Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 2000;35:193-201

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Muller, D. N.
Right arrow Articles by Luft, F. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Muller, D. N.
Right arrow Articles by Luft, F. C.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Vasculitis
Related Collections
Right arrow Cardio-renal physiology/pathophysiology
Right arrow ACE/Angiotension receptors
Right arrow Pathophysiology
Right arrow Other hypertension
Right arrow Hypertension - basic studies
Right arrow Hypertrophy
Right arrow Other Treatment

(Hypertension. 2000;35:193.)
© 2000 American Heart Association, Inc.


Scientific Contributions

NF-{kappa}B Inhibition Ameliorates Angiotensin II–Induced Inflammatory Damage in Rats

Dominik N. Muller; Ralf Dechend; Eero M. A. Mervaala; Joon-Keun Park; Folke Schmidt; Anette Fiebeler; Jürgen Theuer; Volker Breu; Detlev Ganten; Hermann Haller; Friedrich C. Luft

From the Franz Volhard Clinic, Medical Faculty of the Charité, Berlin, Germany (D.N.M., R.D., J.-K.P., F.S., A.F., J.T., H.H., F.C.L.); Humboldt University of Berlin, Germany; Institute of Biomedicine, University of Helsinki, Finland (E.M.A.M.); Max Delbrück Center for Molecular Medicine, Berlin, Germany (D.G.); and F. Hoffmann-La Roche, Basel, Switzerland (V.B.). Dominik Müller, Ralf Dechend, and Eero Mervaala contributed equally to this work.

Correspondence to Friedrich C. Luft, Franz Volhard Clinic, Wiltberg Strasse 50, 13125 Berlin, Germany. E-mail luft{at}fvk-berlin.de


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowNF-{kappa}B Plays a Central...
down arrowReferences
 
Abstract—We recently reported that the activation of nuclear factor-{kappa}B (NF-{kappa}B) promotes inflammation in rats harboring both human renin and angiotensinogen genes (double-transgenic rats [dTGR]). We tested the hypothesis that the antioxidant pyrrolidine dithiocarbamate (PDTC) inhibits NF-{kappa}B and ameliorates renal and cardiac end-organ damage. dTGR feature hypertension, severe renal and cardiac damage, and a 40% mortality rate at 7 weeks. Electrophoretic mobility shift assay showed increased NF-{kappa}B DNA binding activity in hearts and kidneys of dTGR. Chronic PDTC (200 mg/kg SC) treatment decreased blood pressure (162±8 versus 190±7 mm Hg; P=0.02) in dTGR compared with dTGR controls. The cardiac hypertrophy index was also significantly reduced (4.90±0.1 versus 5.77±0.1 mg/g; P<0.001). PDTC reduced 24-hour albuminuria by >95% (2.5±0.8 versus 57.1±8.7 mg/d; P<0.001) and prevented death. Vascular injury was ameliorated in small renal and cardiac vessels. Electrophoretic mobility shift assay showed that PDTC inhibited NF-{kappa}B binding activity in heart and kidney, whereas AP-1 activity in the kidney was not decreased. dTGR exhibited increased left ventricular c-fos and c-jun mRNA expression. PDTC treatment reduced c-fos but not c-jun mRNA. Immunohistochemistry showed increased p65 NF-{kappa}B subunit expression in the endothelium and smooth muscle cells of damaged small vessels, as well as infiltrating cells in glomeruli, tubules, and collecting ducts of dTGR. PDTC markedly reduced the immunoreactivity of p65. PDTC also prevented the NF-{kappa}B–dependent transactivation of the intercellular adhesion molecule ICAM-1 and inducible nitric oxide synthase. Monocyte infiltration was markedly increased in dTGR kidneys and hearts. Chronic treatment reduced monocyte/macrophage infiltration by 72% and 64%, respectively. Thus, these results demonstrate that PDTC inhibits NF-{kappa}B activity, ameliorates inflammation, and protects against angiotensin II-induced end-organ damage.


Key Words: proteins • angiotensin II • inflammatory response • nitric oxide synthase • cell adhesion molecules • proto-oncogenes


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowNF-{kappa}B Plays a Central...
down arrowReferences
 
Hypertension is a major risk factor for renal and cardiac damage; however, the mechanisms are incompletely understood. Angiotensin (Ang) II, the key effector of the local and circulating renin-angiotensin system (RAS), plays a central role.1 2 In addition to its vasoactive and growth-promoting action, Ang II stimulates circulating leukocytes and endothelial cells, thereby promoting inflammation and interstitial extracellular matrix accumulation.3 4 5 6 7 Many inflammation-mediating genes are activated by the transcription factor NF-{kappa}B (nuclear factor-{kappa}B), which resides inactive and bound to the inhibitory protein I-{kappa}B in the cytoplasm of T lymphocytes, monocytes, macrophages, endothelial cells, and smooth muscle cells.8 9 Ang II stimulates NADPH oxidase, which generates reactive oxygen species (ROS).10 ROS may act as signal transduction messengers for several important transcription factors, including NF-{kappa}B and AP-1 (activator protein-1).11 Recently, Ozes et al12 showed that Akt/protein kinase B (Akt) is essential in tumor necrosis factor-{alpha} (TNF-{alpha})–induced activation of NF-{kappa}B. Takahashi et al,13 as well as Ushio-Fukai et al,14 have demonstrated Akt activation by Ang II, which may involve ROS. Activation of Akt NF-{kappa}B activates numerous genes, including interleukin (IL)-1, IL-6, IL-8, interferon-{gamma}, TNF-{alpha}, intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1), and the chemokine MCP-1 (monocyte chemoattractant protein-1). Several reports15 16 17 indicated that angiotensin converting enzyme (ACE) inhibition decreased NF-{kappa}B in renal disease.

