This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Fisslthaler, B. Articles by Fleming, I. Search for Related Content PubMed PubMed Citation Articles by Fisslthaler, B. Articles by Fleming, I. Related Collections Cardiovascular Pharmacology Gene expression Coronary circulation Endothelium/vascular type/nitric oxide

(Hypertension. 2000;36:270.)
© 2000 American Heart Association, Inc.

Scientific Contributions

Nifedipine Increases Cytochrome P4502C Expression and Endothelium-Derived Hyperpolarizing Factor–Mediated Responses in Coronary Arteries

Beate Fisslthaler; Nora Hinsch; Thierry Chataigneau; Rüdiger Popp; Ladislau Kiss; Rudi Busse; Ingrid Fleming

From the Institut für Kardiovaskuläre Physiologie (B.F., N.H., T.C., R.P., R.B., I.F.), Klinikum der J.W. Goethe-Universität, Frankfurt am Main, Germany; and Zentrum der Inneren Medizin (L.K.), Justus Liebig Universität Gießen, Gießen, Germany.

Correspondence to Dr Ingrid Fleming, Institut für Kardiovaskuläre Physiologie, Klinikum der J.W. Goethe-Universität, Theodor-Stern-Kai 7, D-60596 Frankfurt am Main, Germany. E-mail Fleming{at}em.uni-frankfurt.de

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Abstract—In addition to NO and prostacyclin, endothelial cells release a factor that elicits vasodilatation by hyperpolarizing the underlying vascular smooth muscle cells. In some vascular beds, this so-called endothelium-derived hyperpolarizing factor (EDHF) displays the characteristics of a cytochrome P450 (CYP)-derived arachidonic acid metabolite, such as an epoxyeicosatrienoic acid. Native porcine and cultured human coronary artery endothelial cells were screened for CYP epoxygenases, and CYP2B, CYP2C, and CYP2J were detected with reverse transcription–polymerase chain reaction. The CYP inducer ß-naphthoflavone and the Ca²⁺ antagonist nifedipine significantly increased CYP2C mRNA but did not change the expression of CYP2J or CYP2B. To determine the relationship between CYP2C expression and EDHF production in native endothelial cells, we incubated porcine coronary arteries with nifedipine. Nifedipine enhanced endothelial CYP2C protein expression, as well as the generation of 11,12-epoxyeicosatrienoic acid. In organ bath experiments, pretreatment with nifedipine enhanced bradykinin-induced, EDHF-mediated relaxations as well as the concomitant hyperpolarization of smooth muscle cells. The specific CYP2C9 inhibitor sulfaphenazole, on the other hand, significantly attenuated EDHF-mediated hyperpolarization and relaxation. These results demonstrate that in porcine coronary arteries, the elevated expression of a CYP epoxygenase, homologous to CYP2C8/9, is associated with enhanced EDHF-mediated hyperpolarization in response to bradykinin. Therefore, we propose that an isozyme of CYP2C is the most likely candidate for the CYP-dependent EDHF synthase in porcine coronary arteries.

Key Words: endothelium-derived hyperpolarizing factor • cytochrome P450 • nifedipine • arteries • potassium channels

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
The existence of an NO/prostacyclin (prostaglandin [PG]I₂)-independent component of endothelium-dependent relaxation has been convincingly demonstrated in various conduit and resistance arteries. Because this NO/PGI₂-independent vasodilatation was associated with vascular smooth muscle hyperpolarization, the term "endothelium-derived hyperpolarizing factor" (EDHF) was coined.¹

On the basis of the experimental data published to date, it is evident that several EDHFs exist in different species.¹ However, the majority of reports that characterize EDHF in the coronary vascular bed support the concept that this EDHF is a cytochrome P450 (CYP)-related product. This hypothesis was based on the observation that CYP inhibitors and a number of anesthetic agents markedly attenuate EDHF-mediated responses.¹ However, these conclusions are limited by the fact that these CYP inhibitors cannot discriminate between the different CYP isoforms and can directly interfere with Ca²⁺-dependent K⁺ channels,² which are thought to be the main targets of EDHF in vascular cells.^{3 4}

Therefore, the aim of the present study was to identify a candidate EDHF synthase in endothelial cells by screening for the expression of CYP epoxygenases and to determine the effects of clinically relevant antihypertensive agents (ie, ramiprilat, nifedipine) on the induction of CYP enzymes and CYP product formation, as well as the bradykinin-induced EDHF-mediated hyperpolarization and relaxation.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Cultured Endothelial Cells
Human umbilical vein endothelial cells were isolated and cultured as described previously,⁵ and human coronary artery endothelial cells (HCAECs) were obtained from CellSystems and cultured in SmGM-2 (CellSystems). In some experiments, cGMP levels were determined.⁵

Preparation of Porcine Coronary Arteries
Porcine epicardial artery segments (40 mm long, mean external diameter 2.4 to 2.8 mm) were excised, side branches were sealed with surgical clips, and the segment was cannulated at both ends and placed into vessel chambers. After equilibration, coronary arteries were perfused with MEM containing ß-naphthoflavone (3 µmol/L, 48 hours), or nifedipine (0.1 µmol/L, 18 hours). Half of each segment was then cut into rings for organ chamber studies and precontracted with U46619 (0.1 to 1 µmol/L), and relaxation in response to bradykinin was determined in the presence of diclofenac (10 µmol/L) and in the absence and presence of the NO synthase (NOS) inhibitor N-nitro-L-arginine (300 µmol/L) as described previously.⁶ In some experiments, the endothelium was removed after pretreatment with either solvent or nifedipine, and relaxant responses to sodium nitroprusside (SNP) were determined.

