Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 2000;35:704-709

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hengstenberg, C.
Right arrow Articles by Schunkert, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hengstenberg, C.
Right arrow Articles by Schunkert, H.
Related Collections
Right arrow Pathophysiology
Right arrow Epidemiology
Right arrow Genetics of cardiovascular disease

(Hypertension. 2000;35:704.)
© 2000 American Heart Association, Inc.


Scientific Contributions

Evaluation of the Aldosterone Synthase (CYP11B2) Gene Polymorphism in Patients With Myocardial Infarction

Christian Hengstenberg; Stephan R. Holmer; Björn Mayer; Hannelore Löwel; Susanne Engel; Hans-Werner Hense; Günter A. J. Riegger; Heribert Schunkert

From the Klinik und Poliklinik für Innere Medizin II (C.H., S.R.H., B.M., G.A.J.R., H.S.), University of Regensburg, Regensburg; GSF Forschungszentrum (H.L., S.E.), Institut für Epidemiologie, Munich-Neuherberg; and Institut für Epidemiologie und Sozialmedizin (H.-W.H.), University of Münster, Münster, Germany.

Correspondence to Dr Christian Hengstenberg, Klinik und Poliklinik für Innere Medizin II, University of Regensburg, 93042 Regensburg, Germany. E-mail christian.hengstenberg{at}klinik.uni-regensburg.de


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—Left ventricular remodeling after myocardial infarction involves activation of the renin-angiotensin-aldosterone system. Recently, the biallelic -344T/C polymorphism of the aldosterone synthase gene was associated with increased aldosterone levels, arterial hypertension, diastolic dysfunction, and left ventricular dilatation. We hypothesized that this polymorphism may also affect left ventricular geometry and function after myocardial infarction. By using a standardized questionnaire, as well as anthropometric and echocardiographic measurements, we thus studied 606 patients (533 men and 73 women) who had a myocardial infarction before the age of 60 years. The aldosterone synthase gene polymorphism was analyzed after polymerase chain reaction amplification and restriction enzyme digestion. The results demonstrated that there was no association of the aldosterone synthase gene polymorphism with echocardiographically determined left ventricular dimensions, wall thicknesses, or indexes of systolic or diastolic function. Furthermore, anthropometric data, including blood pressure levels, were balanced between the different genotypes. Finally, the allele frequency was similar for patients with myocardial infarction and a sample group from the normal population (n=1675). The data indicate that the allele status of the aldosterone synthase gene polymorphism is not useful for the identification of patients with myocardial infarction who have impaired left ventricular function or unfavorable remodeling.


Key Words: aldosterone • genes • myocardial infarction • cardiac function • echocardiography


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Left ventricular (LV) dilatation after myocardial infarction (MI) involves the activation of neurohormonal systems. Specifically, aldosterone levels have been found to be increased in some patients with MI with profound implications for cardiac remodeling and long-term prognosis.1 2 3 More recently, it was hypothesized that the variability of aldosterone levels may be also affected by a genetic alteration.4 Especially, a cytosine/thymidine (C/T) exchange at position -344 in the regulatory region of the aldosterone synthase gene (CYP11B2) was associated with enlargement and disturbed filling of the LV in healthy young white adults,4 as well as with arterial hypertension in some, but not all, sample groups.5 6 7 Furthermore, the aldosterone synthase gene polymorphism has been shown to potentially influence aldosterone levels.5 Because increased aldosterone levels may be associated with increased LV diameter4 and LV mass,6 8 9 10 we hypothesized that LV remodeling after MI may be affected by this aldosterone synthase gene polymorphism. The aim of the present study was therefore to investigate, first, whether the aldosterone synthase gene polymorphism is associated with poor LV remodeling after MI and, second, whether the aldosterone synthase gene polymorphism is associated with the risk of experiencing MI by comparing the allele frequencies in patients with MI with respective allele frequencies in a large population-based sample.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Study Population
A total of 609 patients with MI were identified through the population-based Monitoring of Trends and Determinants in Cardiovascular Disease (MONICA) MI registry in Augsburg, Germany, and complete phenotypes and genotypes were available for 606 patients with MI. Patients who had an MI before the age of 60 years in the period from 1984 to 1994 were included in the study. From the total of 1254 patients with MI, 580 (46.2%) patients did not respond to our invitation to participate, 65 (5.2%) patients were no longer available (death 2.8%, moving 2.4%), and 609 (48.6%) patients agreed to participate in the study. The echocardiographic examination was performed after a mean of 5.6 years after MI. The clinical diagnoses were validated on the basis of MONICA diagnostic criteria.11 12 All patients were studied with a questionnaire-based interview and anthropometric measurements. According to the same protocols, 1675 individuals were evaluated in population-based MONICA Augsburg surveys in 1994 to 1995, as described previously.6 13 14