In vitro and in vivo studies showed that pyrrolidine dithiocarbamate (PDTC) was a potent inhibitor of NF-{kappa}B but that it had no effect on AP-1, CREB (cAMP response element–binding protein), specificity protein (Sp-1), or octamer-binding proteins.18 19 The precise mechanism for the biological effects of PDTC is still controversial. Several studies have reported that metal-chelating, thiol-modifying, and oxygen radical–scavenging antioxidative properties mediate the inhibition of NF-{kappa}B.19 However, in some biological systems, PDTC has been shown to exert pro-oxidative effects.20 21 This could mean that the inhibitory effect of redox-active substances is related to reductive as well as oxidative processes, most likely depending on the step in the signaling cascade with which they interfere. Other transcription factors, such as AP-1, are influenced by the redox status of the cell. AP-1 DNA binding is regulated by the redox modification of the c-jun and c-fos DNA binding domain.22 Cell culture studies have shown that PDTC induces AP-1 activity. These data suggest that AP-1 may function as an antioxidant responsive element.23 We recently observed that rats harboring both human renin and angiotensinogen genes (double-transgenic rats [dTGR]) develop severe renal and cardiac damage, accompanied by increased NF-{kappa}B DNA binding activity, MCP-1 production, adhesion molecule expression, and inflammation, and that these rats die by 7 weeks of age.24 25 We investigated the hypothesis that PDTC inhibition of NF-{kappa}B prevents inflammation and ameliorates cardiac and renal damage.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowNF-{kappa}B Plays a Central...
down arrowReferences
 
Study Design
Experiments were conducted in 4-week-old male dTGR and age-matched Sprague-Dawley (SD) rats. The dTGR line and characteristics are described elsewhere.25 26 The rats were purchased from RCC (Füllinsdorf, Switzerland), kept in rooms at 24±2°C, fed a standard rat diet containing 0.2% sodium by weight, and allowed free access to tap water. All procedures were done according to guidelines from the American Physiological Society and were approved by local authorities (permit No. G 408/97). Fifteen dTGR received PDTC (Sigma) for 3 weeks once a day (200 mg/kg SC),27 28 whereas 15 dTGR and 15 SD rats received vehicle (0.9% NaCl). Systolic blood pressure was measured weekly by tail-cuff plethysmography under light ether anesthesia 20 hours after the last drug dose was administered. Urine samples were collected over a 24-hour period. Urinary rat albumin was measured with a commercially available ELISA (Celltrend). Rats were killed at 7 weeks of age. The kidneys and hearts were washed with ice-cold saline, blotted dry, and weighed. For electrophoretic mobility shift assay (EMSA) of NF-{kappa}B and AP-1 and for mRNA expression studies, the tissues were snap-frozen in liquid nitrogen (for immunohistochemistry, in isopentane [-35°C]), and stored at -80°C.

Immunohistochemistry
Frozen kidneys and hearts were cryosectioned at 6 µm thickness and air dried as described previously.25 29 The sections were fixed with cold acetone, washed with TBS, and incubated for 60 minutes in a humid chamber at room temperature with primary monoclonal antibodies against rat monocytes/macrophages (ED-1, Serotec), NF-{kappa}B subunit p65 (Roche Boehringer), ICAM-1 (1A29, R&D Systems), and polyclonal inducible NO synthase (iNOS/NOS2) (ABR). After they were washed with TBS, the sections were incubated with a bridging antibody (rabbit anti-mouse IgG; Dako) for 30 minutes at room temperature and washed again with TBS. The APAAP complex (Dako) was applied, and the sections were incubated for 30 minutes at room temperature. Immunoreactivity was visualized by development in a mixture of naphthol AS-BI phosphate (Sigma) with Neufuchsin (Merck). Endogenous alkaline phosphatase was blocked by addition of 10 mmol/L levamisole (Sigma) to the substrate solution. The sections were slightly counterstained in Mayer’s hemalum (Merck), blued in tap water, and mounted with GelTol (Coulter-Immunotech). Immunostaining was performed as described previously.30 Semiquantitative scoring of ED-1–positive cells was performed by a computerized cell-counting program (KS 300 3.0, Zeiss). Fifteen different areas of each heart and kidney samples (n=5 in all groups) were analyzed. The samples were examined without knowledge of the identity of the rats.

Electrophoretic Mobility Shift Assay
Tissue extracts and EMSA for the transcription factor NF-{kappa}B were performed as described previously.31 32 Briefly, frozen whole kidneys were pulverized in liquid nitrogen with mortar and pestle and resuspended in 3 mL of 50 mmol/L Tris (pH 7.4) containing a complete inhibitor tablet (Roche Boehringer) and 1 mmol/L Na-ortho-vanadate (Sigma Chemie). The suspension was centrifuged (4000g, 4 minutes, 4°C). The pellet was resuspended and lysed for 30 minutes in whole-cell lysate buffer (20 mmol/L HEPES, pH 7.9, 350 mmol/L NaCl, 20% glycerol, 1 mmol/L MgCl2, 0.5 mmol/L EDTA, 0.1 mmol/L EGTA, and 1% NP-40) and again centrifuged (13 000g, 10 minutes, 4°C). The supernatant was divided into aliquots and frozen in liquid nitrogen at -80°C until use. The protein concentration for EMSA and Western blot was quantified by the Bradford method. For EMSA, total renal homogenates (50 µg) were incubated in binding reaction medium (2 µg of poly dI-dC, 1 µg of BSA, 1 mmol/L DTT, 20 mmol/L HEPES, pH 8.4, 60 mmol/L KCl, and 8% Ficoll) with 0.5 ng of 32P-dATP end-labeled oligonucleotide containing the NF-{kappa}B binding site from the major histocompatibility complex (MHC) enhancer (H2K, 5'-gatcCAGGGCTGGGGATTC-CCCATCTCCACAGG) at 30°C for 30 minutes. In competition assays, 50 or 100 ng of unlabeled H2K oligonucleotides were used. For supershift assay, 1 µg of anti-p50, anti-p65, anti-Rel B, and anti-c-Rel was added for 20 minutes to the homogenates before addition of the labeled probe. For AP-1, double-stranded oligonucleotides containing the consensus sequence for AP-1 (Santa Cruz, 5'-GAT CGA ACT GAC CGC CCG CCG CCC GT-3') were radiolabeled with g-32P with the use of T4 polynucleotide kinase by standard methods and purified over a column. The DNA-protein complexes were analyzed on a 5% polyacrylamide gel 0.5% Tris buffer, dried, and autoradiographed. In competition assays, 50 ng of unlabeled H2K or AP-1 oligonucleotides were used.

