(Hypertension. 2000;35:273.)
© 2000 American Heart Association, Inc.
Scientific Contributions |
Angiotensin II Enhances Integrin and 
-Actinin Expression in Adult Rat Cardiac Fibroblasts
From the Department of Medicine (H.K., S.G., Y.K., J.S., R.E.L., W.A.H.), Division of Endocrinology, Diabetes and Hypertension, Molecular Biology Institute (R.E.L., W.A.H.), and Department of Medicine (J.S.), Division of Cardiology, University of California at Los Angeles School of Medicine; Department of Medicine/Cardiology (R.J.C.), University of Michigan Medical Center, Ann Arbor; and Department of Medicine/Cardiology (K.G., S.G.), Virchow Klinikum, Humboldt University Berlin and German Heart Institute Berlin, Berlin, Germany.
Correspondence to Willa A. Hsueh, MD, University of California, Los Angeles, School of Medicine, Division of Endocrinology, Diabetes and Hypertension, Warren Hall, 2nd Floor, Room 24-130, 900 Veteran Ave, Mail Code 178622, Los Angeles, CA 90024.
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract—Angiotensin II (Ang II) plays an important role in cardiac remodeling through stimulation of proliferation and extracellular matrix (ECM) production in cardiac fibroblasts. Integrins are a family of transmembrane receptors that mediate the attachment of cells to ECM. We hypothesized that Ang II regulation of integrins further contributes to its role in cardiac remodeling. We cultured adult rat cardiac fibroblasts with and without Ang II (100 nmol/L) to determine the effects on mRNA and protein levels of integrins, as well as
-actinin and other cytoskeletal proteins that link to integrins at the site of focal adhesions. Ang II was also added in the presence of irbesartan (10 µmol/L), a specific Ang II type 1 (AT1) receptor antagonist, or PD 123319 (10 µmol/L), a specific Ang II type 2 receptor antagonist. To investigate the function of these integrins, we determined the effects of blocking antibodies on Ang II–induced adhesion to ECM. We also treated spontaneously hypertensive rats (SHR) with an AT1 receptor blocker, losartan, or with hydralazine to investigate integrin and -actinin expression in treated and untreated SHR. Ang II enhanced v, ß1, ß3, and ß5 integrins; osteopontin; and -actinin mRNA and protein levels in cardiac fibroblasts. All of these effects were inhibited by irbesartan but not by PD 123319. Pretreatment of cardiac fibroblasts with Ang II enhanced cell attachment to ECM proteins and induced focal adhesion kinase phosphorylation. Blocking antibodies to ß3 and vß5 attenuated Ang II–induced adhesion. In SHR, ventricular v and ß5 integrin expression and -actinin were increased compared with those in Wistar-Kyoto rats. Although both losartan and hydralazine lowered mean arterial pressure and decreased peripheral vascular resistance, only losartan attenuated the increased integrin, -actinin, fibronectin laminin, and osteopontin expression and the increased left ventricular mass (as determined with echocardiography). Hydralzine had none of these effects. Although both agents attenuated ß-myosin heavy chain expression, a marker of hypertrophy, losartan had a greater effect. These results suggest that integrins and -actinin are upregulated by Ang II and in left ventricular hypertrophy and that the block of expression of these proteins through inhibition of the AT1 receptor is associated with attenuation of the hypertrophic response. Ang II induces integrin and -actinin expression in cardiac fibroblasts that is associated with adhesion and left ventricular hypertrophy and blocked through inhibition of the AT1 receptor.