Echocardiography
A 2-dimensionally guided M-mode echocardiogram was performed on each patient of the MONICA MI registry by 1 expert sonographer with 1 recorder (Sonos 1500; Hewlett Packard). Only tracings that demonstrated optimal visualization of LV interferences were used, a requirement that resulted in the exclusion of 6.3% of potential subjects for respective data points. Techniques for M-mode–guided measurements of LV structures, as well as the calculation and indexation of LV mass, were reported previously in detail.13 Briefly, the Penn Convention criteria were applied for the measurement of LV dimensions and the calculation of LV mass.15 LV ejection fraction was calculated according to the modified Simpson formula.16

Genotyping
DNA was extracted from peripheral lymphocytes according to standard procedures. Genotyping was carried out according to the methods described by Kupari et al.4 Briefly, DNA samples were amplified in polymerase chain reactions with 10 pmol of both primers (CAGGAGGAGACCCCATGTGAC [sense] and CCTCCACCCTGTTCAGCCC [antisense]) and the protocol of 35 cycles of denaturation at 94°C for 1 minute, 67°C annealing for 1 minute, and 72°C extension for 2 minutes. After polymerase chain reaction amplification, the fragments were digested with HaeIII restriction enzyme, followed by separation of the fragments on a 2.5% agarose gel. The uncut -344T allele (wild type) had a size of 273 bp, and cut fragments (C allele) had a size of 202 bp (plus smaller fragments in each case).

Statistical Analysis
According to the aldosterone -344C/T allele status, continuous data were compared with the use of ANOVA and classified values with {chi}2 tests, respectively. The effect of the -344C/T allele status on LV mass index, LV end-diastolic dimension, fractional shortening, LV ejection fraction, isovolumetric relaxation period, and ratio of early to late diastolic filling of the LV (E/A ratio) was examined with multiple linear regression analysis after adjustment for age, gender, body mass index, systolic blood pressure, and the use of antihypertensive therapy. Furthermore, the study samples were partitioned by infarct location, gender, age (<55 or >=55 years), hypertension status, and the presence or absence of hypercholesterolemia, diabetes mellitus, cigarette smoking, or LV hypertrophy. LV hypertrophy was defined as an LV mass index of >=134 g/m2 in men or >=110 g/m2 in women. Hypertension was defined as systolic blood pressure of >=140 mm Hg or diastolic blood pressure of >=90 mm Hg or when antihypertensive medication was taken on regular basis. In multivariate regression analysis, the corresponding ß-coefficients were computed. At an {alpha} error of 5%, the present study sample provided a power of 78.7% to detect a difference in LV end-diastolic diameter of 1.12 mm between the respective genotype groups. Probability values are reported for each test and statistical model.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
The anthropometric data for patients with MI are shown in Table 1. In individuals from the MI registry (total 606: 533 men, 73 women), the frequencies of the aldosterone synthase genotypes were in Hardy-Weinberg equilibrium. There was no difference in systolic or diastolic functional parameters of the LV in the aldosterone synthase polymorphism genotype groups (Tables 1, 2, and 3). Grouping of the diastolic parameters, such as E/A ratio >1 or isovolumetric relaxation time in quartiles, showed no differences in the genotype groups. Furthermore, neither univariate analysis (Table 2) nor multivariate analysis (Table 4) showed any statistically significant difference in LV end-diastolic dimension, LV wall thickness, or LV mass associated with the aldosterone synthase genotype groups. Given that the location of the MI affects the remodeling of infarcted and noninfarcted walls differently, we analyzed patients with anterior (n=264) and posterior (n=342) MI separately. However, LV wall thicknesses, LV diameters, and LV mass, as well as systolic and diastolic LV function, also were not affected by the -344T/C aldosterone synthase gene polymorphism in these subgroups (Table 3).