Isolation of mRNA and Gene Expression
RNA was isolated according to the Trizol protocol (Gibco-Life Technology). Reverse transcription–polymerase chain reaction (RT-PCR) primers and TaqMan probe for GAPDH, c-fos, and c-jun were constructed with the help of Primer Express (ABI Prism 7700, Perkin-Elmer) as follows: GAPDH forward, AAGCTGGTCATCAATGGGAAAC; GAPDH reverse, ACCCCATTTGATGTTAGCGG; GAPDH probe CATCACCATCTTCCAGGAGCGCGCGAT, FAM (6-carboxytetrafluorescein), and TAMRA (quencher) labeled; c-jun forward, TGAAAGCGCAAAACTCCGA; c-jun reverse, TGTGCCACCTGTTCCCTGA; c-jun probe FAM-CTGGCGTCCACGGCCAACATG-TAMRA; c-fos forward, CCATGATGTTCTCGGGTTTCA; c-fos reverse, GCGCTACTGCAGCGGG; c-fos probe FAM-CGCGGACTACGAGGCGTCA-TCC-TAMRA. Oligonucleotides were synthesized by BioTez. Manganese and primer concentrations were optimized with a titration curve. GAPDH Mn 3 mmol/L; c-jun 4 mmol/L; c-fos 4 mmol/L; GAPDH and c-jun: primer forward 300 nmol/L, primer reverse 300 nmol/L, probe 100 nmol/L; c-fos primer 200 nmol/L, probe 100 nmol/L. Real-time quantitative RT-PCR was performed with the TaqMan system (ABI Prism 7700, Perkin-Elmer) and according to the instructions of the TaqMan EZ RT-PCR TaqMan-kit protocol. RNA (0.5 to 1 µg total) was used for each PCR with the following time course: 50°C, 2 minutes; 60°C, 30 minutes; 95°C, 5 minutes; and 40 cycles of 94°C, 20 seconds, and 60°C, 1 minute. Each sample was tested in doublets. For quantification, gene expression of the target sequence was normalized in relation to the expressed housekeeping gene GAPDH.

Statistical Analysis
Data are presented as mean±SEM. Statistically significant differences in mean values were tested by ANOVA and the Tukey multiple range test. A value of P<0.05 was considered statistically significant. The data were analyzed with SYSTAT statistical software.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowNF-{kappa}B Plays a Central...
down arrowReferences
 
dTGR featured hypertension, severe renal damage, and cardiac hypertrophy with focal necrosis. Six (40%) of 15 untreated dTGR died before the end of the study at 7 weeks. None of the PDTC-treated dTGR and nontransgenic SD rats died before the end of the study (P<0.05). Small vessels showed increased intimal and medial thickness, as well as hyaline deposits. The renal tubules were frequently swollen and filled with proteinaceous material. Chronic treatment with PDTC prevented vascular injury in small renal vessels and extracellular matrix formation.

dTGR showed a progressive increase in systolic blood pressure from 5 to 7 weeks. PDTC ameliorated the increase in systolic blood pressure in dTGR (162±8 versus 190±7 mm Hg). However, PDTC-treated dTGR showed elevated blood pressure compared with nontransgenic SD rats (162±8 versus 107±2 mm Hg; P<0.001; n=8 to 15; Figure 1A). PDTC partially prevented the development of cardiac hypertrophy (Figure 1B). We found only a weak correlation between the reduction of blood pressure and attenuation of cardiac hypertrophy after PDTC treatment (r=0.46). Albuminuria (measured over 24 hours) progressively increased in untreated dTGR from 5 to 7 weeks. PDTC diminished but did not eliminate albuminuria in dTGR (2.5±0.8 versus 57.1±8.7 versus 0.3±0.1 mg/d at week 7; P<0.001; n=8 to 12; Figure 1C). Relative kidney weight was significantly higher in dTGR than in PDTC-treated rats and SD rats (4.9±0.1 versus 4.0±0.1 versus 3.7±0.1 mg/g body weight at week 7; P<0.001; n=8 to 15).



View larger version (38K):
[in this window]
[in a new window]
 
Figure 1. A, Systolic blood pressure in dTGR, dTGR treated with PDTC, and SD rats. Blood pressure of PDTC-treated rats was significantly decreased compared with untreated dTGR but significantly higher than in SD controls. Treatment with PDTC attenuated the development of cardiac hypertrophy (B). Twenty-four-hour albuminuria was ameliorated by PDTC, but PDTC did not eliminate the development of albuminuria in dTGR (C). Results are expressed as mean±SEM of 8 to 12 animals per group. Semiquantitative scoring of ED-1–positive monocytic cells in the kidney and heart was performed by use of a computerized cell-counting program (D). Fifteen different areas of each kidney and heart were analyzed. Results are expressed as mean±SEM of 5 animals per group. *P<0.001.

First, we analyzed the effects of PDTC on monocytes/macrophages. There was significant infiltration in renal and cardiac tissue of dTGR. Monocytes/macrophages were localized primarily in the perivascular space in the heart and around the renal tubules but not in the glomeruli (data not shown). Treatment with PDTC prevented cell infiltration almost completely in both tissues. Semiquantitative cell-count analysis confirmed the significant reduction of monocyte/macrophage infiltration in the kidney and heart after PDTC treatment (P<0.001; Figure 1D). ICAM-1 expression in the kidney was increased in the intima, adventitia, and the perivascular space of the small vessels in untreated dTGR. Glomeruli and tubules also showed increased ICAM-1 expression. Expression of ICAM-1 was markedly reduced by treatment with PDTC and was similar to the constitutive ICAM-1 expression in control animals at week 7 (Figure 2, A through C). These results demonstrate that PDTC treatment reduced mononuclear cell infiltration and inhibited the expression of adhesion molecules.



