This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Tsuruda, T. Articles by Eto, T. Search for Related Content PubMed PubMed Citation Articles by Tsuruda, T. Articles by Eto, T. Pubmed/NCBI databases Substance via MeSH Related Collections Other myocardial biology ACE/Angiotension receptors Hypertrophy

(Hypertension. 2000;35:1210.)
© 2000 American Heart Association, Inc.

Scientific Contributions

Enhanced Adrenomedullin Production by Mechanical Stretching in Cultured Rat Cardiomyocytes

Toshihiro Tsuruda; Johji Kato; Kazuo Kitamura; Takuroh Imamura; Yasushi Koiwaya; Kenji Kangawa; Issei Komuro; Yoshio Yazaki; Tanenao Eto

From the First Department of Internal Medicine (T.T., J.K., K. Kitamura, T.I., Y.K., T.E.), Miyazaki Medical College, Kihara Kiyotake, Miyazaki, Japan; Department of Biochemistry (K. Kangawa), National Cardiovascular Center Research Institute, Fujishirodai, Suita, Osaka, Japan; and Department of Cardiovascular Medicine (I.K., Y.Y.), University of Tokyo Graduate School of Medicine, Hongo, Bunkyo-ku, Tokyo, Japan.

Correspondence to Dr Tanenao Eto, First Department of Internal Medicine, 5200 Kihara, Kiyotake, Miyazaki 889-1692, Japan. E-mail keto{at}post.miyazaki-med.ac.jp

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Abstract—Adrenomedullin (AM) is secreted from cultured cardiac myocytes. In this study, we examined whether mechanical stretching stimulates AM production in cardiac myocytes, and if so, whether angiotensin II (Ang II) is involved in that mechanism. Neonatal rat cardiac myocytes cultured in serum-free medium were stretched 10% or 20% on flexible silicone rubber culture dishes, and AM mRNA expression was examined by quantitative polymerase chain reaction. The AM mRNA levels in the myocytes stretched 10% and 20% for 24 hours significantly increased by 56% (P<0.05) and 88% (P<0.01), respectively, when compared with the levels in nonstretched cells. AM secretion into the medium after the myocytes were stretched 10% and 20% increased by 22% (P<0.05) and 45% (P<0.01), respectively. In nonstretched myocytes incubated with 10^-6 mol/L Ang II for 24 hours, AM mRNA and secretion increased by 86% (P<0.05) and 36% (P<0.01), respectively. These effects of Ang II were abolished by 10^-6 mol/L CV-11974, an Ang II type I (AT₁) receptor antagonist, but not by 10^-6 mol/L PD-123319, an Ang II type II antagonist. Stretch-induced increases of AM gene expression and secretion were significantly inhibited (P<0.05) in the presence of 10^-6 mol/L CV-11974 by 46% and 52%, respectively; however, they were not affected by 10^-6 mol/L PD-123319. These findings indicate that AM production from cardiac myocytes is augmented by mechanical stretching, partially through the AT₁ receptors, which suggests a local interaction between AM and the renin-angiotensin system in stretched cardiac myocytes.

Key Words: adrenomedullin • hypertrophy • mechanical stretch • angiotensin II • receptors, angiotensin

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Left ventricular hypertrophy has been shown to be an important risk factor for cardiovascular disease.^{1 2} Cardiac hypertrophy is basically an adaptation mechanism that develops in response to an increased cardiac workload, but it can ultimately progress to heart failure. Substantial evidence^{3 4} suggests that mechanical load is an important factor in the process of cardiac hypertrophy, and recent studies^{5 6 7 8} indicate that humoral factors such as angiotensin II (Ang II) or endothelin-1 (ET-1) also play an important role in hypertrophy in cardiomyocytes and hyperplasia of the interstitial space in the heart. Adrenomedullin (AM) is a potent vasorelaxant peptide discovered in human pheochromocytomas.⁹ AM mRNA is expressed in various organs of rats and humans, including the normal adrenal medulla and cardiac ventricle.^{10 11} Recent reports^{12 13 14 15} have shown that AM content and mRNA expression in the hypertrophic left ventricle induced by hemodynamic overload are increased when compared with levels in normal rats. We have shown that AM is synthesized and secreted from cultured neonatal rat cardiac myocytes and fibroblasts and that secreted AM acts on the myocytes to inhibit hypertrophy and on the fibroblasts to inhibit growth. This suggests the possible role of AM in modulating cardiac hypertrophy and interstitial fibrosis.^{16 17} However, little is known about the mechanisms that regulate AM synthesis and secretion in the cardiac ventricle. To determine whether mechanical stretching stimulates AM production we stretched neonatal rat cardiac myocytes cultured on silicone rubber dishes and then measured AM gene expression and secretion. We also used Ang II receptor antagonists to evaluate the role of the local renin-angiotensin system in stretch-induced AM production.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Chemicals
Ang II and rat AM were purchased from Peptide Institute Inc. CV-11974 was a gift from Takeda Chemical Industries Ltd, Osaka, Japan, and PD-123319 was purchased from Research Biochemicals International. Holo-transferrin (human), collagenase (type IV), and trypsin (bovine pancreas) were purchased from Sigma Chemical Co, and fibronectin was obtained from Collaborative Biomedical.