View this table:
[in this window]
[in a new window]
 
Table 1. Anthropometric and Demographic Data of Patients with MI According to the -344C/T Polymorphism in the Aldosterone Synthase Gene


View this table:
[in this window]
[in a new window]
 
Table 2. Echocardiographic Data of Patients with MI According to the -344C/T Polymorphism in the Aldosterone Synthase Gene


View this table:
[in this window]
[in a new window]
 
Table 3. Echocardiographic Data of Patients With Anterior and Posterior MI According to the -344C/T Polymorphism in the Aldosterone Synthase Gene


View this table:
[in this window]
[in a new window]
 
Table 4. Multiple Linear Regression: Influence of the Aldosterone Synthase Gene Polymorphism on Structure and Function of the LV in Patients With MI

To examine possible effects of the polymorphism in specific subgroups, we divided the MI patient sample according to the presence or absence of coronary risk factors. No significant influence could be demonstrated on LV end-diastolic diameter (Tables 5 and 6) or other structural or functional parameters that were examined (data not shown). Furthermore, the percentage of patients using ACE inhibitors, diuretics, ß-blockers, calcium antagonists, antiplatelet medication, or anticoagulant medication was similar in the different genotype groups (data not shown).


View this table:
[in this window]
[in a new window]
 
Table 5. Presence of Cardiovascular Risk Factors in Patients With MI According to the -344C/T Polymorphism in the Aldosterone Synthase Gene


View this table:
[in this window]
[in a new window]
 
Table 6. Frequencies of the Aldosterone Synthase Gene Polymorphism in Normal Population and in Patients With MI in All Individuals and in Different Subgroups

In the population-based survey sample (total 1675: 825 men, 850 women), the frequencies of the aldosterone synthase -344C allele were also in Hardy-Weinberg equilibrium and were similar to those in patients with MI (0.45 and 0.44 in men and 0.43 and 0.47 in women, respectively; P=NS). Likewise, the -344TT, -344CT, and -344CC genotypes were found at similar frequencies in patients with MI and in participants of the population-based survey, respectively (Table 6). Similar results were obtained after adjustment for potential confounding factors (age, gender, body mass index, systolic blood pressure, and antihypertensive drug treatment) (data not shown) and after stratification into subgroups defined by the presence or absence of coronary risk factors (Table 6). Given the limitations of such case-control analysis, we examined whether the lack of difference in allele frequencies between the MI registry and the survey population might be explained by differences in the size or location of infarctions or the age at the time of infarction (ie, factors that might affect survival after infarction). However, the lack of association between the aldosterone synthase gene polymorphism and MI could not be explained by differences in genotype groups with respect to the time that had elapsed between the first MI and presentation at the study center (Table 1) or by differences in the age at the time of the MI or in the localization or size of the MI (Table 3).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
A strong association between the -344C allele of the aldosterone synthase gene polymorphism and increased LV diameter and LV mass, as well as impaired diastolic function, has been reported in a previous study of 84 young and healthy individuals.4 In the present study, no such associations were found in a large number of long-term survivors of MI. Moreover, the aldosterone synthase -344C/T allele frequencies were equally distributed in a population-based sample and in the present sample of patients with MI. Along with similar distributions of MI size and location in various genotype groups, these data may indicate that there is no strong association between the aldosterone synthase gene polymorphism and the risk of experiencing MI as well as the risk of presenting with poor remodeling after MI.

The discrepancy of the previous positive4 and the present negative results may be explained by the fact that the previous study was conducted with apparently healthy young individuals, whereas the present study was conducted with patients with MI. Most of the present study patients were taking antihypertensive medication, including ACE inhibitors and ß-blockers, that might affect aldosterone levels. Furthermore, ethnic differences between the previous (Finnish) and the present (German) population samples may account for the differences. This point may be of specific relevance if the -344 allele status is a marker for another genetic alteration. In particular, the aldosterone synthase gene locus may be in close proximity to such causal mutation, which occurs, therefore, in linkage disequilibrium with the -344T/C polymorphism, at least in the isolate Finnish population.17

Albeit the differences in the design between the previous4 and the present study may account for the different results, these data are not in favor of a strong influence of the aldosterone synthase -344C/T polymorphism on LV size and function in a western European population. First, the aldosterone synthase gene polymorphism has no proved effect on potential intermediate phenotypes such as increased serum aldosterone levels or increased blood pressure that might affect cardiac remodeling. Specifically, data on the association with serum aldosterone levels are discrepant, with 1 study showing the highest levels in the CC genotype group,18 2 studies showing the highest levels in the TT genotype group,7 19 and 1 study showing no association.6 Moreover, data on the association with blood pressure levels are largely negative, including the present study on patients with MI.4 6 8 9 18 This may be of interest because other known mutations of the aldosterone synthase gene have in common an affect on both aldosterone levels and blood pressure.20 Second, the allele status of the aldosterone synthase gene polymorphism had no effect on LV size and function in a large population-based sample.6

A limitation of the present study is that only survivors of MI were included. Thus, the apparent lack of association might result from LV dilatation and poor prognosis that occur in patients with sudden or early death after MI. Although this limitation cannot be excluded in any patient population that has been sampled after MI, selection by survival is unlikely because, first, the distribution of aldosterone synthase genotypes was equal in patients with MI and a large population-based sample and, second, there was no relation between allele status and age at MI, size or location of MI, or time elapsed since MI and the echocardiographic study.

