r=0.757, P<0.01).
Pressor and Depressor Responses Induced by Exogenously
Administered ET-1
The potencies of ET-1 to elicit pressor and depressor responses
were determined by generating dose-response relationships to ET-1 in DS
and DR rats with normal or high salt intake (Figure 3). The maximal pressor responses were
not different between groups, while depressor responses were
significantly greater in DS than in DR rats. When the potency of ET-1
to produce pressor responses was assessed by ED50
(dose for 50% of maximal response), which indicates the dose that
produces the response by 50% against full response, it was
significantly greater in DS (0.029 and 0.018 nmol/kg) than in DR rats
(0.089 and 0.078 nmol/kg) with normal and high salt intake,
respectively. In addition, the ET-1 potencies for both pressor (0.029
versus 0.018 nmol/kg) and depressor responses (0.266 versus 0.123
nmol/kg) were enhanced by high salt intake in DS rats. Therefore, DS
rats are more sensitive in terms of vascular reactivity to exogenous
ET-1, and the reactivity is further increased by salt
ingestion.
|
), DR rats with high salt intake (
), and DR rats with
normal salt intake (
), respectively. a, P<0.05,
significantly different from DR rats with normal salt intake; b,
P<0.05, significantly different from DR rats with
normal salt intake and DR rats with high-salt intake; c,
P<0.05, significantly different from DS and DR with
normal salt intake and from DR rats with high salt intake; and d,
P<0.05, significantly different from DR rats with high
salt intake.
MAP After Dosing of J-104132 in DS and DR Rats
High salt intake significantly increased MAP in DS rats (MAP,
164±3 mm Hg [n=37] with high salt intake versus 119±2
mm Hg [n=14] with normal salt intake), but this was not the case in
DR rats (MAP, 111±1 mm Hg [n=12] with high salt intake versus
109±2 mm Hg [n=14] with normal salt intake). With normal salt
intake, MAP in DS rats was slightly higher than that in DR rats, but
this difference was not statistically significant. A single oral
administration of J-104132 (3 and 10 mg/kg) produced significant,
dose-dependent reductions in MAP in conscious DS rats with high salt
intake (Figure 4A). The antihypertensive
effect of J-104132 was maintained for 24 hours. In DS rats with
normal salt intake, J-104132 (10 mg/kg) elicited a slight but
significant decrease in blood pressure (Figure 4B). In contrast,
DR rats showed no obvious blood pressure lowering with J-104132
regardless of salt intake (Figure 4C and 4D).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
In the present study, the expression of preproET-1 mRNA in the kidney and aorta in DS rats was increased compared with DR rats even with normal salt intake. Enhanced expression of preproET-1 mRNA in both tissues was further increased by 3-week high salt intake. In addition, mRNA of preproET-1 and ET-1 levels in heart was increased by high salt intake in DS rats but not in DR rats. Blood pressure had a linear correlation with the magnitude of expression of preproET-1 mRNA in the kidney but not in either the aorta or the left ventricle in DS rats. The pressor responses to exogenous ET-1 were exaggerated in DS rats compared with DR rats regardless of salt intake. A mixed ETA/ETB receptor antagonist, J-104132, significantly reduced blood pressure in DS rats but not in DR rats.
The salt-sensitive hypertension in DS rats may originate, at least in part, from renal dysfunction.6 The pressure-natriuresis relationship is blunted before the development of hypertension in DS rats and is worsened by salt intake, which is a mechanism that could contribute to high salt sensitivity and consequent salt-sensitive hypertension.19 In the present study, the magnitude of expression of preproET-1 mRNA was greater in the kidney of DS than in DR rats with normal salt intake and increased further in DS with high salt intake. The increasing preproET-1 mRNA was linearly correlated with an increase in blood pressure levels. These results indicate that the production of ET-1 in the kidney of DS rats was already increased by normal salt intake and was augmented further by high salt intake, which was accompanied by increases in blood pressure. However, spontaneously hypertensive rats with or without high salt intake did not increase preproET-1 mRNA in kidney.20 Expression of preproET-1 mRNA levels significantly correlated with peptide levels in the present study. These results suggest that the augmented ET system in the kidney might contribute to renal abnormality in DS rats. It has been recently reported that renal interstitial infusion of the ETA/ETB receptor antagonist SB 209670 significantly increased urinary sodium excretion in DS rats with high salt intake but not in DR rats,21 and the ETA selective antagonist A-127722 partially corrected the attenuated pressure natriuresis in DS rats.22 These findings suggest that ET-1 is one of the important factors that participates in mechanisms that underlie blunted pressure natriuresis in DS rats.