Cell Culture
Primary cultures of cardiac myocytes were prepared from cardiac ventricles of 1- to 2-day-old Wistar rats as described previously.¹⁶ Digestion of the minced ventricles was accomplished with 0.12% trypsin and 0.03% collagenase, after which cells were placed in culture dishes for 30 minutes at 37°C to allow selective attachment of nonmyocytes (primarily cardiac fibroblasts). Cardiomyocyte-enriched suspensions were removed from the culture dishes and were plated at a density of 1x10⁵ cells/cm² onto collagen type I–coated 24-well culture plates (Sumitomo Bakelite Co Ltd) or silicone rubber dishes that had been coated with fibronectin. Cells were cultured for 48 hours with DMEM containing 15 mmol/L HEPES, 10% fetal bovine serum, 10 µg/mL insulin, 10 µg/mL transferrin, and 0.1 mmol/L bromodeoxyuridine (BrdU). The culture medium was then exchanged for serum-free DMEM containing the same additives with the exception of BrdU. After having been incubated for 24 hours, the cardiomyocytes were exposed to Ang II or were stretched 10% or 20% on the silicone dishes with or without the Ang II receptor antagonists.

These experiments were performed according to the regulations of the Animal Research Committee of Miyazaki Medical College (1998-037-2). This investigation conformed with the Guide for Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No.85-23, revised 1996).

Assay of AM in Conditioned Medium
Conditioned medium collected from 24-well culture plates or from silicone dishes was acidified with acetic acid to a final concentration of 1.0 mol/L. The medium was heated at 100°C for 10 minutes to inactivate proteases and was applied to a Sep-Pak C18 cartridge (Millipore-Waters). After the cartridge was washed with 10% CH₃CN in 0.1% trifluoroacetic acid, the adsorbed materials were eluted with 60% CH₃CN in 0.1% trifluoroacetic acid, lyophilized, and stored at -30°C. The lyophilized samples were dissolved in radioimmunoassay (RIA) buffer and were subjected to RIA for rat AM as described previously.¹¹ The recovery of AM in this assay procedure was 82%.

AM mRNA Measurement by Real-Time Quantitative Polymerase Chain Reaction
Total RNA Isolation Reagent (GIBCO BRL) was used to extract 2 µg of total RNA, which then underwent reverse-transcription by means of SuperScript reverse transcriptase (Life Technologies Inc) into cDNA. To measure rat AM mRNA levels, we used a novel quantitative polymerase chain reaction (PCR) method, Real-Time Quantitative PCR (Prism 7700 Sequence Detector, Applied Biosystems) as previously reported,¹⁸ with the following oligonucleotide probes labeled with 6-carboxyfluorescein as reporter fluorescence and 6-carboxytetramethyl-rhodamine as quencher fluorescence: CCCACAAGCCAGCACTCAGAGCAC (nucleotides 387 to 410) for AM¹⁹ and ATCACCATCTTCCAGGAGCGCGAT (nucleotides 244 to 267) for GAPDH.²⁰ cDNA of rat AM and GAPDH was amplified with the following pairs of oligonucleotides: CGCAGTTCCGAAAGAAGTGG (nucleotides 236 to 255, forward primer) and CGTTTGACTCGAATGTGGGC (nucleotides 412 to 431, reverse primer) for AM cDNA¹⁹ and CGGCAAGTTCAATGGCACA (nucleotides 183 to 201, forward primer) and AAGACGCCAGTAGACTCCACGA (nucleotides 308 to 329, reverse primer) for GAPDH.²⁰ cDNA from rat lungs was used as a standard and levels of AM mRNA were compared after they had been normalized relative to those of GAPDH.