Therefore, on the basis of the anthropometric and echocardiographic data and the examination of the aldosterone synthase gene polymorphism in patients with MI and a large population-based sample, we conclude that this polymorphism is not a strong risk factor for MI and does not appear to influence LV remodeling after MI.


*    Acknowledgments
 
This study was supported by the Deutsche Forschungsgemeinschaft (DFG grants Schu672/9-1, Schu672/10-1, Schu672/12-1, and Ho1073/8-1), the Bundesministerium für Forschung und Technologie (grant FKZ 01ER9502/0 to Dr Löwel and grant KBF-FKZ 01GB9403 to Dr Hense), the Wilhelm-Vaillant-Stiftung (to Drs Hengstenberg and Schunkert), and the Deutsche Stiftung für Herzforschung (to Drs Hengstenberg and Schunkert). We gratefully acknowledge the excellent technical assistance of Melanie Wolf, Annette Walgenbach, and Susanne Kürzinger.

Received August 5, 1999; first decision September 3, 1999; accepted November 11, 1999.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 

  1. Rouleau JL, Packer M, Moye L, de Champlain J, Bichet D, Klein M, Rouleau JR, Sussex B, Arnold JM, Sestier F. Prognostic value of neurohumoral activation in patients with an acute myocardial infarction: effect of captopril. J Am Coll Cardiol. 1994;24:583–591.[Abstract]
  2. White PC. Disorders of aldosterone biosynthesis and action. N Engl J Med. 1994;331:250–258.[Free Full Text]
  3. Weber KT, Sun Y, Campbell SE, Slight SH, Ganjam VK, Griffing GT, Swinfard RW, Diaz-Arias AA. Chronic mineralocorticoid excess and cardiovascular remodeling. Steroids. 1995;60:125–132.[Medline] [Order article via Infotrieve]
  4. Kupari M, Hautanen A, Lankinen L, Koskinen P, Virolainen J, Nikkila H, White PC. Associations between human aldosterone synthase (CYP11B2) gene polymorphisms and left ventricular size, mass, and function. Circulation. 1998;97:569–575.[Abstract/Free Full Text]
  5. Tamaki S, Iwai N, Tsujita Y, Kinoshita M. Genetic polymorphism of CYP11B2 gene and hypertension in Japanese. Hypertension. 1999;33:266–270.[Abstract/Free Full Text]
  6. Schunkert H, Hengstenberg C, Holmer SR, Broeckel U, Luchner A, Muscholl MW, Kürzinger S, Döring A, Hense HW, Riegger GAJ. Lack of association between a polymorphism of the aldosterone synthase gene and left ventricular structure. Circulation. 1999;99:2255–2260.[Abstract/Free Full Text]
  7. Brand E, Chatelain N, Mulatero P, Fery I, Curnow K, Jeunemaitre X, Corvol P, Pascoe L, Soubrier F. Structural analysis and evaluation of the aldosterone synthase gene in hypertension. Hypertension. 1998;32:198–204.[Abstract/Free Full Text]
  8. Duprez DA, Bauwens FR, De Buyzere ML, De Backer TL, Kaufman JM, Van Hoecke J, Vermeulen A, Clement DL. Influence of arterial blood pressure and aldosterone on left ventricular hypertrophy in moderate essential hypertension. Am J Cardiol. 1993;71:17A–20A.[Medline] [Order article via Infotrieve]
  9. Navarro-Lopez F, Coca A, Pare JC, de la Sierra A, Bosch X, Urbano Marquez A. Left ventricular hypertrophy in asymptomatic essential hypertension: its relationship with aldosterone and the increase in sodium-proton exchanger activity. Eur Heart J. 1993;14(suppl J):38–41.
  10. Muscholl M, Schunkert H, Muders F, Elsner D, Kuch B, Hense HW, Riegger GAJ. Neurohormonal activity and left ventricular geometry in patients with essential arterial hypertension. Am Heart J. 1998;135:58–66.[Medline] [Order article via Infotrieve]
  11. Löwel H, Lewis M, Hörmann A, Keil U. Case finding, data quality aspects, and comparability of myocardial infarction registers: results of a Southern German register study. J Clin Epidemiol. 1991;44:249–260.[Medline] [Order article via Infotrieve]