Key Words: angiotensin II • integrins • kinase
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Angiotensin II (Ang II) plays a pivotal role in cardiac remodeling through its regulation of cardiac fibroblast proliferation, extracellular matrix (ECM) protein production, and adhesion to matrix proteins. Changes in the cardiac interstitium have an importantly affect on myocyte performance and metabolism; progressive fibrosis results in ventricular dysfunction and, ultimately, failure.1 2 3 4 5 6 7
Integrins are a family of transmembrane receptors composed of and ß subunit heterodimers. These receptors mediate adhesion of cells directly to ECM proteins; they have been recognized as important factors in wound healing.8 Integrin-mediated contact of cells with ECM promotes adhesion, spreading, and cytoskeletal reorganization. Moreover, integrins not only act as simple mediators of cell adhesion but also can transduce biochemical signals across the cell membrane to activate cell signaling pathways.9 10 Cytokines and growth factors have been shown to modulate integrin expression.11 12 13 We addressed the hypotheses that Ang II could regulate integrin expression in rat cardiac fibroblasts and that this regulation could contribute to the profibrotic effects of Ang II. We found that Ang II regulated v, ß1, ß3, and ß5 integrin expression through Ang II type 1 (AT1) receptor activation. These integrins were also upregulated in hypertrophied ventricles of spontaneously hypertensive rats (SHR) but not in normal Wistar-Kyoto (WKY) rat ventricles. Expression could be attenuated by the AT1 receptor blocker losartan but not by the vasodilator hydralazine despite similar lowering of blood pressure in SHR. Thus, through its actions to alter integrin expression, Ang II regulates adhesion and other profibrotic actions of cardiac fibroblasts.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Isolation and Treatment of Cardiac Fibroblasts
Adult rat cardiac fibroblasts were prepared from Sprague-Dawley rats4 in accordance with institutional guidelines; cultured fibroblasts (passages 2 to 4) were studied at 70% confluence. They were placed in serum-free medium with containing ITS (5 ng/mL insulin, 5 ng/mL transferrin, and 5 ng/mL selenium) for 48 hours before treatment. Ang II (0.1 µmol/L) was added in the serum-free medium for periods of 0.5 to 48 hours. To assess whether the effect of Ang II was mediated by the AT1 or Ang II type 2 (AT2) receptor, Ang II was added in the presence of irbesartan (10 µmol/L), a specific AT1 receptor antagonist, or PD 123319 (10 µmol/L), a specific AT2 receptor antagonist.
Isolation and Analysis of RNA
Total RNA was isolated with the use of TRIZOL reagent (Life Technologies), and Northern analysis were performed as previously described.4 Hybridization signals of the specific mRNAs of interest were normalized to those of CHOB, a constitutively expressed gene initially isolated as Chinese hamster ovary clone B that encodes a ribosomal protein, to correct for differences in loading or transfer.4 ECM protein cDNAs that were used as probes were obtained from American Type Culture Collection. Osteopontin (OP), -actinin, and integrin cDNAs were kindly provided by C.M. Giachelli (University of Washington, Seattle). For ß-myosin heavy chain (ß-MHC), we used an oligonucleotide probe (ggtctcagggcttcacaggc) that was generously donated by Dr Robert Ross (University of California, Los Angeles). Quantification of Northern blots was performed through densitometric analysis with NIH Image version 1.6 software for the Macintosh personal computer. Several autoradiographic film exposures (from 4 hours to 7 days) were used to ensure that the density of the signals were linear on each film.
Western Blotting
Second, third, and fourth passaged cells were collected and lysed with lysis buffer containing 20 mmol/L Tris (pH 7.5), 150 mmol/L NaC1, 1 mmol/L EDTA, 1 mmol/L EGTA, 1% Triton X-100, 2.5 mmol/L sodium pyrophosphate, 1 mmol/L ß-glycerophosphate, 1 mmol/L Na3VO4, 1 µg/mL leupeptin, and 1 mmol/L PMSF.
Western immunoblots were performed as previously described.14 Membranes were incubated with antibodies (1:1000) against v, ß1, ß3, or ß5 integrin (Chemicon) or -actinin (Sigma Chemical Co).
Cell Attachment
Adhesion assays were performed as described previously.15 ECM substrates human collagen I, III, and IV; fibronectin; vitronectin; and laminin at 10 µg/mL were used to coat 96-well plates (Nunc) through incubation overnight at 4°C. Nonspecific binding was blocked with 1% BSA at 37°C for 1 hour. Absorbance was read at a wavelength of 595 nm with an ELISA reader (model 550 Microplate Leader; Bio-Rad Laboratory).
Focal Adhesion Kinase Assay
Cells were lysed in buffer containing 20 mmol/L Tris (pH 7.5), 150 mmol/L NaC1, 1 mmol/L EDTA, 1 mmol/L EGTA, 1% Triton X-100, 2.5 mmol/L sodium pyrophosphate, 1 mmol/L ß-glycerophosphate, 1 mmol/L Na3VO4, 1 µg/mL leupeptin, and 1 mmol/L PMSF. Lysates were immunoprecipitated with anti–focal adhesion kinase (FAK) antibody (dilution 1:100; Santa Cruz Biotechnology) overnight at 4°C, after which protein G–Sepharose was added to collect the immunoprecipitated complex. Pellets were washed 3 times with lysis buffer, resuspended with cell lysate buffer and 3x SDS sample buffer, and boiled for 5 minutes. Western immunoblotting was performed with anti-phosphotyrosine antibody (1:1000; Santa Cruz).