Statistical Analysis
Student’s t test was used for comparison of the 2 variables. Multiple comparison was assessed first with 1-way ANOVA and then with the Scheffé test. All data were expressed as the mean±SEM of the samples examined; P<0.05 was considered significant. Cells isolated separately from different groups of neonatal rats were used to repeat the experiments, and identical results were obtained.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Mechanical Stretching Augments AM Production from Cardiac Myocytes
To examine whether mechanical stretching affects AM synthesis and secretion, cultured cardiac myocytes were stretched on silicone dishes for 24 hours. AM mRNA expression in cells stretched 10% and 20% increased by 56% (P<0.05) and 88% (P<0.01), respectively, when compared with the levels of AM mRNA expression in nonstretched myocytes (Figure 1A). AM secretion from cells stretched 10% and 20% also increased by 22% (P<0.05) and 45% (P<0.01), respectively, when compared with the AM secretion in controls (Figure 1B). To examine the sequential changes of the rate of AM secretion, we collected conditioned medium of stretched or nonstretched myocytes every 4 hours and measured the AM concentration. As shown in Figure 2, the AM secretion rates from the nonstretched myocytes were almost constant throughout the 24-hour incubation period. During the first 4 hours of incubation, no significant difference occurred in the AM secretion of the stretched and nonstretched cells. A significantly higher rate of AM secretion was evident in the stretched myocytes at 8 hours of incubation compared with the rate in the nonstretched cells, and this elevation was sustained for up to 24 hours.

View larger version (38K): [in this window] [in a new window]   Figure 1. Effects of mechanical stretching on AM gene expression (A) and secretion (B) in cultured cardiac myocytes. Cardiac myocytes were stretched 10% or 20% on silicone rubber dishes for 24 hours. The conditioned media were changed to fresh serum-free media at 20 hours after the stretching procedure, and the AM mRNA level and AM secreted during the last 4 hours of the incubation period were measured as described in Methods. Results are presented as the mean±SEM of cultures of cells isolated independently from 3 different groups of rats. The numbers of dishes examined are indicated in parentheses. *P<0.05, **P<0.01, vs nonstretched cells; #P<0.05, vs cells stretched 10%.

View larger version (29K): [in this window] [in a new window]   Figure 2. Sequential changes of AM secretion rates from stretched or nonstretched cardiac myocytes. Conditioned media of stretched or nonstretched myocytes were collected every 4 hours. Results are presented as the mean±SEM of 6 to 7 samples from 2 independent experiments. *P<0.05, **P<0.01, vs nonstretched myocytes at each time period.

Ang II Stimulates AM Production via Ang II Type 1 Receptors
To examine the effect of Ang II on AM production and the type of receptor mediating the action of Ang II, nonstretched cultured cardiac myocytes were treated with 10^-6 mol/L of synthetic Ang II in the presence or absence of either 10^-6 mol/L CV-11974, an Ang II type 1 (AT₁) receptor specific antagonist or 10^-6 mol/L PD-123319, an Ang II type 2 (AT₂) receptor antagonist. We used Ang II at a concentration of 10^-6 mol/L, which produced the maximum level of response in both AM mRNA expression and AM secretion when compared with the levels produced by concentrations of 10^-5 mol/L or those <10^-6 mol/L. As shown in Figures 3A and 3B, CV-11974 produced no significant effect on the basal levels of AM mRNA expression and secretion, but PD-123319 slightly reduced those levels, although the reductions were not significant. The levels of both AM mRNA and AM secretion in the myocytes incubated with Ang II for 24 hours increased by 86% (P<0.05) and 36% (P<0.01), respectively, when compared with those levels in untreated cells. The effects of Ang II were completely abolished by CV-11974, but little effect was produced by PD-123319.

View larger version (46K): [in this window] [in a new window]   Figure 3. Effects of Ang II receptor antagonists on basal and Ang II–induced AM gene expression (A) and secretion (B) in cultured cardiac myocytes. Cultured cardiac myocytes were incubated with or without 10-6 mol/L Ang II in the presence or absence of 10-6 mol/L CV-11974 or PD-123319 for 24 hours. The Ang II receptor antagonists were added 1 hour before incubation with Ang II. Results are presented as the mean±SEM of cultures of cells from 2 independent experiments. The numbers of wells examined are indicated in parentheses. *P<0.05, **P<0.01, vs control cells; ##P<0.01 vs those treated with Ang II without an antagonist.