View larger version (152K):
[in this window]
[in a new window]
 
Figure 2. Representative immunohistochemical photomicrographs of ICAM-1 in the kidney of dTGR (A), PDTC-treated dTGR (B), and SD rats (C). Expression of ICAM-1 was increased in the intima, adventitia, and perivascular space of the small dTGR vessels. Glomeruli and tubuli showed frequently increased ICAM-1 expression. Stimulation of ICAM-1 was markedly reduced by PDTC. D through F, Representative immunohistochemical photomicrographs of iNOS in the kidney. iNOS expression was increased in glomeruli and the vessel wall of dTGR. PDTC reduced iNOS expression. Magnification level was 40x.

Next, we investigated the effects of PDTC on iNOS expression. We observed a strong increase in iNOS expression in the glomeruli in the vessel walls of renal arterioles (Figure 2, D through F). Treatment with PDTC greatly reduced iNOS immunoreactivity both in the blood vessels and in the glomeruli. Furthermore, we investigated the activation of the transcription factors NF-{kappa}B and AP-1, which are main regulators of ICAM-1 and iNOS gene expression. Immunohistochemistry (phase contrast resolution) shows the localization of the NF-{kappa}B subunit p65 in a cardiac vessel. Expression of p65 was increased in the endothelium and smooth muscle cells (Figure 3A), as well as in the vessel wall, infiltrated cells, glomeruli, and tubules (data not shown) of dTGR kidneys. PDTC markedly reduced p65 expression (Figure 3B). No immunoreaction was observed in nontransgenic SD rats (Figure 3C). The antibody recognizes an epitope overlapping the nuclear location signal of the p65 subunit and therefore selectively stains released, activated NF-{kappa}B after dissociation from its inhibitor, I-{kappa}B{alpha}.33 We used EMSA for the detection of NF-{kappa}B DNA binding activity in the kidney (Figure 4A) and heart (Figure 4D). NF-{kappa}B DNA binding activity in the kidney was markedly reduced by PDTC treatment and even more so in the heart. Each lane in Figure 4 represents a separate animal. Renal homogenates were incubated with antibodies against the NF-{kappa}B subunits anti-p50, anti-p65, anti-c-Rel, and anti-Rel B (Figure 4B). Binding specificity was demonstrated by competition of excess unlabeled oligonucleotides containing the kB site from the MHC enhancer (H2K) (Figure C). AP-1 activity was increased in dTGR kidneys compared with SD (Figure 5A). However, PDTC treatment did not reduce AP-1 binding activity. Binding specificity was demonstrated by competition of excess unlabeled oligonucleotides containing the AP-1 site (Figure 5B). Semiquantitative RT-PCR (TaqMan analysis) showed significantly increased c-jun and c-fos mRNA expression in the left ventricle of dTGR hearts (Figure 5, C through D). Chronic treatment with PDTC reduced c-fos but not c-jun mRNA (Figure 5, C through D).



View larger version (95K):
[in this window]
[in a new window]
 
Figure 3. Immunohistochemical analysis of the p65 subunit of NF-{kappa}B in the heart of dTGR shows increased expression in endothelial cells and smooth muscles cells in the vessel wall, which was partially reduced by PDTC. Some of the immunostaining might represent leukocytes infiltrating the vascular tissue. Magnification level was 100x.



View larger version (73K):
[in this window]
[in a new window]
 
Figure 4. Effects of PDTC on the activation of DNA binding nuclear factors in the kidney (A) and heart (D). EMSA for the detection of NF-{kappa}B shows a higher binding activity of dTGR kidney and heart homogenates than in SD rats. NF-{kappa}B DNA binding activity in the kidney was markedly reduced by PDTC treatment and even more so in the heart. Each lane represents a separate animal. Renal homogenates were incubated with antibodies against the NF-{kappa}B subunits anti-p50, anti-p65, anti-c-Rel, and anti-Rel B (B). Specificity of binding (C) was demonstrated by competition of excess unlabeled oligonucleotides containing the {kappa}B site from the MHC enhancer (H2K). EMSA was performed 3 times independently with similar results.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 5. Effects of PDTC on the DNA binding activity of AP-1 in the kidney (A). EMSA for the detection of AP-1 shows a higher binding activity of dTGR kidney homogenates than in SD rats. However, PDTC treatment did not reduce AP-1 DNA binding activity. Binding specificity was demonstrated by competition of excess unlabeled oligonucleotides containing the AP-1 site (B). Each lane represents a separate animal. TaqMan analysis showed significantly increased c-jun (C) and c-fos (D) mRNA expression in the left ventricle of dTGR hearts. Chronic treatment with PDTC reduced c-fos but not c-jun mRNA.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowNF-{kappa}B Plays a Central...
down arrowReferences
 
We tested the hypothesis that inhibition of NF-{kappa}B prevents inflammatory responses and ameliorates cardiac and renal damage. NF-{kappa}B plays a critical role in the transcriptional activation of multiple genes that contribute to the development of end-organ damage. We found that NF-{kappa}B inhibition prevented inflammatory responses, ameliorated cardiac and renal damage, and prevented death in all cases. Chronic PDTC treatment decreased blood pressure and cardiac hypertrophy slightly but almost completely eliminated albuminuria. The modest decrease in blood pressure was probably related to amelioration of renal failure rather than the result of a vasodilator effect. We do not believe that the blood pressure–lowering effect of PDTC had a major influence on end-organ protection, because effective Ang II–independent, antihypertensive triple treatment (hydralazine, reserpine, and hydrochlorothiazide) merely delayed organ damage and did not reduce inflammation.30

We used rats overexpressing the human renin and angiotensinogen genes because of the utility and severity of this model. We previously reported that renin can be taken up into tissues, leading to local Ang II formation.34 In contrast, Ang II infusions act in the circulation. Therefore, the dTGR model is suitable to study the effect of locally and systemically generated Ang II on cardiac and renal damage. We have also used 2-kidney 1-clip hypertension to induce end-organ damage.3 However, the reproducibility of that model is not as reliable as that reported here. Nevertheless, similar changes in terms of ICAM-1 expression, inflammation, and matrix production are also featured in that model. Thus, we believe that our results are relevant to other models of high Ang II.