Antihypertensive Treatment in SHR
After 2 weeks of acclimatization, 8- to 10-week-old SHR were divided into 3 groups and treated on a daily basis for 14 weeks. The first group (placebo) received tap water ad libitum, the second group received 30 mg/kg losartan, and the third group received 25 mg/kg hydralazine. Because both compounds are water soluble, drugs were administered in tap water, similar to the placebo group. To quantify drug ingestion, the amount ingested was estimated as the difference between the administrated volume and the residual volume, with the concentration of drug within the tap water adjusted to yield the prescribed daily dose of experimental drug. Drug administration was adjusted to accommodate the increase in body weight during the period of treatment. An age-matched group of normal WKY rats were followed in a similar manner, with ingestion of tap water. Purina chow intake was similar for all groups. Treatment groups were staggered to accommodate the scheduled hemodynamic studies.
Echocardiographic Measurements
The echocardiographic technique used in this study was originally established by de Simone et al.16 We previously validated and confirmed this methodology for chronic changes of left ventricular mass in the rodent.17
Hemodynamic Measurements
On the completion of long-term therapy, a terminal hemodynamic study was obtained through the use of methodologies that were previously reported.18 19 Data acquisition included the scalar ECG, phasic and mean aortic blood flow and phasic and mean aortic blood pressure, arterial resistance, and left ventricular end-diastolic pressure, with all hemodynamic signals acquired through a group amplifier system. Data were simultaneously recorded to chart paper and digital audio tape with the use of a digital data recorder (model RD-111TN; Teac).
Analog-to-digital translation of the simultaneously acquired hemodynamic signals was performed at a sampling rate of 1024 Hz. Translation involved the use of a Codas analog-to-digital converter board and software (Dataq Instruments) installed in a DOS operating system computer, creating a numeric data file. The latter generates a report for each cardiac cycle in a sampling sequence, which typically includes 30 to 40 consecutive cardiac cycles. An average value for all acquired and derived hemodynamic variables is then generated for each sampling sequence of each individual animals. Heart rate was derived from the RR interval of the ECG. The mean volume aortic flow (in mL/min) was considered to represent the cardiac output minus coronary blood flow. Cardiac output was normalized to a body weight of 1 kg to allow for differences in individual rat weight. Direct recordings of systolic and diastolic aortic blood pressure (SBP and DBP, respectively) were obtained, with simultaneous determination of mean aortic pressure obtained with signal conditioning of the phasic pressure signal through a separate amplifier. Systemic arterial resistance was expressed in arbitrary units, as the ratio of mean arterial pressure (MAP) to normalized cardiac output.
After completion of the hemodynamic assessment, animals were euthanized with intravenous potassium chloride while under general anesthesia. The heart was immediately isolated, and the left ventricle was rapidly dissected and snap frozen in liquid nitrogen. All samples of the left ventricle were coded and stored at -80°C until the time of analysis.
Statistical Analysis
Values are expressed as mean±SEM. Group mean values were compared with use of the 2-tailed Student’s t test. Differences between treatments were analyzed with the use of ANOVA. Values of P<0.05 were considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Ang II Regulates Integrin and
-Actinin Expression in Rat Cardiac FibroblastsAng II (100 nmol/L) prominently induced ß3 integrin mRNA expression in rat cardiac fibroblasts at 2 to 6 hours (4-fold, P<0.01; Figures 1A and 1B), which returned to control levels by 12 hours. Ang II increased
v mRNA expression by 3-fold (P<0.01) at 48 hours. There was little effect of Ang II on ß5 integrin mRNA expression until 48 hours of treatment (2-fold; P<-0.01). As previously shown,20 Ang II also increased OP expression. This acid phosphoprotein is a ligand for v, ß3, and v, and ß5 enhances cell attachment to ECM proteins through these integrins. The AT1 receptor blocker irbesartan, but not the AT2 receptor blocker PD 123319, blocked the Ang II–induced increase in ß3 integrin (Figure 2A) and v integrin (Figure 2B). Ang II also stimulated expression of the cytoskeletal protein -actinin from 6 to 24 hours (Figure 3A). This effect was blocked by irbesartan but not by PD 123319 (Figure 3B). The expression of other cytoskeletal proteins, such as talin, vinculin, paxillin, or F-actin, was not altered by Ang II (data not shown). Ang II also increased the protein levels of ß1, ß3, ß5, and v integrins and -actinin for up to 48 to 72 hours, which is consistent with its effects to enhance message expression (Figure 4).