Isolation of RNA and Protein
From the remaining coronary artery segment, endothelial cells or total RNA was isolated through intraluminal incubation with either dispase (2.4 U/mL) or guanidine isothiocyanate. Random hexanucleotide primers were used for reverse transcription (RT) of equal amounts of RNA, and the oligonucleotides used for polymerase chain reaction (PCR) were derived from a porcine CYP2C34 sequence (GenBank accession no. U35843) (upstream primer AGACAACGAGCACCACTCTG, downstream primer CCTTGGGGATGAGGTAGTTT) that exhibited a high homology to the human 2C8 sequence (GenBank accession no. Y00498) (CYP2B2 upstream primer TGGTGGAGGARCTGCGGAAATCC, downstream primer TGCCTTCGCCAAGACAAAYGCG [GenBank accession no. M34452]; CYP2J2 upstream primer CCCTCAYTTCAAGATCAACA, downstream primer GCAGATGAGGTTTTCTTCAT [GenBank accession no. U37143]; and elongation factor [EF] upstream primer GACATCACCAAGGGTGTGCAG, downstream primer GCGGTCAGCACACTGGCATA).

PCR products were separated on a 1.5% TAE agarose gel and visualized by staining with ethidium bromide. For the verification of the DNA fragment, the PCR products were transferred to nylon membranes and hybridized with ³²P-labeled DNA fragments derived from a plasmid containing the coding sequence of CYP2C8, CYP2B, or CYP2J2. Phenol-soluble protein or microsomal fractions (100 000g pellets) prepared from isolated porcine coronary artery endothelial cells (PCAECs) were subjected to SDS–polyacrylamide gel electrophoresis (8%) and Western blotting with the use of 2 different CYP2C11 polyclonal antibodies (kindly provided by Dr E. Morgan [Atlanta, Ga] or purchased from Daiichi Pure Chemicals): an endothelial NOS (eNOS) polyclonal antibody (Transduction Laboratories) or a platelet-endothelial cell adhesion molecule 1 (PECAM-1) monoclonal antibody (Santa Cruz).

Analysis of CYP-Derived Products
Native PCAECs harvested with the use of dispase, as described earlier, were allowed to equilibrate in HEPES-modified Tyrode’s solution containing 300 µmol/L N-nitro-L-arginine and 10 µmol/L diclofenac, were stimulated with 100 nmol/L bradykinin (5 minutes), and were frozen in liquid nitrogen. Endothelial cells were homogenized, and CYP-derived eicosanoids were detected as described previously.⁷

Electrophysiological Measurements
After incubation with solvent or nifedipine, coronary artery rings were slit, mounted in a heated chamber, and maintained in HEPES-modified Tyrode solution containing 10 µmol/L diclofenac, 300 µmol/L N-nitro-L-arginine, and 1 µmol/L U46619 to mimic conditions in the organ chamber experiments. Smooth muscle membrane potential was recorded by impaling cells through the intima as described previously.⁸

Statistical Analysis
Data are expressed as mean±SEM. Statistical evaluation was performed with Student’s t test for unpaired data, 1-way ANOVA followed by a Bonferroni t test, or ANOVA for repeated measures where appropriate. Values of P<0.05 were considered statistically significant.

	Results

Top Abstract Introduction Methods Results Discussion References

 
CYP Expression in Endothelial Cells
To determine which CYP isoform could be implicated in the generation of EDHF-mediated responses, we used RT-PCR to screen native PCAECs, as well as cultured HCAECs. Of the CYP epoxygenases that we investigated, isozymes homologous to 2C8/9 and 2J2 were expressed in both HCAECs and PCAECs (Figure 1A). Only the globally expressed CYP2C family fit the criteria of an EDHF synthase, because its expression was consistently enhanced by ß-naphthoflavone in all of the endothelial cell types studied. To determine whether CYP2C expression and EDHF-mediated responses could be modulated by antihypertensive agents, we tested the effects of the Ca²⁺ antagonist nifedipine and the ACE inhibitor ramiprilat. While ramiprilat was without effect, 0.1 µmol/L nifedipine (18 hours) enhanced CYP2C RNA expression in native PCAECs (Figure 1B).

View larger version (70K): [in this window] [in a new window]   Figure 1. Expression of CYP enzymes in cultured HCAECs and native PCAECs. A, Cultured HCAECs and native PCAECs were pretreated with either solvent (CTL) or ß-naphthoflavone (ß-NF; 3 µmol/L, 48 hours), and total RNA was isolated for RT-PCR as described in the text. CYP PCR products were detected by Southern blotting and hybridization with isoform-specific DNA fragments. To ensure that equal amounts of cDNA were amplified per PCR, PCR for EF was performed, and the products were visualized by staining the agarose gel with ethidium bromide. A positive control (p.c., human liver) and negative control (n.c., no reverse transcriptase in the RT reaction) was included in each experiment. Identical results were obtained in 3 additional experiments. B and C, after perfusion with solvent (CTL) or nifedipine (Nif; 0.1 µmol/L, 18 hours) porcine coronary artery segments were intraluminally incubated with guanidine isothiocyanate. B, Total RNA was extracted and analyzed by RT-PCR and subsequent Southern blotting for the expression of CYP2C. C, The phenol-soluble proteins were subjected to Western blot analysis with a specific antibody directed against CYP2C11. The densitometric evaluations of Southern and Western blots were obtained from 4 or 5 independent experiments. *P<0.05 vs control.

CYP Induction and Epoxyeicosatrienoic Acid Production
To establish a functional link between the expression of CYP2C and the production of EDHF, experiments were performed with isolated endothelium-intact porcine coronary arteries, and epoxyeicosatrienoic acid (EET) levels were measured in endothelial cell homogenates. Intraluminal incubation with nifedipine enhanced the expression of CYP2C protein in endothelial cells (Figure 1C). In endothelial cells harvested from coronary arteries maintained under control conditions for 18 hours, detectable amounts of 11,12-EET were generated in response to bradykinin (Figure 2). A >3-fold increase in endothelial EET generation was detected after the incubation of coronary segments with either ß-naphthoflavone or nifedipine (Figure 2).