We showed previously that Ang II production in the kidneys and elsewhere is responsible for this severe vasculopathy.24 Ang II stimulates various signaling pathways that lead to NF-{kappa}B activation. Ang II stimulates NADPH oxidase, which generates ROS.10 ROS may act as signal transduction messengers for several important transcription factors, including NF-{kappa}B and AP-1.11 35 36 Recently, 2 groups demonstrated that Ang II also stimulates Akt serine-threonine kinase.13 14 Furthermore, Ozes et al12 showed that Akt is essential in TNF-{alpha}–induced activation of NF-{kappa}B. PDTC is a potent inhibitor of NF-{kappa}B.37 Schreck et al19 and Liu et al18 demonstrated that PDTC inhibited NF-{kappa}B activation of various stimulants but had no effect on AP-1, CREB, Sp-1, and octamer-binding proteins in several cell lines and in vivo. In our study, PDTC markedly decreased NF-{kappa}B binding activity in the heart and kidney, whereas AP-1 in the kidney and c-jun mRNA expression in the heart were not decreased. Only left ventricular c-fos expression was reduced by PDTC. Abate et al22 showed that AP-1 DNA binding is regulated by the redox modification of conserved cysteine residues in the DNA binding domain of c-jun and c-fos. Meyer et al23 suggested that AP-1 may function as an antioxidant responsive element. Thus, unchanged AP-1 activity in PDTC-treated dTGR may have also accounted for the antioxidative effect of PDTC. On the other hand, Ang II is known to stimulate immediate early genes, cell proliferation, and hypertrophic response.38 39 40 41 Recently, 2 groups39 41 showed that Ang II induced c-fos, c-jun, and AP-1 activity in vascular smooth muscle cells. Nakamura et al38 found that administration of antioxidants inhibited cardiac hypertrophy. In our model, chronic treatment with PDTC partially reduced cardiac hypertrophy. However, semiquantitative RT-PCR analysis showed that only c-fos mRNA and not c-jun was reduced in the left ventricle. However, to discern the differential contributions of c-jun, c-fos, and AP-1 on end-organ damage, more detailed analyses of signaling pathways using specific inhibitors of AP-1 will be required.


*    NF-{kappa}B Plays a Central Role in Various Cardiovascular Diseases
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*NF-{kappa}B Plays a Central...
down arrowReferences
 
Ruiz-Ortega et al17 reported that NF-{kappa}B activation and MCP-1 expression in the renal cortex was reduced by ACE inhibition in experimental immune complex nephritis. Morrissey and Klahr16 showed that ACE inhibition decreased NF-{kappa}B in kidneys with ureteral obstruction. Recently, Rangan et al28 demonstrated that NF-{kappa}B inhibition by PDTC reduced inflammation and tubulointerstitial injury in nonimmune proteinuric rats. Myocardial and renal reperfusion injury develops to a large extent subsequent to the complex interaction of multiple cytokines and activated adhesion molecules.8 29 42 Morishita et al42 demonstrated that NF-{kappa}B inhibition by a decoy technique reduced the extent of myocardial infarction after reperfusion. Hernandez-Presa et al15 have shown that ACE inhibition prevents arterial NF-{kappa}B activation, chemokine expression, and macrophage infiltration in early accelerated atherosclerosis. We performed immunohistochemical analysis for the NF-{kappa}B subunit p65, because in contrast to the p50 subunit, p65 contains the transcription activation domain. The antibody recognizes an epitope overlapping the nuclear location signal of the p65 subunit and therefore selectively stains released, activated NF-{kappa}B after dissociation from its inhibitor, I-{kappa}B{alpha}.33 The NF-{kappa}B subunit p65 was increased in the endothelium, in smooth muscle cells of damaged small vessels, and in infiltrated cells in dTGR. The staining pattern resembled the localization of p65 expression in atherosclerotic lesions.

Untreated dTGR show a 150-fold increased albuminuria. Remuzzi and coworkers7 43 44 45 demonstrated that increased glomerular permeability is followed by increased filtration of macromolecules, followed by excessive tubular protein reabsorption. This process leads to abnormal accumulation of proteins in endolysosomes and endoplasmic reticulum. Altogether, these processes foster the activation of NF-{kappa}B–dependent and –independent cytokines, resulting in renal inflammation. Chronic inhibition of NF-{kappa}B by PDTC probably inhibited both the direct activation of NF-{kappa}B by Ang II and the subsequent activation induced by the increased glomerular permeability in our model, thereby breaking the self-amplifying loop.

We also examined inducible NO synthase (iNOS). Promoter deletion and mutation studies in cultured cells demonstrated that NF-{kappa}B plays a critical role in transcriptional regulation of the iNOS gene induced by various cytokines.46 47 48 49 NO regulates numerous physiological and pathophysiological processes, including smooth muscle contractility, platelet reactivity, and the cytotoxic activity of leukocytes. However, inappropriate release of this mediator has been linked to the pathogenesis of a number of disease states.50 Although endothelial NO serves beneficial roles as a messenger and host defense molecule, excessive NO production by inducible NOS can be cytotoxic. Indeed, peroxynitrite anion formation, protein tyrosine nitration, and hydroxyl radical production may contribute to the evolution of several commonly encountered renal diseases, including postischemic renal failure, obstructive nephropathy, and renal allograft rejection, among others.51 Our data show that inhibition of NF-{kappa}B by PDTC markedly reduces inflammation, iNOS expression in dTGR (most likely leading to decreased cytotoxicity), and cell proliferation. Thus, NF-{kappa}B activation plays an important role in Ang II–induced end-organ damage.


*    Acknowledgments
 
This study was supported by a grant-in-aid from Hoffmann-La Roche, Basel, Switzerland. Eero Mervaala was supported by the Alexander von Humboldt Foundation, the klinisch-pharmakologischer Verbund Berlin-Brandenburg, the Finnish Foundation for Cardiovascular Research, and the Academy of Finland. Christel Lipka, Mathilde Schmidt, and Karin Dressler gave expert technical assistance.