Mechanical Stretching Stimulates AM Production in Part via the AT₁ Receptors
To clarify the role of the endogenous renin-angiotensin system in stretch-induced AM production, the myocytes were stretched 20% for 24 hours in the presence or absence of the Ang II receptor antagonists. As shown in Figures 4A and 4B, when myocytes were incubated with CV-11974, the stretch-induced increases of AM mRNA expression and AM secretion were significantly attenuated (P<0.05) by 46% and 52% respectively; however, PD-123319 produced little effect on the stretch-stimulated AM gene expression and secretion. To evaluate Ang II secretion from the myocytes, we measured Ang II concentrations in the conditioned media of the control cells and of the cells stretched for 30 minutes or 24 hours by a specific radioimmunoassay.²¹ The Ang II levels in most of the samples from those myocytes were < 3.0x10^-12 mol/L, a level undetectable by our assay.

View larger version (43K): [in this window] [in a new window]   Figure 4. Effects of AT1 or AT2 receptor antagonists on stretch-induced AM gene expression (A) and secretion (B) in cardiac myocytes. Cardiac myocytes were stretched 20% in the presence or absence of 10-6 mol/L CV-11974 or PD-123319 for 24 hours. The Ang II receptor antagonists were added 1 hour before the stretching procedure. The conditioned media were changed to fresh serum-free media at 20 hours after the stretching procedure, and the AM mRNA level and AM secreted during the last 4 hours of the incubation were measured as described in Methods. Results are presented as the mean±SEM of cultures of cells from 3 independent experiments. The numbers of dishes examined are indicated in parentheses. **P<0.01 vs nonstretched cells; #P<0.05 vs cells stretched without an Ang II receptor antagonist.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
AM mRNA is expressed in various tissues and organs of rats and humans, including the normal adrenal medulla, cardiac atrium, and ventricle.^{10 11} AM is also present in human blood,¹¹ and Sumimoto et al²² showed an elevated plasma AM level in patients with hypertension, particularly in those with left ventricular hypertrophy. Previous studies^{12 13 14 15} showed that AM gene expression and AM content are increased in rats with hypertrophy of the cardiac ventricles induced by hemodynamic overload when compared with control rats. In this study, we found that mechanical stretching stimulates AM mRNA expression and AM secretion in cultured cardiac myocytes. When compared with the levels of gene expression and immunoreactive AM in the conditioned media, the increments in immunoreactive AM were smaller than those of AM mRNA in the myocytes that had been stretched or treated with Ang II. According to our unpublished observation, 47% of 10^-7 mol/L of unlabelled AM added to the media disappeared after 24 hours of incubation with the cardiac myocytes, which suggests nonspecific or specific receptor binding or clearance of AM by the cells. The myocytes may be producing more AM than that detected in the conditioned media. It has been suggested that AM is secreted in a constitutive manner with a little intracellular storage from various types of cultured cells, including cardiac myocytes.^{16 17 23} In this study, the nonstretched myocytes constantly produced AM, and a significant increase in AM secretion occurred in the myocytes that had been stretched for 8 hours. This finding confirms those of previous observations¹⁶ about the constitutive secretion of AM.

In cultured vascular smooth muscle cells, AM production is increased in the presence of Ang II, ET-1, or cytokines such as tumor necrosis factor- (TNF-) and interleukin-1ß (IL-1ß).^{23 24} AM production is stimulated by TNF- and IL-1ß in cultured cardiac myocytes and fibroblasts.²⁵ In this study, synthetic Ang II stimulated AM mRNA expression and AM secretion in cultured cardiac myocytes. Those effects were completely abolished by CV-11974 (an AT₁ receptor antagonist) but were only slightly diminished by PD-123319, an AT₂ receptor antagonist. Because Ang II produced by cardiac myocytes is an important factor in hypertrophy stimulated by mechanical stretching,^{26 27} we examined the role of endogenous Ang II in stretch-induced AM production. As shown in Figure 4, CV-11974 significantly reduced the AM production in the stretched myocytes, whereas PD-123319 had little effect, which suggests that stretch-induced AM production is mediated in part by endogenous Ang II acting through the AT₁ receptor. We also evaluated Ang II production from the cells by measuring Ang II concentrations in the control cells and in stretched myocytes, but the concentrations were <3.0x10^-12 mol/L, a level too low to be detected. This concentration is much lower than that of synthetic Ang II, which significantly elevated AM production in this study. Ang II levels in the cell surface or in extracellular cell-to-cell spaces may be higher than those in conditioned media, although this discrepancy is unexplained and should be the topic of future research.