View larger version (24K): [in this window] [in a new window]   Figure 2. CYP induction enhances the generation of 11,12-EET in native PCAECs pretreated with either solvent (CTL; 48 hours), ß-naphthoflavone (ß-NF; 3 µmol/L, 48 hours), or nifedipine (Nif; 0.1 µmol/L, 18 hours). After equilibration in HEPES-modified Tyrode’s solution (37°C, 4 hours) containing 10 µmol/L diclofenac and 300 µmol/L N-nitro-L-arginine, the isolated cells were stimulated with 100 nmol/L bradykinin (5 minutes). Arachidonic acid metabolites were analyzed as described. The results (ng of 11,12-EET) are presented as the mean±SEM of data obtained with 4 to 8 porcine coronary arteries, all from different animals. *P<0.05 vs control.

CYP Induction and EDHF-Mediated Hyperpolarization
Induction of CYP2C potentiated the bradykinin-induced, EDHF-mediated hyperpolarization of porcine coronary arteries (Figures 3A and 3B) measured in the continuous presence of NOS and cyclooxygenase inhibitors. Nifedipine (0.1 µmol/L, 18 hours) did not affect the resting membrane potential of smooth muscle cells (-50.5±1.8 mV in control versus -49.0±2.2 mV in nifedipine-treated arteries) or the hyperpolarization elicited by 11,12-EET (the 1 µmol/L EET–induced hyperpolarization was 8.6±0.9 mV in control arteries versus 8.7±2.3 mV in arteries treated with nifedipine, n=4, NS). Sulfaphenazole, which selectively inhibits CYP2C9 in the human liver,⁹ significantly attenuated the EDHF-mediated hyperpolarization of coronary artery rings (hyperpolarization was reduced from 16.5±2.9 mV in the absence of sulfaphenazole to 6.9±2.2 mV in the presence of sulfaphenazole, n=11, P<0.05). The EDHF-mediated hyperpolarization of the porcine coronary artery, unlike EDHF-mediated responses in other arteries, was sensitive to iberiotoxin as well as to the combination of charybdotoxin and apamin (Figure 3C).

View larger version (21K): [in this window] [in a new window]   Figure 3. Nifedipine pretreatment enhances the EDHF-mediated hyperpolarization of porcine coronary artery smooth muscle. The bradykinin (Bk; 100 nmol/L)-induced hyperpolarization was determined in endothelium-intact porcine coronary artery segments pretreated with either solvent (CTL; 18 hours) or nifedipine (Nif; 0.1 µmol/L, 18 hours). Representative membrane potential recordings (A) and statistical summary of data (B) were obtained in 4 to 6 separate experiments (*P<0.05 vs control). C, Statistical summary of the bradykinin-induced hyperpolarization determined in freshly isolated porcine coronary arteries in the absence (CTL) and presence of charybdotoxin (CbTx; 100 nmol/L)/apamin (Apa; 100 nmol/L) and in the absence and presence of iberiotoxin (IbTx; 100 nmol/L). The results are presented as the mean±SEM of data obtained with arteries from 6 different animals (**P<0.01 vs control). All experiments were performed in the presence of 10 µmol/L diclofenac, 300 µmol/L N-nitro-L-arginine, and 1 µmol/L U46619 to mimic conditions in organ chamber experiments.

In cultured cells, the expression of CYP isozymes is known to decrease with time. A similar effect is observed in native endothelial cells maintained for prolonged periods in culture medium. Indeed, although bradykinin-induced hyperpolarization of porcine coronary arteries is detectable for up to 60 hours, the amplitude of the hyperpolarization decreases in a time-dependent manner (compare Figures 3B and 3C), and there is a rightward shift in the bradykinin-induced EDHF-mediated relaxation of porcine coronary arteries incubated for various times.⁸

CYP Induction and EDHF-Mediated Relaxation
In accordance with the effects of nifedipine on the agonist-induced, endothelium-dependent hyperpolarization of porcine coronary artery smooth muscle cells, nifedipine induced a leftward shift in the EDHF-mediated concentration-relaxation curve to bradykinin (EC₅₀=-7.66±0.12 mol/L in control versus -8.35±0.15 mol/L in nifedipine-treated rings, P<0.001, n=6; Figure 4A). The CYP2C9 inhibitor sulfaphenazole did not affect basal tone (data not shown) but significantly attenuated the bradykinin-induced EDHF-mediated relaxation of coronary artery rings (Figure 4B). The potentiating effect of nifedipine was restricted to the EDHF-mediated relaxation as the NO-mediated relaxation of nifedipine-treated segments was attenuated (EC₅₀=-8.35±0.09 mol/L in control versus -8.21±0.16 mol/L in nifedipine-treated rings, P<0.05, n=6; Figure 4C). Nifedipine altered neither the Ca²⁺ response of cultured endothelial cells to bradykinin (data not shown) nor the responsiveness of vascular smooth muscle cells to nitrovasodilators. Relaxation responses to SNP in endothelium-denuded segments were identical in the solvent- and nifedipine-treated groups (EC₅₀=-7.79±0.05 mol/L in control versus -7.83±0.05 mol/L in nifedipine-treated rings, NS, n=14; Figure 4D).

View larger version (28K): [in this window] [in a new window]   Figure 4. Effect of nifedipine on the EDHF- and NO-mediated relaxation of endothelium-intact porcine coronary artery rings. Porcine coronary arteries incubated with either solvent (18 hours) or nifedipine (0.1 µmol/L, 18 hours) were cut into rings, and the relaxation to bradykinin was determined after contraction with U46619 (0.1 to 1 µmol/L). A, EDHF-mediated relaxation in the combined presence of 10 µmol/L diclofenac and 300 µmol/L N-nitro-L-arginine. B, Relaxation in response to 1 µmol/L bradykinin in the combined presence of diclofenac and N-nitro-L-arginine and in the absence and presence of sulfaphenazole (Sph; 10 µmol/L). C, NO-mediated relaxation in the presence of diclofenac (10 µmol/L). D, SNP-induced relaxation of endothelium-denuded coronary artery rings in the presence of diclofenac (10 µmol/L). Results are presented as the mean±SEM of 6 to 14 separate experiments (*P<0.05 vs control).