|
|
|
|
Ang II Stimulates Attachment and Phosphorylation of FAK
Pretreatment of cardiac fibroblasts with Ang II for 48 hours increased cell attachment to all ECM proteins tested, including type I collagen, fibronectin, vitronectin, and laminin (Figure 5). These effects were significantly decreased with irbesartan (Figure 6). Antibodies against ß3 integrin also attenuated Ang II–induced attachment of cardiac fibroblasts to all matrices, whereas antibodies to vß5 integrin attenuated only attachment to vitronectin (Figure 6). Cardiac fibroblasts that were pretreated with Ang II for 48 hours had increased phosphorylation of FAK when attached to each of the ECM proteins compared with the attachment of untreated cells (Figure 7).
|
|
|
Integrins Are Regulated in Cardiac Hypertrophy
At the time of the terminal hemodynamic study, the MAP, SBP, and DBP of SHR were significantly higher than those of the WKY rats (Table). Both the AT1 receptor blocker losartan and the vasodilator hydralazine suppressed MAP, SBP, and DBP in the SHR to levels similar to those in WKY rats. Systemic arterial resistance of SHR was significantly higher than that of WKY rats (Table); both losartan and hydralazine suppressed systemic arterial resistance in the SHR to the level of that of WKY rats. Losartan and hydralazine significantly decreased left ventricular end-diastolic pressure compared with placebo (losartan 0.17±0.17 mm Hg, placebo 12.3±2.3 mm Hg, P<0.0005) and hydralazine (2.6± 1.7 mm Hg, P<0.005 versus placebo).
|
The left ventricular mass of SHR was increased compared with that of WKY rats (Table). The long-term administration of losartan prevented the development of left ventricular hypertrophy (LVH) compared with untreated SHR. In contrast, despite comparable blood pressure reduction, hydralazine did not significantly prevent LVH.
The message levels of 2 markers of hypertrophy, OP and ß-MHC, were increased in the ventricles of SHR hearts compared with WKY hearts. Losartan administration, but not hydralazine administration, prevented the upregulation of OP and ß-MHC expression. The expression of 2 matrix proteins, fibronectin and laminin, was increased in SHR compared with WKY rats; losartan attenuated message expression of these proteins, whereas hydralazine did not. Message expression of v and ß5 integrin and -actinin was increased in SHR compared with that in WKY rats; losartan attenuated expression of these adhesion receptors and the cytoskeletal protein -actinin, whereas hydralazine had little effect. Representative Northern blots are shown in Figure 8A, and densitometric analysis is shown in Figure 8B. In contrast, ß3 mRNA did not differ among WKY rats or the treated and untreated SHR (data not shown).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The present study demonstrates that (1) Ang II regulates
v, ß1, ß3, and ß5 integrin expression in rat cardiac fibroblasts; (2) Ang II enhances cardiac fibroblast attachment to ECM proteins and FAK phosphorylation through this increase in integrin expression; (3) Ang II increases expression of the cytoskeletal protein -actinin; (4) v and ß5 integrins and -actinin expression is increased in hearts of SHR compared with their normotensive WKY controls; and (5) these effects are attenuated by AT1 receptor blockade both in vivo and in vitro. These data suggest that Ang II plays a novel role in cardiac fibroblast attachment to ECM, which is another mechanism, in addition to stimulation of fibroblast growth and ECM production, by which Ang II enhances the interstitial fibrotic process in the heart.
Ang II is implicated as a cardiac profibrotic factor. Previous studies have demonstrated that Ang II stimulates transforming growth factor-ß and ECM production, as well as growth of cardiac fibroblasts and activation of cell signaling pathways, such as the mitogen-activated protein kinase cascade, which mediates growth.21 22 We recently demonstrated that Ang II stimulates production of the adhesion protein OP in rat cardiac fibroblasts; this protein mediates growth and collagen gel contraction of the fibroblasts, both of which are functions that are dependent on cell attachment.20 Burgess et al23 also showed that Ang II enhanced the level of ß1 integrins, which contributed to Ang II–induced attachment to collagen. The present investigation underscores the role of Ang II in adhesion by demonstrating that Ang II not only regulates the production of the extracellular adhesion molecule OP but also regulates the expression of cell surface integrins that bind to OP and to other ECM proteins, as well as the expression of the cytoskeletal protein -actinin, which is intimately connected to integrins at the site of focal adhesions. Thus, Ang II regulates proteins that mediate cell attachment at all locations of the cell (eg, secreted matrix proteins, cell membrane receptors, and intracellular strut proteins), suggesting that Ang II orchestrates a coordinated series of cellular events to enhance cell adhesion, as well as signaling pathways that are associated with adhesion such as FAK.