ET-1 is not only a potent vasoconstrictor but a potent mitogen for vascular smooth muscle cells, cardiac myocytes, and glomerular mesangial cells.1 2 In the present study, tissue weights of left ventricle, aorta, and kidney, in which the expression of preproET-1 mRNA was enhanced by high salt intake in DS rats, were significantly greater than those in other groups. ET-1–induced hypertrophy and/or proliferation may partly contribute to the increases in tissue weights, although contribution of other factors, such as norepinephrine and mechanical stress caused by high blood pressure, cannot be excluded in this study.
Exogenous ET-1 caused an initial transient decrease followed by a sustained increase in blood pressure in rats. Although the pattern of cardiovascular responses was not altered in DS rats with or without high salt intake, the pressor response to ET-1 mediated by ETA/ETB receptors was exaggerated in DS rats regardless of high salt intake. This result indicates that the vascular reactivity to ET-1 in DS rats was exaggerated compared with that in DR rats regardless of salt intake. Goligorsky et al23 reported that glomerular mesangial cells and vascular smooth muscle cells obtained from prehypertensive DS rats exhibited an exaggerated intracellular calcium response to ET-1 and enhanced contraction of vascular rings in DS rats. However, it has been reported that after establishment of hypertension, vascular reactivities to ET-1 are attenuated in DS rat mesenteric artery, which suggests downregulation of ET-1 receptor.12 However, the cardiovascular effects of ET-1 in DS rats have not been tested. It has been reported that responses to norepinephrine are increased markedly after 1 to 3 weeks of high-salt diet in DS rats and that the enhanced responses to norepinephrine are reversed after 6 weeks of a high-salt diet.24 The activation of the sympathetic nervous system has been demonstrated in DS rats. Thus, the present results may indicate that both production of and receptor sensitivity to ET-1 were enhanced after 3 weeks of high salt intake in DS rats. The maximal depressor responses to ET-1 were enhanced without changing the sensitivity in DS rats with or without high salt intake. Although these enhanced responses may be due to high baseline blood pressure in DS rats, enhanced vasodilatory mechanisms through activation of ETB receptor in endothelial cells or compensatory dilatory mechanisms cannot be ruled out in the present study.
In DS rats, preproET-1 mRNA in the aorta and kidney before salt intake (without hypertension) was 1.4-fold and 2-fold greater than in DR rats, respectively. Furthermore, the pressor response to ET-1 in DS rats without salt intake was significantly enhanced compared with that in DR rats. However, there was no significant difference in plasma ET-1 levels between DS and DR rats. On the basis of these results, it is likely that a mechanism for salt-sensitive hypertension in DS rats might be due to local activation of the ET-1 system in tissues.
J-104132 produced long-lasting antihypertensive effects in hypertensive DS rats, which has been reported with other endothelin receptor antagonists.12 13 21 22 ET receptor antagonists are also effective as antihypertensive agents in other salt-sensitive hypertensive models, such as the DOCA-salt rat.25 26 ET-1 content in the aorta, mesenteric vascular bed, and kidney was also increased dramatically in DOCA-salt hypertensive rats.7 27 Furthermore, infusion of ET-1 at a dose that caused no hypertension in rats fed a normal salt diet produced hypertension in rats fed a high-salt diet.4 These results strongly support the theory that ET-1 contributes to the development and maintenance of salt-dependent hypertension.
In conclusion, results from the present experiment indicate that the enhanced activity of the ET system is apparent in DS rats with high salt intake, as follows: (1) greater expression of preproET-1 mRNA in tissues, (2) enhanced sensitivity to pressor responses by ET-1, and (3) full antihypertensive efficacy when both ETA and ETB receptors are inhibited by J-104132. These results suggest that ET-1 is an important pathophysiological factor in the development and maintenance of salt-sensitive hypertension and that blockade of ETA/ETB receptors could have clinical benefit for treatment of salt-sensitive hypertension.
Received February 22, 1999; first decision March 22, 1999; accepted May 3, 1999.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Yanagisawa M, Kurihara M, Kimura S, Tomobe Y, Kobayashi M, Mitsui Y, Yazaki Y, Goto K, Masaki T. A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature. 1988;332:411–415.[Medline] [Order article via Infotrieve]
2. Highsmith RF, ed. Endothelin Molecular Biology, Physiology, and Pathology. Totowa, NJ: Human Press; 1998.
3. Ferri C, Bellini C, Desideri G, Mazzocchi C, De Siati L, Santucci A. Elevated plasma and urinary endothelin-1 levels in human salt-sensitive hypertension. Clin Sci. 1997;93:35–41.[Medline] [Order article via Infotrieve]
4.