Received September 14, 1999; first decision October 26, 1999; accepted November 10, 1999.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
up arrowNF-{kappa}B Plays a Central...
*References
 

  1. Ingelfinger JR, Dzau VJ. Molecular biology of renal injury: emphasis on the role of the renin-angiotensin system. J Am Soc Nephrol. 1991;2:S9–S20.
  2. Lindpaintner K, Ganten D. The cardiac renin-angiotensin system: an appraisal of present experimental and clinical evidence. Circ Res. 1991;68:905–921.[Free Full Text]
  3. Haller H, Park JK, Dragun D, Lippoldt A, Luft FC. Leukocyte infiltration and ICAM-1 expression in two-kidney one-clip hypertension. Nephrol Dial Transplant. 1997;12:899–903.[Abstract/Free Full Text]
  4. Hsueh WA, Law RE, Do YS. Integrins, adhesion, and cardiac remodeling. Hypertension. 1998;31:176–180.[Abstract/Free Full Text]
  5. Roy-Chaudhury P, Hillis G, McDonald S, Simpson JG, Power DA. Importance of the tubulointerstitium in human glomerulonephritis, II: distribution of integrin chains beta 1, alpha 1 to 6 and alpha V. Kidney Int. 1997;52:103–110.[Medline] [Order article via Infotrieve]
  6. Ridker PM, Hennekens CH, Roitman Johnson B, Stampfer MJ, Allen J. Plasma concentration of soluble intercellular adhesion molecule 1 and risks of future myocardial infarction in apparently healthy men. Lancet. 1998;351:88–92.[Medline] [Order article via Infotrieve]
  7. Remuzzi G, Bertani T. Pathophysiology of progressive nephropathies. N Engl J Med. 1998;339:1448–1456.[Free Full Text]
  8. Lenardo MJ, Baltimore D. NF-kappa B: a pleiotropic mediator of inducible and tissue-specific gene control. Cell. 1989;58:227–229.[Medline] [Order article via Infotrieve]
  9. Barnes PJ, Karin M. Nuclear factor-kappaB: a pivotal transcription factor in chronic inflammatory diseases. N Engl J Med. 1997;336:1066–1071.[Free Full Text]
  10. Marumo T, Schini Kerth VB, Brandes RP, Busse R. Glucocorticoids inhibit superoxide anion production and p22 phox mRNA expression in human aortic smooth muscle cells. Hypertension. 1998;32:1083–1088.[Abstract/Free Full Text]
  11. Sen CK, Packer L. Antioxidant and redox regulation of gene transcription. FASEB J. 1996;10:709–720.[Abstract]
  12. Ozes O, Mayo L, Gustin J, Pfeffer S, Pfeffer L, Donner D. NF-kappaB activation by tumour necrosis factor requires the Akt serine-threonine kinase. Nature. 1999;401:82–85.[Medline] [Order article via Infotrieve]
  13. Takahashi T, Taniguchi T, Konishi H, Kikkawa U, Ishikawa Y, Yokoyama M. Activation of Akt/protein kinase B after stimulation with angiotensin II in vascular smooth muscle cells. Am J Physiol. 1999;276:H1927–H1934.[Abstract/Free Full Text]
  14. Ushio-Fukai M, Alexander R, Akers M, Yin Q, Fujio Y, Walsh K, Griendling K. Reactive oxygen species mediate the activation of Akt/protein kinase B by angiotensin II in vascular smooth muscle cells. J Biol Chem. 1999;274:22699–22704.[Abstract/Free Full Text]
  15. Hernandez-Presa MA, Bustos C, Ortego M, Tunon J, Ortega L, Egido J. ACE inhibitor quinapril reduces the arterial expression of NF-kappaB-dependent proinflammatory factors but not of collagen I in a rabbit model of atherosclerosis. Am J Pathol. 1998;153:1825–1837.[Abstract/Free Full Text]
  16. Morrissey JJ, Klahr S. Rapid communication: enalapril decreases nuclear factor kappa B activation in the kidney with ureteral obstruction. Kidney Int. 1997;52:926–933.[Medline] [Order article via Infotrieve]
  17. Ruiz-Ortega M, Bustos C, Hernandez-Presa M, Lorenzo O, Plaza J, Edigo J. Angiotensin II participates in mononuclear cell recruitment in experimental immune complex nephritis through nuclear factor-kB activation and monocyte chemoattractant protein-1 synthesis. J Immunol. 1998;161:430–439.[Abstract/Free Full Text]
  18. Liu S, Ye X, Malik A. Inhibition of NF-kappaB activation by pyrrolidine dithiocarbamate prevents in vivo expression of proinflammatory genes. Circulation. 1999;100:1330–1337.[Abstract/Free Full Text]
  19. Schreck R, Meier B, Mannel DN, Droge W, Baeuerle PA. Dithiocarbamates as potent inhibitors of nuclear factor kappa B activation in intact cells. J Exp Med. 1992;175:1181–1194.[Abstract/Free Full Text]
  20. Nobel CI, Kimland M, Lind B, Orrenius S, Slater AF. Dithiocarbamates induce apoptosis in thymocytes by raising the intracellular level of redox-active copper. J Biol Chem. 1995;270:26202–26208.[Abstract/Free Full Text]
  21. Galter D, Mihm S, Droge W. Distinct effects of glutathione disulphide on the nuclear transcription factor kappa B and the activator protein-1. Eur J Biochem. 1994;221:639–648.[Medline] [Order article via Infotrieve]
  22. Abate C, Patel L, Rauscher FJD, Curran T. Redox regulation of fos and jun DNA-binding activity in vitro. Science. 1990;249:1157–1161.[Abstract/Free Full Text]
  23. Meyer M, Schreck R, Baeuerle PA. H2O2 and antioxidants have opposite effects on activation of NF-kappa B and AP-1 in intact cells: AP-1 as secondary antioxidant-responsive factor. EMBO J. 1993;12:2005–2015.[Medline] [Order article via Infotrieve]
  24. Luft FC, Mervaala EMA, Muller DN, Gross V, Park J-K, Schmitz C, Lippoldt A, Breu V, Dragun D, Dechend R, Schneider W, Ganten D, Haller H. Hypertension-induced end-organ damage: a new transgenic approach to an old problem. Hypertension. 1999;33:212–218.[Abstract/Free Full Text]
  25. Mervaala EMA, Muller DN, Park J-K, Schmidt F, Breu V, Dragun D, Ganten D, Haller H, Luft FC. Monocyte infiltration and adhesion molecules in a rat model of high human renin hypertension. Hypertension. 1999;33:389–395.[Abstract/Free Full Text]
  26. Bohlender J, Fukamizu A, Lippoldt A, Nomura T, Dietz R, Menard J, Murakami K, Luft FC, Ganten D. High human renin hypertension in transgenic rats. Hypertension. 1997;29:428–434.[Abstract/Free Full Text]
  27. Altura BM, Gebrewold A. Pyrrolidine dithiocarbamate attenuates alcohol-induced leukocyte-endothelial cell interaction and cerebral vascular damage in rats: possible role of activation of transcription factor NF-kappaB in alcohol brain pathology. Alcohol. 1998;16:25–28.[Medline] [Order article via Infotrieve]
  28. Rangan GK, Wang Y, Tay YC, Harris DC. Inhibition of nuclear factor-kappaB activation reduces cortical tubulointerstitial injury in proteinuric rats. Kidney Int. 1999;56:118–134.[Medline] [Order article via Infotrieve]