CV-11974 did not reduce stretch-induced AM gene expression and secretion to the levels observed in controls, in spite of the complete inhibition of exogenous Ang II–induced AM production by that AT₁ antagonist in nonstretched myocytes. The AM mRNA expression and secretion were slightly reduced by PD-123319 in the control cells and in cells treated with Ang II. Horio et al²⁵ reported that Ang II had no significant effect on AM production in cultured cardiac myocytes isolated by a Percoll gradient that is apparently different from ours. The discrepancy between their results and ours suggests that a type of cell isolated by our method but not by theirs may be necessary for the Ang II– or stretch-induced AM production. Recently, nonmyocytes that secrete ET-1 were shown to have an important role in the Ang II–induced hypertrophy of cardiomyocytes.²⁸ We observed that AM secretion from myocytes is augmented not only by Ang II but also by ET-1 or by fetal bovine serum that contains various growth-promoting factors (data not shown). Although endogenous Ang II acting through the AT₁ receptors seems important, other mechanisms including the AT₂ receptors, ET-1, or other growth-promoting factors may also be involved in the Ang II-induced or stretch-induced AM production. We have shown that AM attenuates Ang II–stimulated hypertrophy of cardiomyocytes and growth of cardiac fibroblasts,^{16 17} which suggests the possible role of AM in modulating cardiac hypertrophy and in remodeling as an autocrine or a paracrine factor. Augmentation of AM secretion from the myocytes by mechanical stretching supports our hypothesis that AM participates in the mechanism acting against cardiomyocyte hypertrophy, which is induced by hemodynamic overload of the heart.

In summary, this study revealed that mechanical stretching augments AM production from cultured cardiac myocytes, partially through the AT₁ receptors, which suggests interaction of the local renin-angiotensin system and AM in stretched myocytes.

	Acknowledgments

 
This study was supported by Grants-in-Aid for Scientific Research from the Ministry of Education, Science, Sports and Culture in Japan. We are grateful to Drs Koji Nozaki and Jun Hino from the Department of Biochemistry at the National Cardiovascular Center Research Institute for their technical advice regarding Real-Time Quantitative PCR. We thank Mari Kawamoto for her technical assistance.

Received July 28, 1999; first decision August 25, 1999; accepted January 7, 2000.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Levy D, Garrison RJ, Savage DD, Kannel WB, Castelli WP. Prognostic implications of echocardiographically determined left ventricular mass in the Framingham Heart Study. N Engl J Med. 1990;322:1561–1566.[Abstract]

2. Mosterd A, D’Agostino RB, Silbershatz H, Sytkowski PA, Kannel WB, Grobbee DE, Levy D. Trends in the prevalence of hypertension, antihypertensive therapy, and left ventricular hypertrophy from 1950 to 1989. N Engl J Med. 1999;340:1221–1227.[Abstract/Free Full Text]

3. Komuro I, Katoh Y, Kaida T, Shibazaki Y, Kurabayashi M, Hoh E, Takaku F, Yazaki Y. Mechanical loading stimulates cell hypertrophy and specific gene expression in cultured rat cardiac myocytes: possible role of protein kinase C activation. J Biol Chem. 1991;266:1265–1268.[Abstract/Free Full Text]

4. Sadoshima J, Jahn L, Takahashi T, Kulik TJ, Izumo S. Molecular characterization of the stretch-induced adaptation of cultured cardiac cells: an in vitro model of load-induced cardiac hypertrophy. J Biol Chem. 1992;267:10551–10560.[Abstract/Free Full Text]

5. Sadoshima J, Izumo S. Molecular characterization of angiotensin II-induced hypertrophy of cardiac myocytes and hyperplasia of cardiac fibroblasts: critical role of the AT₁ receptor subtype. Circ Res. 1993;73:413–423.[Abstract/Free Full Text]