Adhesion is key for many cell functions, including growth and migration. Inhibition of adhesion promotes cell death.24 Thus, it is not surprising that acting in its role as a growth factor, Ang II enhances adhesion processes. In skin fibroblasts, adhesion to ECM is important for growth, as well as for wound healing and scar formation.25 In ischemic or necrotic myocardium, these responses are necessary acutely, but chronic fibrosis leads to interstitial remodeling, ultimately resulting in heart failure.3 The cause of the chronic fibrosis that occurs in LVH in the absence of extensive necrosis is unclear, although increased ventricular workload is associated with increased cardiac ACE activity and increased local generation of Ang II.26 The present study suggests that the profibrotic effects of Ang II result from its ability to regulate cell adhesion to collagen and other matrix proteins. Indeed, Ang II enhanced attachment of cardiac fibroblasts to type I collagen, fibronectin, vitronectin, and laminin. All of these proteins contain RGD (arginine-glycine-aspartic acid) sequences, which attach to integrins, although v ß5 binds preferentially to vitronectin. The block of antibodies to ß3 inhibited the attachment of cells to all of these ECM proteins, whereas antibodies against v ß5 blocked binding only to vitronectin. Ang II–induced attachment to collagen was not reversed to control (non–Ang II–treated) levels by the AT1 receptor blocker or by anti-ß3 antibody, whereas attachment to other matrix proteins was reversed to control, suggesting that other mechanisms may contribute to cardiac fibroblast attachment to type I collagen.
Because integrins mediate the response of the cell to its environment, elucidation of factors that regulate integrin expression will enhance our understanding of cell behavior. Because Ang II is a key regulator of OP expression in the heart and because OP binds to integrins through RGD sequences, we were particularly interested in the effect of Ang II on expression of integrins activated by RGD-containing ligands. In addition, cyclic peptides containing RGD sequences are available that could be used therapeutically to competitively inhibit integrin activation by RGD-containing ECM proteins.27 The RGD-binding integrin heterodimers v ß5 are present on cardiac fibroblasts, regulated by Ang II; importantly, the present study is the first demonstration that the expression of these integrins is increased in LVH. This observation fits in well with our previous finding that ventricular OP is increased in 2 other rat models of LVH, aortic banding and 2-kidney, 1-clip Goldblatt hypertension, as well as the SHR used in the present study. In fact, ventricular OP expression is highly correlated with ventricular ANP expression, suggesting OP expression could also be a marker of LVH.28 The increase in OP coupled with the increase in OP-binding integrins and the increases in -actinin allows for amplification of the effects of Ang II to enhance fibroblast attachment, proliferation, and ECM contraction, leading to fibrosis, which characterizes all forms of cardiac hypertrophy. It is likely that inhibition of integrin activation through the inhibition of OP or through interaction with integrin-blocking antibodies or competing RGD peptides will alter interstitial remodeling associated with LVH. An important question is how this inhibition will ultimately affect ventricular function.
Ang II stimulation of v, ß3, and ß5 integrins and -actinin in vitro was inhibited with AT1 receptor blockade. In the SHR, blood pressure and peripheral vascular resistance were lowered with both losartan, an AT1 receptor blocker, and hydralazine, a vasodilator. Losartan treatment attenuated the increased expression of ECM proteins v, ß5, -actinin, and OP and ß-MHC (a marker of hypertrophy), whereas hydralazine had little or no effect. These data suggest that Ang II directly regulates ECM and adhesion proteins in the SHR and that the AT1 receptor mediates these actions of Ang II. Doses of ACE inhibitor that do not lower blood pressure have been shown to attenuate LVH in the aortic banded rat model, whereas doses of hydralazine that lower blood pressure are less effective.29 Similarly, in our study, losartan, but not hydralazine, blocked the increase in left ventricular mass in the SHR. It has been suggested that enhanced tissue bradykinin levels associated with ACE inhibition contribute to these effects.30 However, in the post–myocardial infarction rat model, ACE inhibitor and AT1 receptor blockade equally attenuated both the increase in left ventricular mass and fibrosis, suggesting Ang II may play a primary role in regulation of these cardiac responses through the AT1 receptor.30 Both enalapril and losartan were recently shown to reduce cardiac mass and to improve coronary hemodynamics in SHR.18 Ang II blockade may attenuate LVH by decreasing matrix production and, as suggested by the present data, by decreasing OP and integrin overexpression.