Mortensen LH, Fink GD. Salt-dependency of
endothelin-induced, chronic hypertension in conscious rats.
Hypertension. 1992;19:549–554.
5. Dahl LK, Heine M, Tassinari L. Effects of chronic salt ingestion: evidence that genetic factors play an important role in susceptibility to experimental hypertension. J Exp Med. 1962;115:1173–1190.[Abstract]
6.
Dahl LK, Heine M. Primary role of renal homografts in
setting chronic blood pressure levels in rats. Circ Res. 1975;36:692–696.
7. Deng LY, Day R, Schiffrin EL. Localization of sites of enhanced expression of endothelin-1 in the kidney of DOCA-salt hypertensive rats. J Am Soc Nephrol. 1996;7:1158–1164.[Abstract]
8. Madeddu P, Troffa C, Glorioso N, Pazzola A, Soro A, Manunta P, Tonolo G, Demontis MP, Varoni MV, Anania V. Effect of endothelin on regional hemodynamics and renal function in awake normotensive rats. J Cardiovasc Pharmacol. 1989;14:818–825.[Medline] [Order article via Infotrieve]
9. Badr KF, Murray JJ, Breyer MD, Takahashi K, Inagami T, Harris RC. Mesangial cell, glomerular and renal vascular responses to endothelin in the rat kidney. J Clin Invest. 1989;83:336–342.
10.
Goets KL, Wang BC, Madwed JB, Zhu JL, Leadley RJ Jr.
Cardiovascular, renal, and endocrine responses to
intravenous endothelin in conscious dogs. Am J
Physiol. 1988;255:R1064–R1068.
11.
Clavell AL, Stingo AJ, Margulies KB, Brandt RR, Burnett
JC Jr. Role of endothelin receptor subtypes in the in vivo regulation
of renal function. Am J Physiol. 1995;268:F455–F460.
12. Barton M, d'Uscio LV, Shaw S, Meyer P, Moreau P, Lüsher TF. ETA receptor blockade prevents increased tissue endothelin-1, vascular hypertrophy, and endothelial dysfunction in salt-sensitive hypertension. Hypertension. 1998;31(pt 2):499–504.
13. Doucet J, Gonzalez W, Michel JB. Endothelin antagonists in salt-dependent hypertension associated with renal insufficiency. J Cardiovasc Pharmacol. 1996;27:643–651.[Medline] [Order article via Infotrieve]
14.
Nishikibe M, Ohta H, Okada M, Ishikawa K, Hayama T,
Fukuroda T, Saito M, Kanoh T, Ozaki S, Kamei T, Hara K, William D,
Kivlighn S, Krause S, Gabel R, Zingaro G, Nolan N, O'Brien J, Clayton
F, Lynch J, Pettibone D, Siegl P. Pharmacological properties of
J-104132 (L753,037), a potent, orally active, mixed
ETA/ETB endothelin receptor
antagonist. J Pharmacol Exp Ther.. 1999;289:1262–1270.
15. Maeda S, Miyauchi T, Sakai S, Kobayashi T, Iemitsu M, Goto K, Sugishita Y, Matsuda M. Prolonged exercise causes an increase in endothelin-1 production in the heart in rats. Am J Physiol. 1998;268:F455–F460.
16. Sakurai T, Yanagisawa M, Inoue A, Ruan US, Kimura S, Mitsui Y, Goto K, Masaki T. cDNA cloning, sequence analysis and tissue distribution of rat preproendothelin-1 mRNA. Biochem Biophys Res Commun. 1991;77:165–172.
17.
Tso JY, Sun XH, Kao TH, Reece KS, Wu R. Isolation and
characterization of rat and human
glyceraldehyde-3-phosphate dehydrogenase cDNA: genomic
complexity and molecular evolution of the gene. Nucleic Acids
Res. 1985;13:2485–2502.
18. Sakai S, Miyauchi T, Kobayashi M, Yamaguchi I, Goto K, Sugishita Y. Inhibition of myocardial endothelin pathway improves long-term survival in heart failure. Nature. 1996;384:353–355.[Medline] [Order article via Infotrieve]
19. Roman RJ. Abnormal renal hemodynamics and pressure-natriuresis relationship in Dahl salt-sensitive rats. Am J Physiol. 1986;251:F57–F65.