  12. Tunstall-Pedoe H, Kuulasmaa K, Amouyel P, Arveiler D, Rajakangas AM, Pajak A. Myocardial infarction and coronary deaths in the World Health Organization MONICA Project: registration procedures, event rates, and case fatality rates in 38 populations from 21 countries in four continents. Circulation. 1994;90:583–612.[Abstract/Free Full Text]
  13. Muscholl M, Hense HW, Bröckel U, Döring A, Riegger GAJ, Schunkert H. Alterations of left ventricular geometry and function in subjects with white coat hypertension. BMJ. 1998;317:565–570.[Abstract/Free Full Text]
  14. Schunkert H, Hense HW, Danser J, Muscholl M, Luchner A, Riegger AJG. Association between circulating components of the renin-angiotensin-aldosterone system and left ventricular mass. Heart. 1997;77:24–31.[Abstract/Free Full Text]
  15. Devereux RB, Reicek N. Echocardiographic determination of left ventricular mass in man: anatomic validation of the method. Circulation. 1977;55:613–618.[Abstract/Free Full Text]
  16. Schiller NB, Shah PM, Crawford M, DeMaria A, Devereux R, Feigenbaum H, Gutfesell H, Reichek N, Sahn D, Schnittger I, Silverman NH, Tajik AJ. Recommendations for the quantification of the left ventricle by two-dimensional echocardiography. J Am Soc Echocardiogr. 1989;2:358–367.[Medline] [Order article via Infotrieve]
  17. Cavalli-Sforza LL, Piazza A. Human genomic diversity in Europe: a summary of recent research and prospects for the future. Eur J Hum Genet. 1993;1:3–18.[Medline] [Order article via Infotrieve]
  18. Pojoga L, Gautier S, Blanc H, Guyene TT, Poirier O, Cambien F, Benetos A. Genetic determination of plasma aldosterone levels in essential hypertension. Am J Hypertens. 1998;11:856–860.[Medline] [Order article via Infotrieve]
  19. Davies E, Holloway CD, Ingram MC, Inglis GC, Friel EC, Morrison C, Anderson NH, Fraser R, Connell JMC. Aldosterone excretion rate and blood pressure in essential hypertension are related to polymorphic differences in the aldosterone synthase gene CYP11B2. Hypertension. 1999;33:703–707.[Abstract/Free Full Text]
  20. Lifton RP, Dluhy RG, Powers M, Rich GM, Gutkin M, Fallo F, Gill JR Jr, Feld L, Ganguly A, Laidlaw JC, Murnagham DJ, Kaufman C, Stockigt JR, Ulrick C, Lalouel JM. Hereditary hypertension caused by chimaeric gene duplications and ectopic expression of aldosterone synthase. Nat Genet. 1992;2:66–74.[Medline] [Order article via Infotrieve]



This article has been cited by other articles:


Home page
HeartHome page
S Sookoian, T F Gianotti, and C J Pirola
Role of the C-344T aldosterone synthase gene variant in left ventricular mass and left ventricular structure-related phenotypes
Heart, July 1, 2008; 94(7): 903 - 910.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. C. White and W. E. Rainey
Polymorphisms in CYP11B Genes and 11-Hydroxylase Activity
J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1252 - 1255.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. C. White
Aldosterone: Direct Effects on and Production by the Heart
J. Clin. Endocrinol. Metab., June 1, 2003; 88(6): 2376 - 2383.
[Full Text] [PDF]


Home page
CirculationHome page
S. R. Holmer, C. Hengstenberg, H.-G. Kraft, B. Mayer, M. Poll, S. Kurzinger, M. Fischer, H. Lowel, G. Klein, G. A.J. Riegger, et al.
Association of Polymorphisms of the Apolipoprotein(a) Gene With Lipoprotein(a) Levels and Myocardial Infarction
Circulation, February 11, 2003; 107(5): 696 - 701.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hengstenberg, C.
Right arrow Articles by Schunkert, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hengstenberg, C.
Right arrow Articles by Schunkert, H.
Related Collections
Right arrow Pathophysiology
Right arrow Epidemiology
Right arrow Genetics of cardiovascular disease