Role of NO and Protein Kinase C in Nifedipine-Mediated CYP Induction
The nifedipine-induced attenuation of NO-mediated relaxation could be correlated with a slight decrease in the expression of eNOS. In cultured endothelial cells, 0.1 µmol/L nifedipine (18 hours) decreased the expression of eNOS (Figure 5) and attenuated the basal production of cGMP (1.2±0.5 versus 0.7±0.2 pmol/well in the absence and presence of nifedipine, P=0.38, n=8, NS), as well as the bradykinin-stimulated increase in cGMP levels (15.5±1.4 versus 12.3±0.3 pmol/well in the absence and presence of nifedipine, n=8, P<0.05).

View larger version (94K): [in this window] [in a new window]   Figure 5. The role of NO and PKC in nifedipine-mediated CYP induction. Confluent primary cultures of human umbilical vein endothelial cells were incubated with either solvent (CTL; 18 hours), nifedipine (Nif; 0.1 µmol/L, 18 hours), N-nitro-L-arginine (L-NA; 300 µmol/L, 18 hours), DETA-NO (500 µmol/L, 18 hours), the PKC inhibitor Ro-31-8220 (100 nmol/L), or combinations of more than 1 substance. Endothelial proteins were subjected to Western blot analysis with specific antibodies directed against eNOS or CYP2C. To control for the protein loading of each lane, blots were reprobed with the endothelial marker protein PECAM-1; +ve represents the signal generated by a positive control: rat liver for CYP 2C and an endothelial cell lysate for PECAM-1. The blots presented are representative of data obtained in 3 to 5 additional experiments.

To determine whether the effect of nifedipine on CYP2C expression was a consequence of its effect on eNOS expression, experiments were performed with N-nitro-L-arginine and the NO donor (Z)-1-[2-(2-Aminoethyl)-N-(2-ammonioethyl)amino]diazen-1-ium-1,2-diolate (DETA-NO). In 3 of 6 experiments, 300 µmol/L N-nitro-L-arginine (18 hours) enhanced CYP2C expression, whereas 500 µmol/L DETA-NO (18 hours) consistently attenuated CYP2C expression. Moreover, in the presence of DETA-NO, nifedipine did not increase CYP2C expression (Figure 5).

Because nifedipine has been suggested to inhibit PKC in endothelial cells,¹⁰ we compared the effects of the Ca²⁺ antagonist with those of an inhibitor of Ca²⁺-dependent and -independent protein kinase C (PKC) isoforms. Ro-31-8220 (100 nmol/L, 18 hours) slightly depressed the expression of CYP2C in human endothelial cells and completely prevented its induction by nifedipine (Figure 5).

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
The results presented here demonstrate that EDHF-mediated hyperpolarization and relaxation elicited by bradykinin in porcine coronary arteries can be modulated by enhancement of the expression of CYP2C with nifedipine or by inhibition of CYP2C9 activity with the use of sulfaphenazole. This supports the concept that a CYP-dependent process is crucial for the generation of EDHF-mediated responses in porcine coronary arteries.

Previously, indirect evidence has suggested that a CYP epoxygenase-derived product mediates NO/PGI₂-independent relaxation in the human,¹¹ porcine,³ bovine,¹² canine,¹³ and rat¹⁴ coronary circulations. One hindrance to the identification of the CYP isozyme or isozymes that may generate a hyperpolarizing factor in endothelial cells has been the fact that these enzymes are expressed at extremely low levels in cultured cells. Thus, it was necessary to screen both cultured and native coronary endothelial cells to determine which CYP enzymes may be involved in the generation of EDHF. Previous reports demonstrated that 2 CYP epoxygenases (CYP2C8/9¹⁵ and CYP2J2¹⁶ ) can be expressed in human endothelial cells, and we were able to detect homologs of both enzymes in the endothelium removed from porcine coronary arteries. Because we previously reported that a CYP-derived hyperpolarizing factor can be physically transferred from cultured endothelial to smooth muscle cells after the induction of CYP enzymes with ß-naphthoflavone,³ we took the sensitivity to this inducer as a criterion for the identification of the putative coronary EDHF synthase. Only the CYP2C enzymes were consistently induced after incubation with ß-naphthoflavone. Moreover, the results of the present investigation, which show the generation of EETs and the amplitude of EDHF-mediated smooth muscle hyperpolarization and relaxation were potentiated after the induction of CYP2C, suggest that a homolog of CYP2C8/9 is involved in the generation of EDHF in porcine coronary arteries. Indeed, we have recently shown that antisense oligonucleotides against CYP2C selectively attenuate the EDHF-mediated hyperpolarization and relaxation of coronary arteries.⁸

To demonstrate that CYP2C expression and EDHF-mediated responses could be induced by a completely different class of compounds to ß-naphthoflavone, experiments were performed with the Ca²⁺ antagonist nifedipine. From a theoretical point of view, there was no reason to expect that nifedipine would be able to induce CYP2C, because this compound is known to be metabolized in the liver by CYP3A4.¹⁷ Moreover, the nifedipine-specific element, described in the CYP3A4 promoter,¹⁸ does not appear to be present in the CYP2C gene family. Because nifedipine has been reported to inhibit PKC in endothelial cells,¹⁰ we compared the effects of nifedipine on CYP2C expression with those of Ro-31-8220, which inhibits Ca²⁺-dependent and -independent isoforms of PKC. However, in contrast to nifedipine, Ro-31-8220 attenuated endothelial CYP2C expression, suggesting that although the activity of PKC may modulate endothelial CYP2C expression, the mechanism that underlies the upregulation of CYP2C expression by nifedipine is not related to its inhibitory action on PKC.

The prolonged incubation of cultured HCAECs with nifedipine downregulated eNOS protein levels. We therefore speculated that NO may regulate CYP/EDHF synthase expression. Indeed, in some experiments, the inhibition of basal NO production enhanced CYP2C expression. The inconsistency in this observation may be related to variations in basal NO production in different cell batches. High concentrations of NO, on the other hand, consistently decreased the expression of CYP2C. It is therefore tempting to suggest that the expression and activity of the EDHF synthase are attenuated by NO. Caution should be exerted in the interpretation of data that relate to the induction of CYP expression by pharmacological substances because these compounds may be partially metabolized by endothelial cells and thus induce the expression of CYP enzymes independent of any effects related to the production of NO.