20. Feron O, Salomone S, Godfraind T. Influence of salt loading on the cardiac and renal preproendothelin-1 mRNA expression in stroke-prone spontaneously hypertensive rats. Biochem Biophys Res Commun. 1995;209:161–166.[Medline] [Order article via Infotrieve]
21. Kassab S, Novak J, Miller T, Kirchner K, Granger J. Role of endothelin in mediating the attenuated renal hemodynamics in Dahl salt-sensitive hypertension. Hypertension. 1997;30(pt 2):682–686.
22. Kassab S, Miller T, Novak J, Reckelhoff J, Clower B, Granger JP. Endothelin-A receptor antagonism attenuates the hypertension and renal injury in Dahl salt-sensitive rats. Hypertension. 1998;31(pt 2):397–402.
23. Goligorsky MS, Iijima K, Morgan M, Yanagisawa M, Masaki T, Lin L, Nasjletti A, Kaskel F, Frazer M. Role of endothelin in the development of Dahl hypertension. J Cardiovasc Pharmacol. 1991;17(suppl 7):S484–S491.
24.
Kong J-Q, Taylor D, Fleming WW. Sustained hypertension
in Dahl rats: negative correlation of agonist response to blood
pressure. Hypertension. 1995;25:139–145.
25. Fujita K, Matsumura Y, Kita S, Miyazaki Y, Hisaki K, Takaoka M, Morimoto S. Role of endothelin-1 and the ETA receptor in the maintenance of deoxycorticosterone acetate-salt-induced hypertension. Br J Pharmacol. 1995;114:925–930.[Medline] [Order article via Infotrieve]
26. Fujita K, Matsumura Y, Miyazaki Y, Hashimoto N, Takaoka M, Morimoto S. ETA receptor-mediated role of endothelin in the kidney of DOCA-salt hypertensive rats. Life Sci. 1996;58:PL1–PL7.[Medline] [Order article via Infotrieve]
27.
Larivière R, Thibault G, Schiffrin EL. Increased
endothelin-1 content in blood vessels of deoxycorticosterone
acetate–salt hypertensive but not in spontaneously hypertensive rats.
Hypertension. 1993;21:294–300.
This article has been cited by other articles:
 |
|
 |
|
  M. P. Schneider, E. W. Inscho, and D. M. Pollock Attenuated vasoconstrictor responses to endothelin in afferent arterioles during a high-salt diet Am J Physiol Renal Physiol, April 1, 2007; 292(4): F1208 - F1214. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Quaschning, F. Voss, K. Relle, P. Kalk, N. Vignon-Zellweger, T. Pfab, C. Bauer, F. Theilig, S. Bachmann, A. Kraemer-Guth, et al. Lack of Endothelial Nitric Oxide Synthase Promotes Endothelin-Induced Hypertension: Lessons from Endothelin-1 Transgenic/Endothelial Nitric Oxide Synthase Knockout Mice J. Am. Soc. Nephrol., March 1, 2007; 18(3): 730 - 740. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Chansel, M. Ciroldi, S. Vandermeersch, L. F Jackson, A.-M. Gomez, D. Henrion, D. C. Lee, T. M. Coffman, S. Richard, J.-C. Dussaule, et al. Heparin binding EGF is necessary for vasospastic response to endothelin FASEB J, September 1, 2006; 20(11): 1936 - 1938. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. D'Angelo, J. S. Pollock, and D. M. Pollock In vivo evidence for endothelin-1-mediated attenuation of {alpha}1-adrenergic stimulation Am J Physiol Heart Circ Physiol, March 1, 2006; 290(3): H1251 - H1258. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. L. M. Herrera, L. R. B. Ponce, P. D. Bagamasbad, B. D. VanPelt, T. Didishvili, and N. Ruiz-Opazo Embryonic lethality in Dear gene-deficient mice: new player in angiogenesis Physiol Genomics, November 17, 2005; 23(3): 257 - 268. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. P. del Villar, C. J. G. Alonso, C. A. Feldstein, L. A. Juncos, and J. C. Romero Role of Endothelin in the Pathogenesis of Hypertension Mayo Clin. Proc., January 1, 2005; 80(1): 84 - 96. [Abstract] [PDF]
|
|
|
|
|
|
R. A. Fenton, C.-L. Chou, S. Ageloff, W. Brandt, J. B. Stokes, and M. A. Knepper Increased collecting duct urea transporter expression in Dahl salt-sensitive rats Am J Physiol Renal Physiol, July 1, 2003; 285(1): F143 - F151. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. R. Ballew, S. W. Watts, and G. D. Fink Effects of Salt Intake and Angiotensin II on Vascular Reactivity to Endothelin-1 J. Pharmacol. Exp. Ther., April 13, 2001; 296(2): 345 - 350. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||