Interestingly, -actinin expression was also increased in the SHR without treatment or in the SHR that had been administered hydralazine and was regulated by Ang II both in vitro in cardiac fibroblasts and in vivo. -Actinin is a cytoskeletal protein that is anchored to F-actin, a major protein involved in cellular architecture, and to integrins on the cell surface.24 As the activation of integrins changes cell function, alterations in cytoskeletal protein arrangement, and possibly quantity, are needed to change cell shape to execute specific functions.24 It is unclear why Ang II enhances expression of -actinin and not the other cytoskeletal proteins like vinculin or talin that are also anchored to integrin receptors on the cell surface. Whether there is some specific role of -actinin in adhesion or in regulation of intracellular signaling events associated with adhesion requires further investigation. Cardiac fibroblasts can differentiate into myofibroblasts, which is associated with proliferation and ECM production.31 However, in human cardiac fibroblasts, we did not find that Ang II treatment was associated with increased fibroblast differentiation, so it does not appear that increased expression of -actinin is associated with the myofibroblast differentiation program.32
In summary, Ang II increases multiple cellular mechanisms that mediate adhesion in cardiac fibroblasts, including upregulation of OP; v, ß3, and ß5 integrins; and -actinin. These changes also occur in LVH. Blockade of the AT1 receptor prevents these effects in cardiac fibroblasts and contributes to its attenuation of the development of LVH in the SHR.
Received September 15, 1999; first decision October 11, 1999; accepted October 26, 1999.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Sadoshima J, XU Y, Slayter HS, Izumo S. Autocrine release of angiotensin II mediates stretch-induced hypertrophy of cardiac myocytes in vitro. Cell. 1993;75:977–984.[Medline] [Order article via Infotrieve]
2.
Crawford DC, Chobanian AV, Brecher P. Angiotensin II induces fibronectin expression associated with cardiac fibrosis in the rat. Circ Res. 1994;74:727–739.
3. Weber KT, Sun Y, Tyagi SC, Cleutjens JP. Collagen network of the myocardium: function, structural remodeling and regulatory mechanisms. J Mol Cell Cardiol. 1994;26:279–292.[Medline] [Order article via Infotrieve]
4.
Iwami K, Ashizawa N, Do YS, Graf K, Hsueh WA. Comparison of Ang II with other growth factors on Egr-1 and matrix gene expression in cardiac fibroblasts. Am J Physiol. 1996;270:H2100–H2107.
5. Carey DJ. Control of growth and differentiation of vascular cells by extracellular matrix proteins. Annu Rev Physiol. 1991;53:161–177.[Medline] [Order article via Infotrieve]
6.
Hsueh WA, Law RE, Do YS. Integrins, adhesion, and cardiac remodeling. Hypertension. 1998;31:176–180.
7. Ruoslahti E. Fibronectin and its receptors. Annu Rev Biochem. 1988;57:375–413.[Medline] [Order article via Infotrieve]
8. Hynes RO. Integrins: versatility, modulation, and signaling in cell adhesion. Cell. 1992;69:11–25.[Medline] [Order article via Infotrieve]
9.
Juliano RL, Haskill S. Signal transduction from the extracellular matrix. J Cell Biol. 1993;120:577–585.
10.
Clark EA, Brugg JS. Integrins and signal transduction pathways: the road taken. Science. 1995;268:233–239.
11. Enenstein J, Waleh NS, Kramer RH. Basic FGF and TGF-beta differentially modulate integrin expression of human microvascular endothelial cells. Exp Cell Res. 1992;203:499–503.[Medline] [Order article via Infotrieve]
12.
Santala P, Heino J. Regulation of integrin-type cell adhesion receptors by cytokines. J Biol Chem. 1991;266:23505–23509.
13.
Heino J, Ignotz RA, Hemler ME, Crouse C, Massague J. Regulation of cell adhesion receptors by transforming growth factor-beta: concomitant regulation of integrins that share a common beta 1 subunit. J Biol Chem. 1989;264:380–388.
14.
Graf K, Xi X-P, Yang D, Fleck E, Hsueh WA, Law RE. Mitogen-activated protein kinase activation is involved in platelet-derived growth factor-directed migration by vascular smooth muscle cells. Hypertension. 1997;29:334–339.
15.
Liaw L, Almeida M, Hart CE, Schwartz SM, Giachelli CM. Osteopontin promotes vascular cell adhesion and spreading and is chemotactic for smooth muscle cells in vitro. Circ Res. 1994;74:214–224.
16. de Simone G, Wallerson DC, Volpe M, Devereux RB. Echocardiographic measurement of left ventricular mass and volume in normotensive and hypertensive rats: necropsy validation. Am J Hypertens. 1990;3:688–696.[Medline] [Order article via Infotrieve]
17. Haas GJ, McCune SA, Brown DM, Cody RJ. Echocardiographic characterization of left ventricular adaptation in a genetically determined heart failure rat model. Am Heart J. 1995;30:806–811.