The list of candidate EDHFs is relatively long, and in most vascular preparations in which EDHF clearly is not a CYP metabolite (eg, the guinea pig carotid artery¹⁹ and the rat hepatic artery²⁰ ), EDHF-mediated hyperpolarizations are insensitive to iberiotoxin but sensitive to the combination of charybdotoxin and apamin. In the porcine and canine coronary arteries, as well as the rat renal artery, in which EDHF also appears to be a CYP metabolite, EDHF-mediated hyperpolarizations are equally sensitive to iberiotoxin²¹ and charybdotoxin/apamin.^{22 23 24} Thus, because the CYP2C product 11,12-EET, which is generated by coronary artery endothelial cells, activates iberiotoxin-sensitive K⁺_Ca channels,²⁵ the evidence accumulated to date strongly suggests that a CYP-derived product plays a crucial role in the bradykinin-induced generation of EDHF-mediated responses in the coronary artery. The reason for the caution in stating that the coronary EDHF is an EET is that it is currently unclear how endothelium-derived EETs are able to access smooth muscle cells to elicit hyperpolarization. EETs are by nature lipophilic, and simple diffusion from the endothelium to smooth muscle cells down a concentration gradient would be too slow to account for the rapidly initiated EDHF-mediated hyperpolarization and relaxation. One possibility that would also link many of the observations made in different vessels is that EETs are able to either pass through gap junctions or influence gap junctional communication of a second hyperpolarizing agent.

Taken together, the results of the present study demonstrate that nifedipine enhances the bradykinin-induced, EDHF-mediated hyperpolarization and relaxation of porcine coronary artery segments. These effects appear to be directly attributable to the upregulation of an enzyme homologous to CYP2C8/9 and the generation of the CYP metabolite 11,12-EET.

	Acknowledgments

 
This work was supported by the Deutsche Forschungsgemeinschaft (SFB 553, B1). The authors are indebted to Isabel Winter, Michaela Stächele, and Stergiani Hauk for expert technical assistance.

Received November 22, 1999; first decision December 28, 1999; accepted March 2, 2000.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Quilley J, Fulton D, McGiff JC. Hyperpolarizing factors. Biochem Pharmacol. 1997;54:1059–1070.[Medline] [Order article via Infotrieve]

2. Alvarez J, Montero M, García-Sancho J. Cytochrome P450 may link intracellular Ca²⁺ stores with plasma membrane Ca²⁺ influx. Biochem J. 1991;274:193–197.

3. Popp R, Bauersachs J, Hecker M, Fleming I, Busse R. A transferable, ß-naphthoflavone-inducible, hyperpolarizing factor is synthesised by native and cultured porcine coronary endothelial cells. J Physiol (Lond). 1996;497:3:699–709.[Abstract/Free Full Text]

4. Doughty JM, Plane F, Langton PD. Charybdotoxin and apamin block EDHF in rat mesenteric artery if selectively applied to the endothelium. Am J Physiol. 1999;276:H1107–H1112.[Abstract/Free Full Text]

5. Busse R, Lamontagne D. Endothelium-derived bradykinin is responsible for the increase in calcium produced by angiotensin-converting enzyme inhibitors in human endothelial cells. Naunyn-Schmiedeberg’s Arch Pharmacol. 1991;344:126–129.[Medline] [Order article via Infotrieve]

6. Bauersachs J, Popp R, Hecker M, Sauer E, Fleming I, Busse R. Nitric oxide attenuates the release of endothelium-derived hyperpolarizing factor. Circulation. 1996;94:3341–3347.[Abstract/Free Full Text]

7. Kiss L, Bieniek E, Weissmann N, Schutte H, Sibelius U, Gunther A, Bier J, Mayer K, Henneking K, Padberg W, Grimm H, Seeger W, Grimminger F. Simultaneous analysis of 4- and 5-series lipoxygenase and cytochrome P450 products from different biological sources by reversed-phase high-performance liquid chromatographic technique. Anal Biochem. 1998;261:16–28.[Medline] [Order article via Infotrieve]

8. Fisslthaler B, Popp R, Kiss L, Potente M, Harder DR, Fleming I, Busse R. Cytochrome P450 2C is an EDHF synthase in coronary arteries. Nature. 1999;401:493–497.[Medline] [Order article via Infotrieve]

9. Mancy A, Dijols S, Poli S, Guengerich P, Mansuy D. Interaction of sulfaphenazole derivatives with human liver cytochromes P450 2C: molecular origin of the specific inhibitory effects of sulfaphenazole on CYP 2C9 and consequences for the substrate binding site topology of CYP 2C9. Biochemistry. 1996;35:16205–16212.[Medline] [Order article via Infotrieve]

10. Hempel A, Lindschau C, Maasch C, Mahn M, Bychkov R, Noll T, Luft FC, Haller H. Calcium antagonists ameliorate ischemia-induced endothelial permeability by inhibiting protein kinase C. Circulation. 1999;99:2523–2529.[Abstract/Free Full Text]

11. Miura H, Liu Y, Gutterman DD. Human coronary arteriolar dilation to bradykinin depends on membrane hyperpolarization: contribution of nitric oxide and Ca²⁺-activated K⁺ channels. Circulation. 1999;99:3132–3138.[Abstract/Free Full Text]

12. Hecker M, Bara AT, Bauersachs J, Busse R. Characterization of endothelium-derived hyperpolarizing factor as a cytochrome P450-derived arachidonic acid metabolite in mammals. J Physiol (Lond). 1994;481:407–414.[Abstract/Free Full Text]

13. Oltman CL, Weintraub NL, VanRollins M, Dellsperger KC. Epoxyeicosatrienoic acids and dihydroxyeicosatrienoic acids are potent vasodilators in the canine coronary microcirculation. Circ Res. 1998;83:932–939.[Abstract/Free Full Text]

14. Bauersachs J, Hecker M, Busse R. Display of the characteristics of endothelium-derived hyperpolarizing factor by a cytochrome P450-derived arachidonic acid metabolite in the coronary microcirculation. Br J Pharmacol. 1994;113:1548–1553.[Medline] [Order article via Infotrieve]

15. Lin JHC, Kobari Y, Zhu Y, Stemerman MB, Pritchard KA Jr. Human umbilical vein endothelial cells express P450 2C8 mRNA: cloning of endothelial P450 epoxygenase. Endothelium. 1996;4:219–229.