6. Ito H, Hirata Y, Hiroe M, Tsujino M, Adachi S, Takamoto T, Nitta M, Taniguchi K, Marumo F. Endothelin-1 induces hypertrophy with enhanced expression of muscle-specific genes in cultured neonatal rat cardiomyocytes. Circ Res. 1991;69:209–215.[Abstract/Free Full Text]

7. Schorb W, Booz GW, Dostal DE, Conrad KM, Chang KC, Baker KM. Angiotensin II is mitogenic in neonatal rat cardiac fibroblasts. Circ Res. 1993;72:1245–1254.[Abstract/Free Full Text]

8. Fujisaki H, Ito H, Hirata Y, Tanaka M, Hata M, Lin M, Adachi S, Akimoto H, Marumo F, Hiroe M. Natriuretic peptides inhibit angiotensin II-induced proliferation of rat cardiac fibroblasts by blocking endothelin-1 gene expression. J Clin Invest. 1995;96:1059–1065.

9. Kitamura K, Kangawa K, Kawamoto M, Ichiki Y, Nakamura S, Matsuo H, Eto T. Adrenomedullin: a novel hypotensive peptide isolated from human pheochromocytoma. Biochem Biophys Res Commun. 1993;192:553–560.[Medline] [Order article via Infotrieve]

10. Sakata J, Shimokubo T, Kitamura K, Nishizono M, Ichiki Y, Kangawa K, Matsuo H, Eto T. Distribution and characterization of immunoreactive rat adrenomedullin in tissue and plasma. FEBS Lett. 1994;352:105–108.[Medline] [Order article via Infotrieve]

11. Ichiki Y, Kitamura K, Kangawa K, Kawamoto M, Matsuo H, Eto T. Distribution and characterization of immunoreactive adrenomedullin in human tissue and plasma. FEBS Lett. 1994;338:6–10.[Medline] [Order article via Infotrieve]

12. Shimokubo T, Sakata J, Kitamura K, Kangawa K, Matsuo H, Eto T. Adrenomedullin: changes in circulating and cardiac tissue concentration in Dahl salt-sensitive rats on a high-salt diet. Clin Exp Hypertens. 1996;18:949–961.

13. Ishiyama Y, Kitamura K, Kato J, Sakata J, Kangawa K, Eto T. Changes in cardiac adrenomedullin concentration in renovascular hypertensive rats. Hypertens Res. 1997;20:113–117.[Medline] [Order article via Infotrieve]

14. Romppanen H, Marttila M, Magga J, Vuolteenaho O, Kinnunen P, Szokodi I, Ruskoaho H. Adrenomedullin gene expression in the rat heart is stimulated by acute pressure overload: blunted effect in experimental hypertension. Endocrinology. 1997;138:2636–2639.[Abstract/Free Full Text]

15. Morimoto A, Nishikimi T, Yoshihara F, Horio T, Nagaya N, Matsuo H, Dohi K, Kangawa K. Ventricular adrenomedullin levels correlate with the extent of cardiac hypertrophy in rats. Hypertension. 1999;33:1146–1152.[Abstract/Free Full Text]

16. Tsuruda T, Kato J, Kitamura K, Kuwasako K, Imamura T, Koiwaya Y, Tsuji T, Kangawa K, Eto T. Adrenomedullin: a possible autocrine or paracrine inhibitor of hypertrophy of cardiomyocytes. Hypertension. 1998;31:505–510.[Abstract/Free Full Text]

17. Tsuruda T, Kato J, Kitamura K, Kawamoto M, Kuwasako K, Imamura T, Koiwaya Y, Tsuji T, Kangawa K, Eto T. An autocrine or a paracrine role of adrenomedullin in modulating cardiac fibroblast growth. Cardiovasc Res. 1999;43:958–967.[Abstract/Free Full Text]

18. Kubo A, Minamino N, Isumi Y, Katafuchi T, Kangawa K, Dohi K, Matsuo H. Production of adrenomedullin in macrophage cell line and peritoneal macrophage. J Biol Chem. 1998;273:16730–16738.[Abstract/Free Full Text]

19. Sakata J, Shimokubo T, Kitamura K, Nakamura S, Kangawa K, Matsuo H, Eto T. Molecular cloning and biological activities of rat adrenomedullin, a hypotensive peptide. Biochem Biophys Res Commun. 1993;195:921–927.[Medline] [Order article via Infotrieve]