18. Cody RJ, Binkley PF, Haas GJ, Brown DM. Acute myocardial and vascular responses to specific angiotensin II antagonism in the spontaneously hypertensive rat. Am J Hypertens. 1995;8:500–508.[Medline] [Order article via Infotrieve]
19. Cipkala DA, Livingston WH, Cody RJ. Influence of pressure overload and ACE inhibitor therapy on constitutive protein mRNA expression in the spontaneously hypertensive rat. Am J Hypertens. 1996;9:393–396.[Medline] [Order article via Infotrieve]
20. Ashizawa N, Graf K, Do YS, Nunohiro T, Giachelli CM, Meehan WP, Tuan TL, Hsueh WA. Osteopontin is produced by rat cardiac fibroblasts and mediates A(II)-induced DNA synthesis and collagen gel contraction. J Clin Invest. 1996;98:2218–2227.[Medline] [Order article via Infotrieve]
21. Schorb W, Conrad KM, Singer HA, Dostal DE, Baker KM. Angiotensin II is a potent stimulator of MAP-kinase activity in neonatal rat cardiac fibroblasts. J Mol Cell Cardiol. 1995;27:1151–1160.[Medline] [Order article via Infotrieve]
22. Lee AA, Dillmann WH, McCulloch AD, Villarreal FJ. Angiotensin II stimulates the autocrine production of transforming growth factor-beta 1 in adult rat cardiac fibroblasts. J Mol Cell Cardiol. 1995;27:2347–2357.[Medline] [Order article via Infotrieve]
23.
Burgess ML, Carver WE, Terracio L, Wilson SP, Wilson MA, Borg TK. Integrin-mediated collagen gel contraction by cardiac fibroblasts: effects of angiotensin II. Circ Res. 1994;74:291–298.
24. Meredith JE Jr, Winitz S, McArthur LJ, Hess S, Ren X-D, Renshaw MW, Schwartz MA. The regulation of growth and intracellular signaling by integrins. Endocrine Res. 1996;17:207.
25. Guidry C, Grinnell F. Contraction of hydrated collagen gels by fibroblasts: evidence for two mechanisms by which collagen fibrils are stabilized. Collagen Relat Res. 1986;6:515–529.
26. Schunkert H, Dzau VJ, Tang SS, Hirsch AT, Apstein CS, Lorell BH. Increased rat cardiac angiotensin converting enzyme activity and mRNA expression in pressure overload left ventricular hypertrophy: effects of coronary resistance, contractility, and relaxation. J Clin Invest. 1990;86:1913–1920.
27. Eliceiri BP, Cheresh DA. The role of alphav integrins during angiogenesis: insights into potential mechanisms of action and clinical development. J Clin Invest. 1999;103:1227–1230.[Medline] [Order article via Infotrieve]
28.
Graf K, Do YS, Ashizawa N, Meehan WP, Giachelli CM, Marboe CC, Fleck EW, Hsueh WA. Myocardial osteopontin expression is associated with left ventricular hypertrophy. Circulation. 1997;96:3063–3071.
29. Grimm D, Kromer EP, Bocker W, Bruckschlegal G, Holmer SR, Riegger GA, Schunkert H. Regulation of extracellular matrix proteins in pressure-overload cardiac hypertrophy: effects of angiotensin converting enzyme inhibition. J Hypertens. 1998;16:1345–1355.[Medline] [Order article via Infotrieve]
30.
Hu K, Gaudron P, Anders HJ, Weidemann F, Turschner O, Nahrendorf M, Ertl G. Chronic effects of early started angiotensin converting enzyme inhibition and angiotensin AT1-receptor subtype blockade in rats with myocardial infarction: role of bradykinin. Cardiovasc Res. 1998;39:401–412.
31. Sigel AV, Centrella M, Eghbali-Webb M. Regulation of proliferative response of cardiac fibroblasts by transforming growth factor-beta 1. J Mol Cell Cardiol. 1996;28:1921–1929.[Medline] [Order article via Infotrieve]
32. Kawano H, Do YS, Kawano Y, Starnes V, Barr M, Law RE, Hsueh WA. Angiotensin II has multiple fibrotic effects in human cardiac fibroblasts. Circulation. In press.