16. Node K, Huo Y, Ruan X, Yang B, Spiecker M, Ley K, Zeldin DC, Liao JK. Anti-inflammatory properties of cytochrome P450 epoxygenase-derived eicosanoids. Science. 1999;285:1276–1279.[Abstract/Free Full Text]

17. Guengerich FP, Martin MV, Beaune PH, Kremers P, Wolff T, Waxman DJ. Characterization of rat and human liver microsomal cytochrome P-450 forms involved in nifedipine oxidation, a prototype for genetic polymorphism in oxidative drug metabolism. J Biol Chem. 1986;261:5051–5060.[Abstract/Free Full Text]

18. Hashimoto H, Toide K, Kitamura R, Fujita M, Tagawa S, Itoh S, Kamataki T. Gene structure of CYP3A4, an adult-specific form of cytochrome P450 in human livers, and its transcriptional control. Eur J Biochem. 1993;218:585–595.[Medline] [Order article via Infotrieve]

19. Corriu C, Félétou M, Canet E, Vanhoutte PM. Inhibitors of the cytochrome P450-mono-oxygenase and endothelium-dependent hyperpolarizations in the guinea-pig isolated carotid artery. Br J Pharmacol. 1996;117:607–610.[Medline] [Order article via Infotrieve]

20. Zygmunt PM, Edwards G, Weston AH, Davis SC, Högestätt ED. Effects of cytochrome P450 inhibitors on EDHF-mediated relaxation in the rat hepatic artery. Br J Pharmacol. 1996;118:1147–1152.[Medline] [Order article via Infotrieve]

21. Gebremedhin D, Harder DR, Pratt PF, Campbell WB. Bioassay of an endothelium-derived hyperpolarizing factor from bovine coronary arteries: role of a cytochrome P₄₅₀ mono-oxygenase. J Vasc Res. 1998;35:274–284.[Medline] [Order article via Infotrieve]

22. Frieden M, Sollini M, Bény J-L. Substance P and bradykinin activate different types of K_ca currents to hyperpolarize cultured porcine coronary artery endothelial cells. J Physiol (Lond). 1999;519:2:361–371.

23. Nishikawa Y, Stepp DW, Chilian WM. In vivo location and mechanism of EDHF-mediated vasodilation in canine coronary microcirculation. Am J Physiol. 1999;277:H1252–H1259.[Abstract/Free Full Text]

24. Zou AP, Fleming JT, Falck JR, Jacobs ER, Gebremedhin D, Harder DR, Roman RJ. Stereospecific effects of epoxyeicosatrienoic acids on renal vascular tone and K⁺-channel activity. Am J Physiol. 1996;270:F822–F832.[Abstract/Free Full Text]

25. Baron A, Frieden M, Bény J-L. Epoxyeicosatrienoic acids activate a high-conductance, Ca²⁺-dependent K⁺ channel on pig coronary artery endothelial cells. J Physiol (Lond). 1997;504:3:537–543.

This article has been cited by other articles:

				F. Krotz, N. Hellwig, M. A. Burkle, S. Lehrer, T. Riexinger, H. Mannell, H.-Y. Sohn, V. Klauss, and U. Pohl A sulfaphenazole-sensitive EDHF opposes platelet-endothelium interactions in vitro and in the hamster microcirculation in vivo Cardiovasc Res, October 4, 2009; (2009) cvp301v2. [Abstract] [Full Text] [PDF]

				T. Pearson, A. Y. Warren, D. A. Barrett, and R. N. Khan Detection of EETs and HETE-generating cytochrome P-450 enzymes and the effects of their metabolites on myometrial and vascular function Am J Physiol Endocrinol Metab, September 1, 2009; 297(3): E647 - E656. [Abstract] [Full Text] [PDF]

				B. T. Larsen, A. H. Bubolz, S. A. Mendoza, K. A. Pritchard Jr, and D. D. Gutterman Bradykinin-Induced Dilation of Human Coronary Arterioles Requires NADPH Oxidase-Derived Reactive Oxygen Species Arterioscler Thromb Vasc Biol, May 1, 2009; 29(5): 739 - 745. [Abstract] [Full Text] [PDF]

				A. C. Webler, U. R. Michaelis, R. Popp, E. Barbosa-Sicard, A. Murugan, J. R. Falck, B. Fisslthaler, and I. Fleming Epoxyeicosatrienoic acids are part of the VEGF-activated signaling cascade leading to angiogenesis Am J Physiol Cell Physiol, November 1, 2008; 295(5): C1292 - C1301. [Abstract] [Full Text] [PDF]

				A. C. Webler, R. Popp, T. Korff, U. R. Michaelis, C. Urbich, R. Busse, and I. Fleming Cytochrome P450 2C9-Induced Angiogenesis Is Dependent on EphB4 Arterioscler Thromb Vasc Biol, June 1, 2008; 28(6): 1123 - 1129. [Abstract] [Full Text] [PDF]

				U. R. Michaelis, N. Xia, E. Barbosa-Sicard, J. R. Falck, and I. Fleming Role of Cytochrome P450 2C Epoxygenases in Hypoxia-Induced Cell Migration and Angiogenesis in Retinal Endothelial Cells Invest. Ophthalmol. Vis. Sci., March 1, 2008; 49(3): 1242 - 1247. [Abstract] [Full Text] [PDF]