20. Fort P, Marty L, Piechaczyk M, el Sabrouty S, Dani C, Jeanteur P, Blanchard JM. Various rat adult tissues express only one major mRNA species from the glyceraldehyde-3-phosphate-dehydrogenase multigenic family. Nucleic Acids Res. 1985;13:1431–1442.[Abstract/Free Full Text]

21. Iwahana M, Tokumoto M, Makiishi N, Takatori O, Miyazaki N. Fundamental evaluation of no-extraction method of angiotensin I and angiotensin II by radioimmunoassay. Jpn J Med Pharm Sci. 1996;36:297–303.

22. Sumimoto T, Nishikimi T, Mukai M, Matsuzaki K, Murakami E, Takishita S, Miyata A, Matsuo H, Kangawa K. Plasma adrenomedullin concentrations and cardiac and arterial hypertrophy in hypertension. Hypertension. 1997;30:741–745.[Abstract/Free Full Text]

23. Sugo S, Minamino N, Shoji H, Kangawa K, Kitamura K, Eto T, Matsuo H. Interleukin-1, tumor necrosis factor and lipopolysaccharide additively stimulate production of adrenomedullin in vascular smooth muscle cells. Biochem Biophys Res Commun. 1995;207:25–32.[Medline] [Order article via Infotrieve]

24. Sugo S, Minamino N, Shoji H, Kangawa K, Matsuo H. Effects of vasoactive substances and cAMP related compounds on adrenomedullin production in cultured vascular smooth muscle cells. FEBS Lett. 1995;369:311–314.[Medline] [Order article via Infotrieve]

25. Horio T, Nishikimi T, Yoshihara F, Nagaya N, Matsuo H, Takishita S, Kangawa K. Production and secretion of adrenomedullin in cultured rat cardiac myocytes and nonmyocytes: stimulation by interleukin-1ß and tumor necrosis factor-. Endocrinology. 1998;139:4576–4580.[Abstract/Free Full Text]

26. Sadoshima J, Xu Y, Slayter HS, Izumo S. Autocrine release of angiotensin II mediates stretch-induced hypertrophy of cardiac myocytes in vitro. Cell. 1993;75:977–984.[Medline] [Order article via Infotrieve]

27. Yamazaki T, Komuro I, Kudoh S, Zou Y, Shiojima I, Mizuno T, Takano H, Hiroi Y, Ueki K, Tobe K, Kadowaki T, Nagai R, Yazaki Y. Angiotensin II partly mediates mechanical stress-induced cardiac hypertrophy. Circ Res. 1995;77:258–265.[Abstract/Free Full Text]

28. Harada M, Itoh H, Nakagawa O, Ogawa Y, Miyamoto Y, Kuwahara K, Ogawa E, Igaki T, Yamashita J, Masuda I, Yoshimasa T, Tanaka I, Saito Y, Nakao K. Significance of ventricular myocytes and nonmyocytes interaction during cardiocyte hypertrophy: evidence for endothelin-1 as a paracrine hypertrophic factor from cardiac nonmyocytes. Circulation. 1997;96:3737–3744.[Abstract/Free Full Text]

This article has been cited by other articles:

				J. J. Saris, P. A.C. 't Hoen, I. M. Garrelds, D. H.W. Dekkers, J. T. den Dunnen, J. M.J. Lamers, and A.H. Jan Danser Prorenin Induces Intracellular Signaling in Cardiomyocytes Independently of Angiotensin II Hypertension, October 1, 2006; 48(4): 564 - 571. [Abstract] [Full Text] [PDF]

				Y. Zhao, D. Bell, L. R. Smith, L. Zhao, A. B. Devine, E. M. McHenry, D. P. Nicholls, and B. J. McDermott Differential Expression of Components of the Cardiomyocyte Adrenomedullin/Intermedin Receptor System following Blood Pressure Reduction in Nitric Oxide-Deficient Hypertension J. Pharmacol. Exp. Ther., March 1, 2006; 316(3): 1269 - 1281. [Abstract] [Full Text] [PDF]