This article has been cited by other articles:
 |
|
 |
|
  E. M. de Cavanagh, M. Ferder, F. Inserra, and L. Ferder Angiotensin II, mitochondria, cytoskeletal, and extracellular matrix connections: an integrating viewpoint Am J Physiol Heart Circ Physiol, March 1, 2009; 296(3): H550 - H558. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Caglayan, B. Stauber, A. R. Collins, C. J. Lyon, F. Yin, J. Liu, S. Rosenkranz, E. Erdmann, L. E. Peterson, R. S. Ross, et al. Differential Roles of Cardiomyocyte and Macrophage Peroxisome Proliferator-Activated Receptor {gamma} in Cardiac Fibrosis Diabetes, September 1, 2008; 57(9): 2470 - 2479. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Louis, A. Kakou, V. Regnault, C. Labat, A. Bressenot, J. Gao-Li, H. Gardner, S. N. Thornton, P. Challande, Z. Li, et al. Role of {alpha}1beta1-integrin in arterial stiffness and angiotensin-induced arterial wall hypertrophy in mice Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2597 - H2604. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Sodek, A. P. Batista Da Silva, and R. Zohar Osteopontin and Mucosal Protection Journal of Dental Research, May 1, 2006; 85(5): 404 - 415. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Brassard, F. Amiri, G. Thibault, and E. L. Schiffrin Role of Angiotensin Type-1 and Angiotensin Type-2 Receptors in the Expression of Vascular Integrins in Angiotensin II-Infused Rats Hypertension, January 1, 2006; 47(1): 122 - 127. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Stawowy, C. Margeta, F. Blaschke, C. Lindschau, C. Spencer-Hansch, M. Leitges, G. Biagini, E. Fleck, and K. Graf Protein kinase C epsilon mediates angiotensin II-induced activation of {beta}1-integrins in cardiac fibroblasts Cardiovasc Res, July 1, 2005; 67(1): 50 - 59. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. S Ross Molecular and mechanical synergy: cross-talk between integrins and growth factor receptors Cardiovasc Res, August 15, 2004; 63(3): 381 - 390. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. A Marganski, V. M De Biase, M. L Burgess, and M. Dembo Demonstration of altered fibroblast contractile activity in hypertensive heart disease Cardiovasc Res, December 1, 2003; 60(3): 547 - 556. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Sanada, K. Node, H. Asanuma, H. Ogita, S. Takashima, T. Minamino, M. Asakura, Y. Liao, A. Ogai, J. Kim, et al. Opening of the adenosine triphosphate-sensitive potassium channel attenuates cardiac remodeling induced by long-term inhibition of nitric oxide synthesis: Role of 70-kDa S6 kinase and extracellular signal-regulated kinase J. Am. Coll. Cardiol., September 4, 2002; 40(5): 991 - 997. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Stawowy, F. Blaschke, P. Pfautsch, S. Goetze, F. Lippek, B. Wollert-Wulf, E. Fleck, and K. Graf Increased myocardial expression of osteopontin in patients with advanced heart failure Eur J Heart Fail, March 1, 2002; 4(2): 139 - 146. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Bouzegrhane and G. Thibault Is angiotensin II a proliferative factor of cardiac fibroblasts? Cardiovasc Res, February 1, 2002; 53(2): 304 - 312. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Thibault, M.-J. Lacombe, L. M. Schnapp, A. Lacasse, F. Bouzeghrane, and G. Lapalme Upregulation of alpha 8beta 1-integrin in cardiac fibroblast by angiotensin II and transforming growth factor-beta 1 Am J Physiol Cell Physiol, November 1, 2001; 281(5): C1457 - C1467. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Sanada, M. Kitakaze, K. Node, S. Takashima, A. Ogai, H. Asanuma, Y. Sakata, M. Asakura, H. Ogita, Y. Liao, et al. Differential Subcellular Actions of ACE Inhibitors and AT1 Receptor Antagonists on Cardiac Remodeling Induced by Chronic Inhibition of NO Synthesis in Rats Hypertension, September 1, 2001; 38(3): 404 - 411. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. P. Sodhi, S. A. Phadke, D. Batlle, and A. Sahai Hypoxia Stimulates Osteopontin Expression and Proliferation of Cultured Vascular Smooth Muscle Cells: Potentiation by High Glucose Diabetes, June 1, 2001; 50(6): 1482 - 1490. [Abstract] [Full Text]
|
|
|
|
|
|
J. M. Schnee and W. A. Hsueh Angiotensin II, adhesion, and cardiac fibrosis Cardiovasc Res, May 1, 2000; 46(2): 264 - 268. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Liang, A. Atakilit, and D. G. Gardner Integrin Dependence of Brain Natriuretic Peptide Gene Promoter Activation by Mechanical Strain J. Biol. Chem., June 30, 2000; 275(27): 20355 - 20360. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||