				B. T. Larsen, D. D. Gutterman, A. Sato, K. Toyama, W. B. Campbell, D. C. Zeldin, V. L. Manthati, J. R. Falck, and H. Miura Hydrogen Peroxide Inhibits Cytochrome P450 Epoxygenases: Interaction Between Two Endothelium-Derived Hyperpolarizing Factors Circ. Res., January 4, 2008; 102(1): 59 - 67. [Abstract] [Full Text] [PDF]

				J. Wray and D. Bishop-Bailey Epoxygenases and peroxisome proliferator-activated receptors in mammalian vascular biology Exp Physiol, January 1, 2008; 93(1): 148 - 154. [Abstract] [Full Text] [PDF]

				D. Fischer, U. Landmesser, S. Spiekermann, D. Hilfiker-Kleiner, M. Hospely, M. Muller, R. Busse, I. Fleming, and H. Drexler Cytochrome P450 2C9 is involved in flow-dependent vasodilation of peripheral conduit arteries in healthy subjects and in patients with chronic heart failure Eur J Heart Fail, August 1, 2007; 9(8): 770 - 775. [Abstract] [Full Text] [PDF]

				G. Irusta, M.J. Murphy, W.D. Perez, and J.D. Hennebold Dynamic expression of epoxyeicosatrienoic acid synthesizing and metabolizing enzymes in the primate corpus luteum Mol. Hum. Reprod., August 1, 2007; 13(8): 541 - 548. [Abstract] [Full Text] [PDF]

				K. A. Hagedorn, C.-L. Cooke, J. R. Falck, B. F. Mitchell, and S. T. Davidge Regulation of Vascular Tone During Pregnancy: A Novel Role for the Pregnane X Receptor Hypertension, February 1, 2007; 49(2): 328 - 333. [Abstract] [Full Text] [PDF]

				J. G. Zhang, S. S. Dehal, T. Ho, J. Johnson, C. Chandler, A. P. Blanchard, R. J. Clark Jr., C. L. Crespi, D. M. Stresser, and J. Wong HUMAN CYTOCHROME P450 INDUCTION AND INHIBITION POTENTIAL OF CLEVIDIPINE AND ITS PRIMARY METABOLITE H152/81 Drug Metab. Dispos., May 1, 2006; 34(5): 734 - 737. [Abstract] [Full Text] [PDF]

				J. Vriens, G. Owsianik, B. Fisslthaler, M. Suzuki, A. Janssens, T. Voets, C. Morisseau, B.D. Hammock, I. Fleming, R. Busse, et al. Modulation of the Ca2 Permeable Cation Channel TRPV4 by Cytochrome P450 Epoxygenases in Vascular Endothelium Circ. Res., October 28, 2005; 97(9): 908 - 915. [Abstract] [Full Text] [PDF]

				M. Funk, R. Freitag, G. Endler, W. Lalouschek, W. Lang, C. Mannhalter, and R. Sunder-Plassmann Influence of Cytochrome P450 2C9*2 and 2C9*3 Variants on the Risk of Ischemic Stroke: A Cross-sectional Case-Control Study Clin. Chem., September 1, 2005; 51(9): 1716 - 1718. [Full Text] [PDF]

				V. Randriamboavonjy, L. Kiss, J. R. Falck, R. Busse, and I. Fleming The synthesis of 20-HETE in small porcine coronary arteries antagonizes EDHF-mediated relaxation Cardiovasc Res, February 1, 2005; 65(2): 487 - 494. [Abstract] [Full Text] [PDF]

				X. Zhao, A. Dey, O. P. Romanko, D. W. Stepp, M.-H. Wang, Y. Zhou, L. Jin, J. S. Pollock, R. C. Webb, and J. D. Imig Decreased epoxygenase and increased epoxide hydrolase expression in the mesenteric artery of obese Zucker rats Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2005; 288(1): R188 - R196. [Abstract] [Full Text] [PDF]

				M. Funk, G. Endler, R. Freitag, J. Wojta, K. Huber, C. Mannhalter, and R. Sunder-Plassmann CYP2C9*2 and CYP2C9*3 Alleles Confer a Lower Risk for Myocardial Infarction Clin. Chem., December 1, 2004; 50(12): 2395 - 2398. [Full Text] [PDF]

				C. Cseko, Z. Bagi, and A. Koller Biphasic effect of hydrogen peroxide on skeletal muscle arteriolar tone via activation of endothelial and smooth muscle signaling pathways J Appl Physiol, September 1, 2004; 97(3): 1130 - 1137. [Abstract] [Full Text] [PDF]

				X. Zhao, T. Yamamoto, J. W. Newman, I.-H. Kim, T. Watanabe, B. D. Hammock, J. Stewart, J. S. Pollock, D. M. Pollock, and J. D. Imig Soluble Epoxide Hydrolase Inhibition Protects the Kidney from Hypertension-Induced Damage J. Am. Soc. Nephrol., May 1, 2004; 15(5): 1244 - 1253. [Abstract] [Full Text] [PDF]

				L. J. Dickmann, C. W. Locuson, J. P. Jones, and A. E. Rettie Differential Roles of Arg97, Asp293, and Arg108 in Enzyme Stability and Substrate Specificity of CYP2C9 Mol. Pharmacol., April 1, 2004; 65(4): 842 - 850. [Abstract] [Full Text]

				F. Krotz, T. Riexinger, M. A. Buerkle, K. Nithipatikom, T. Gloe, H.-Y. Sohn, W. B. Campbell, and U. Pohl Membrane Potential-Dependent Inhibition of Platelet Adhesion to Endothelial Cells by Epoxyeicosatrienoic Acids Arterioscler Thromb Vasc Biol, March 1, 2004; 24(3): 595 - 600. [Abstract] [Full Text]

				S. Fichtlscherer, S. Dimmeler, S. Breuer, R. Busse, A. M. Zeiher, and I. Fleming Inhibition of Cytochrome P450 2C9 Improves Endothelium-Dependent, Nitric Oxide-Mediated Vasodilatation in Patients With Coronary Artery Disease Circulation, January 20, 2004; 109(2): 178 - 183. [Abstract] [Full Text] [PDF]