				D. Bell, Y.-Y. Zhao, E. J. Kelso, E. M. McHenry, L. M. Rush, V. M. Lamont, D. P. Nicholls, and B. J. McDermott Upregulation of adrenomedullin and its receptor components during cardiomyocyte hypertrophy induced by chronic inhibition of nitric oxide synthesis in rats Am J Physiol Heart Circ Physiol, February 1, 2006; 290(2): H904 - H914. [Abstract] [Full Text] [PDF]

				T. Tsuruda, J. Kato, K. Hatakeyama, H. Masuyama, Y.-N. Cao, T. Imamura, K. Kitamura, Y. Asada, and T. Eto Antifibrotic effect of adrenomedullin on coronary adventitia in angiotensin II-induced hypertensive rats Cardiovasc Res, March 1, 2005; 65(4): 921 - 929. [Abstract] [Full Text] [PDF]

				R. Nakamura, J. Kato, K. Kitamura, H. Onitsuka, T. Imamura, Y. Cao, K. Marutsuka, Y. Asada, K. Kangawa, and T. Eto Adrenomedullin Administration Immediately After Myocardial Infarction Ameliorates Progression of Heart Failure in Rats Circulation, July 27, 2004; 110(4): 426 - 431. [Abstract] [Full Text] [PDF]

				P. Niu, T. Shindo, H. Iwata, S. Iimuro, N. Takeda, Y. Zhang, A. Ebihara, Y. Suematsu, K. Kangawa, Y. Hirata, et al. Protective Effects of Endogenous Adrenomedullin on Cardiac Hypertrophy, Fibrosis, and Renal Damage Circulation, April 13, 2004; 109(14): 1789 - 1794. [Abstract] [Full Text] [PDF]

				T. Nishikimi, K. Tadokoro, Y. Mori, X. Wang, K. Akimoto, F. Yoshihara, N. Minamino, K. Kangawa, and H. Matsuoka Ventricular Adrenomedullin System in the Transition From LVH to Heart Failure in Rats Hypertension, March 1, 2003; 41(3): 512 - 518. [Abstract] [Full Text] [PDF]

				R. Nakamura, J. Kato, K. Kitamura, H. Onitsuka, T. Imamura, K. Marutsuka, Y. Asada, K. Kangawa, and T. Eto Beneficial effects of adrenomedullin on left ventricular remodeling after myocardial infarction in rats Cardiovasc Res, December 1, 2002; 56(3): 373 - 380. [Abstract] [Full Text] [PDF]

				T. Tsuruda and J. C. Burnett Jr Adrenomedullin: An Autocrine/Paracrine Factor for Cardiorenal Protection Circ. Res., April 5, 2002; 90(6): 625 - 627. [Full Text] [PDF]

				K Tambara, M Fujita, N Nagaya, S Miyamoto, A Iwakura, K Doi, G Sakaguchi, K Nishimura, K Kangawa, and M Komeda Increased pericardial fluid concentrations of the mature form of adrenomedullin in patients with cardiac remodelling Heart, March 1, 2002; 87(3): 242 - 246. [Abstract] [Full Text] [PDF]

				G. Apodaca Modulation of membrane traffic by mechanical stimuli Am J Physiol Renal Physiol, February 1, 2002; 282(2): F179 - F190. [Abstract] [Full Text] [PDF]

				A. M. Richards, R. Doughty, M. G. Nicholls, S. MacMahon, N. Sharpe, J. Murphy, E. A. Espiner, C. Frampton, T. G. Yandle, and for the Australia-New Zealand Heart Failure Group Plasma N-terminal pro-brain natriuretic peptide and adrenomedullin: Prognostic utility and prediction of benefit from carvedilol in chronic ischemic left ventricular dysfunction J. Am. Coll. Cardiol., June 1, 2001; 37(7): 1781 - 1787. [Abstract] [Full Text] [PDF]

				H. Yamakawa, T. Imamura, T. Matsuo, H. Onitsuka, Y. Tsumori, J. Kato, K. Kitamura, Y. Koiwaya, and T. Eto Diastolic wall stress and ANG II in cardiac hypertrophy and gene expression induced by volume overload Am J Physiol Heart Circ Physiol, December 1, 2000; 279(6): H2939 - H2946. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Tsuruda, T. Articles by Eto, T. Search for Related Content PubMed PubMed Citation Articles by Tsuruda, T. Articles by Eto, T. Pubmed/NCBI databases Substance via MeSH Related Collections Other myocardial biology ACE/Angiotension receptors Hypertrophy