  29. Dragun D, Tullius SG, Park JK, Maasch C, Lukitsch I, Lippoldt A, Gross V, Luft FC, Haller H. ICAM-1 antisense oligodesoxynucleotides prevent reperfusion injury and enhance immediate graft function in renal transplantation. Kidney Int. 1998;54:590–602.[Medline] [Order article via Infotrieve]
  30. Mervaala E, Muller D, Schmidt F, Park J-K, Gross V, Bader M, Breu V, Ganten D, Haller H, Luft F. Angiotensin II induces perivascular inflammation and cell proliferation independent of blood pressure in high human renin hypertension. Hypertension. In press.
  31. Brand K, Page S, Rogler G, Bartsch A, Brandl R, Knuechel R, Page M, Kaltschmidt C, Baeuerle PA, Neumeier D. Activated transcription factor nuclear factor-kappa B is present in the atherosclerotic lesion. J Clin Invest. 1996;97:1715–1722.[Medline] [Order article via Infotrieve]
  32. Krappmann D, Wulczyn FG, Scheidereit C. Different mechanisms control signal-induced degradation and basal turnover of the NF-{kappa}B inhibitor I{kappa}B{alpha} in vivo. EMBO J. 1996;15:6716–6726.[Medline] [Order article via Infotrieve]
  33. Zabel U, Henkel T, Silva MS, Baeuerle PA. Nuclear uptake control of NF-kappa B by MAD-3, an I{kappa}B protein present in the nucleus. EMBO J. 1993;12:201–211.[Medline] [Order article via Infotrieve]
  34. Muller DN, Fischli W, Clozel JP, Hilgers KF, Bohlender J, Menard J, Busjahn A, Ganten D, Luft FC. Local angiotensin II generation in the rat heart: role of renin uptake. Circ Res. 1998;82:13–20.[Abstract/Free Full Text]
  35. Rosen P, Du X, Tschope D. Role of oxygen derived radicals for vascular dysfunction in the diabetic heart: prevention by {alpha}-tocopherol? Mol Cell Biochem.. 1998;188:103–111.[Medline] [Order article via Infotrieve]
  36. Scheidegger KJ, Du J, Delafontaine P. Distinct and common pathways in the regulation of insulin-like growth factor-1 receptor gene expression by angiotensin II and basic fibroblast growth factor. J Biol Chem. 1999;274:3522–3530.[Abstract/Free Full Text]
  37. Munoz C, Castellanos MC, Alfranca A, Vara A, Esteban MA, Redondo JM, de Landazuri MO. Transcriptional up-regulation of intracellular adhesion molecule-1 in human endothelial cells by the antioxidant pyrrolidine dithiocarbamate involves the activation of activating protein-1. J Immunol. 1996;157:3587–3597.[Abstract]
  38. Nakamura K, Fushimi K, Kouchi H, Mihara K, Miyazaki M, Ohe T, Namba M. Inhibitory effects of antioxidants on neonatal rat cardiac myocyte hypertrophy induced by tumor necrosis factor-alpha and angiotensin II. Circulation. 1998;98:794–799.[Abstract/Free Full Text]
  39. Hamaguchi A, Kim S, Izumi Y, Zhan Y, Yamanaka S, Iwao H. Contribution of extracellular signal-regulated kinase to angiotensin II-induced transforming growth factor-b1 expression in vascular smooth muscle cells. Hypertension. 1999;34:126–131.[Abstract/Free Full Text]
  40. Puri PL, Avantaggiati ML, Burgio VL, Chirillo P, Collepardo D, Natoli G, Balsano C, Levrero M. Reactive oxygen intermediates mediate angiotensin II-induced c-Jun.c-Fos heterodimer DNA binding activity and proliferative hypertrophic responses in myogenic cells. J Biol Chem. 1995;270:22129–22134.[Abstract/Free Full Text]
  41. Moriguchi Y, Matsubara H, Mori Y, Murasawa S, Masaki H, Maruyama K, Tsutsumi Y, Shibasaki Y, Tanaka Y, Nakajima T, Oda K, Iwasaka T. Angiotensin II-induced transactivation of epidermal growth factor receptor regulates fibronectin and transforming growth factor-ß synthesis via transcriptional and posttranscriptional mechanisms. Circ Res. 1999;84:1073–1084.[Abstract/Free Full Text]
  42. Morishita R, Sugimoto T, Aoki M, Kida I, Tomita N, Moriguchi A, Maeda K, Sawa Y, Kaneda Y, Higaki J, Ogihara T. In vivo transfection of cis element "decoy" against nuclear factor-kappaB binding site prevents myocardial infarction. Nat Med. 1997;3:894–899.[Medline] [Order article via Infotrieve]
  43. Benigni A, Remuzzi G. Glomerular protein trafficking and progression of renal disease to terminal uremia. Semin Nephrol. 1996;16:151–159.[Medline] [Order article via Infotrieve]
  44. Abbate M, Zoja C, Corna D, Capitanio M, Bertani T, Remuzzi G. In progressive nephropathies, overload of tubular cells with filtered proteins translates glomerular permeability dysfunction into cellular signals of interstitial inflammation. J Am Soc Nephrol. 1998;9:1213–1224.[Abstract]
  45. Abbate M, Zoja C, Rottoli D, Corna D, Perico N, Bertani T, Remuzzi G. Antiproteinuric therapy while preventing the abnormal protein traffic in proximal tubule abrogates protein- and complement-dependent interstitial inflammation in experimental renal disease. J Am Soc Nephrol. 1999;10:804–813.[Abstract/Free Full Text]
  46. Liu SF, Ye X, Malik AB. In vivo inhibition of nuclear factor-kappa B activation prevents inducible nitric oxide synthase expression and systemic hypotension in a rat model of septic shock. J Immunol. 1997;159:3976–3983.[Abstract]
  47. Spink J, Cohen J, Evans TJ. The cytokine responsive vascular smooth muscle cell enhancer of inducible nitric oxide synthase: activation by nuclear factor-kappa B. J Biol Chem. 1995;270:29541–29547.[Abstract/Free Full Text]
  48. Perrella MA, Patterson C, Tan L, Yet SF, Hsieh CM, Yoshizumi M, Lee ME. Suppression of interleukin-1beta-induced nitric-oxide synthase promoter/enhancer activity by transforming growth factor-beta1 in vascular smooth muscle cells: evidence for mechanisms other than NF-kappaB. J Biol Chem. 1996;271:13776–13780.[Abstract/Free Full Text]
  49. Wong HR, Finder JD, Wasserloos K, Lowenstein CJ, Geller DA, Billiar TR, Pitt BR, Davies P. Transcriptional regulation of iNOS by IL-1 beta in cultured rat pulmonary artery smooth muscle cells. Am J Physiol. 1996;271:L166–L171.[Abstract/Free Full Text]
  50. Hobbs A, Higgs A, Moncada S. Inhibition of nitric oxide synthase as a potential therapeutic target. Ann Rev Pharmacol Toxicol. 1999;39:191–200.[Medline] [Order article via Infotrieve]
  51. Klahr S. The role of L-arginine in hypertension and nephrotoxicity. Curr Opin Nephrol Hypertens. 1998;7:547–550.[Medline] [Order article via Infotrieve]