				I. T. Udosen, H. Jiang, H. C. Hercule, and A. O. Oyekan Nitric oxide-epoxygenase interactions and arachidonate-induced dilation of rat renal microvessels Am J Physiol Heart Circ Physiol, November 1, 2003; 285(5): H2054 - H2063. [Abstract] [Full Text] [PDF]

				H. Lenasi, K. Kohlstedt, B. Fichtlscherer, A. Mulsch, R. Busse, and I. Fleming Amlodipine activates the endothelial nitric oxide synthase by altering phosphorylation on Ser1177 and Thr495 Cardiovasc Res, October 1, 2003; 59(4): 844 - 853. [Abstract] [Full Text] [PDF]

				W.-P. Qiu, Q. Hu, N. Paolocci, R. C. Ziegelstein, and D. A. Kass Differential effects of pulsatile versus steady flow on coronary endothelial membrane potential Am J Physiol Heart Circ Physiol, June 5, 2003; 285(1): H341 - H346. [Abstract] [Full Text] [PDF]

				S. Earley, A. Pastuszyn, and B. R. Walker Cytochrome P-450 epoxygenase products contribute to attenuated vasoconstriction after chronic hypoxia Am J Physiol Heart Circ Physiol, June 5, 2003; 285(1): H127 - H136. [Abstract] [Full Text] [PDF]

				T. Hillig, P. Krustrup, I. Fleming, T. Osada, B. Saltin, and Y. Hellsten Cytochrome P450 2C9 plays an important role in the regulation of exercise-induced skeletal muscle blood flow and oxygen uptake in humans J. Physiol., January 1, 2003; 546(1): 307 - 314. [Abstract] [Full Text] [PDF]

				M. Medhora, J. Daniels, K. Mundey, B. Fisslthaler, R. Busse, E. R. Jacobs, and D. R. Harder Epoxygenase-driven angiogenesis in human lung microvascular endothelial cells Am J Physiol Heart Circ Physiol, January 1, 2003; 284(1): H215 - H224. [Abstract] [Full Text] [PDF]

				B. Hoepfl, B. Rodenwaldt, U. Pohl, and C. de Wit EDHF, but not NO or prostaglandins, is critical to evoke a conducted dilation upon ACh in hamster arterioles Am J Physiol Heart Circ Physiol, September 1, 2002; 283(3): H996 - H1004. [Abstract] [Full Text] [PDF]

				Y. Ando, E. Fuse, and W. D. Figg Thalidomide Metabolism by the CYP2C Subfamily Clin. Cancer Res., June 1, 2002; 8(6): 1964 - 1973. [Abstract] [Full Text] [PDF]

				J. Bauersachs, M. Christ, G. Ertl, U.R. Michaelis, B. Fisslthaler, R. Busse, and I. Fleming Cytochrome P450 2C expression and EDHF-mediated relaxation in porcine coronary arteries is increased by cortisol Cardiovasc Res, June 1, 2002; 54(3): 669 - 675. [Abstract] [Full Text] [PDF]

				M. Potente, U. R. Michaelis, B. Fisslthaler, R. Busse, and I. Fleming Cytochrome P450 2C9-induced Endothelial Cell Proliferation Involves Induction of Mitogen-activated Protein (MAP) Kinase Phosphatase-1, Inhibition of the c-Jun N-terminal Kinase, and Up-regulation of Cyclin D1 J. Biol. Chem., May 3, 2002; 277(18): 15671 - 15676. [Abstract] [Full Text] [PDF]

				R. Popp, R. P. Brandes, G. Ott, R. Busse, and I. Fleming Dynamic Modulation of Interendothelial Gap Junctional Communication by 11,12-Epoxyeicosatrienoic Acid Circ. Res., April 19, 2002; 90(7): 800 - 806. [Abstract] [Full Text] [PDF]

				R. J. Roman P-450 Metabolites of Arachidonic Acid in the Control of Cardiovascular Function Physiol Rev, January 1, 2002; 82(1): 131 - 185. [Abstract] [Full Text] [PDF]

				B. Fisslthaler, R. Popp, U. R. Michaelis, L. Kiss, I. Fleming, and R. Busse Cyclic Stretch Enhances the Expression and Activity of Coronary Endothelium-Derived Hyperpolarizing Factor Synthase Hypertension, December 1, 2001; 38(6): 1427 - 1432. [Abstract] [Full Text] [PDF]

				I. Fleming Cytochrome P450 and Vascular Homeostasis Circ. Res., October 26, 2001; 89(9): 753 - 762. [Abstract] [Full Text] [PDF]

				E. T. Morgan Regulation of Cytochrome P450 by Inflammatory Mediators: Why and How? Drug Metab. Dispos., March 1, 2001; 29(3): 207 - 212. [Abstract] [Full Text]

				G Edwards and A H Weston EDHF - are there gaps in the pathway? J. Physiol., March 1, 2001; 531(2): 299 - 299. [Full Text] [PDF]

				I. Fleming, U. R. Michaelis, D. Bredenkotter, B. Fisslthaler, F. Dehghani, R. P. Brandes, and R. Busse Endothelium-Derived Hyperpolarizing Factor Synthase (Cytochrome P450 2C9) Is a Functionally Significant Source of Reactive Oxygen Species in Coronary Arteries Circ. Res., January 19, 2001; 88(1): 44 - 51. [Abstract] [Full Text] [PDF]

				R. Popp, R. P. Brandes, G. Ott, R. Busse, and I. Fleming Dynamic Modulation of Interendothelial Gap Junctional Communication by 11,12-Epoxyeicosatrienoic Acid Circ. Res., April 19, 2002; 90(7): 800 - 806. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Fisslthaler, B. Articles by Fleming, I. Search for Related Content PubMed PubMed Citation Articles by Fisslthaler, B. Articles by Fleming, I. Related Collections Cardiovascular Pharmacology Gene expression Coronary circulation Endothelium/vascular type/nitric oxide