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
S. D. Crowley, C. W. Frey, S. K. Gould, R. Griffiths, P. Ruiz, J. L. Burchette, D. N. Howell, N. Makhanova, M. Yan, H.-S. Kim, et al.
Stimulation of lymphocyte responses by angiotensin II promotes kidney injury in hypertension
Am J Physiol Renal Physiol, August 1, 2008; 295(2): F515 - F524.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
G. Piecha, N. Koleganova, M.-L. Gross, A. Geldyyev, M. Adamczak, and E. Ritz
Regression of glomerulosclerosis in subtotally nephrectomized rats: effects of monotherapy with losartan, spironolactone, and their combination
Am J Physiol Renal Physiol, July 1, 2008; 295(1): F137 - F144.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
B. Shen, M. Hagiwara, Y.-Y. Yao, L. Chao, and J. Chao
Salutary Effect of Kallistatin in Salt-Induced Renal Injury, Inflammation, and Fibrosis via Antioxidative Stress
Hypertension, May 1, 2008; 51(5): 1358 - 1365.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
Y. Wei, K. Chen, A. T. Whaley-Connell, C. S. Stump, J. A. Ibdah, and J. R. Sowers
Skeletal muscle insulin resistance: role of inflammatory cytokines and reactive oxygen species
Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2008; 294(3): R673 - R680.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
Y. Wei, J. R. Sowers, S. E. Clark, W. Li, C. M. Ferrario, and C. S. Stump
Angiotensin II-induced skeletal muscle insulin resistance mediated by NF-{kappa}B activation via NADPH oxidase
Am J Physiol Endocrinol Metab, February 1, 2008; 294(2): E345 - E351.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
A. A. Elmarakby, J. E. Quigley, J. J. Olearczyk, A. Sridhar, A. K. Cook, E. W. Inscho, D. M. Pollock, and J. D. Imig
Chemokine Receptor 2b Inhibition Provides Renal Protection in Angiotensin II Salt Hypertension
Hypertension, December 1, 2007; 50(6): 1069 - 1076.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. C. Sullivan, L. Semprun-Prieto, E. I. Boesen, D. M. Pollock, and J. S. Pollock
Sex and sex hormones influence the development of albuminuria and renal macrophage infiltration in spontaneously hypertensive rats
Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2007; 293(4): R1573 - R1579.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. A. Cooper, A. Whaley-Connell, J. Habibi, Y. Wei, G. Lastra, C. Manrique, S. Stas, and J. R. Sowers
Renin-angiotensin-aldosterone system and oxidative stress in cardiovascular insulin resistance
Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2009 - H2023.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
N. Henke, R. Schmidt-Ullrich, R. Dechend, J.-K. Park, F. Qadri, M. Wellner, M. Obst, V. Gross, R. Dietz, F. C. Luft, et al.
Vascular Endothelial Cell Specific NF-{kappa}B Suppression Attenuates Hypertension-Induced Renal Damage
Circ. Res., August 3, 2007; 101(3): 268 - 276.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
Y. Wei, A. T. Whaley-Connell, K. Chen, J. Habibi, G. M.-E. Uptergrove, S. E. Clark, C. S. Stump, C. M. Ferrario, and J. R. Sowers
NADPH Oxidase Contributes to Vascular Inflammation, Insulin Resistance, and Remodeling in the Transgenic (mRen2) Rat
Hypertension, August 1, 2007; 50(2): 384 - 391.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Y. Ozawa and H. Kobori
Crucial role of Rho-nuclear factor-{kappa}B axis in angiotensin II-induced renal injury
Am J Physiol Renal Physiol, July 1, 2007; 293(1): F100 - F109.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc Res