This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Molderings, G. J. Articles by Göthert, M. Search for Related Content PubMed PubMed Citation Articles by Molderings, G. J. Articles by Göthert, M. Pubmed/NCBI databases Compound via MeSH Substance via MeSH Hazardous Substances DB OXYMETAZOLINE TRITIUM Related Collections Receptor pharmacology

(Hypertension. 2000;36:405.)
© 2000 American Heart Association, Inc.

Scientific Contributions

Species-Specific Pharmacological Properties of Human _2A-Adrenoceptors

Gerhard J. Molderings; Heinz Bönisch; Michael Brüss; James Likungu; Manfred Göthert

From Institut für Pharmakologie und Toxikologie, Universität Bonn (G.J.M., H.B., M.G.), and Klinik für Herz- und Gefäßchirurgie (J.L.), Bonn, Germany.

Correspondence to Gerhard J. Molderings, Institute of Pharmacology and Toxicology, University of Bonn, Reuterstr 2b, D-53113 Bonn, Germany. E-mail molderings{at}uni-bonn.de

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Abstract—On the basis of data obtained in rabbits, the imidazoline receptor ligand rilmenidine has been suggested to decrease blood pressure in humans by activating central _2A-adrenoceptors. A prerequisite for this hypothesis was the unproved assumption that rabbit and human _2A-adrenoceptors are equally activated by rilmenidine. Because _2A-adrenoceptors in the brain and on cardiovascular sympathetic nerve terminals are identical, the latter were used as a model for the former to confirm or disprove this assumption. Human atrial appendages and rabbit pulmonary arteries were used to determine the potencies of ₂-adrenoceptor agonists in inhibiting the electrically (2 Hz) evoked [³H]norepinephrine release and of antagonists in counteracting the ₂-adrenoceptor–mediated inhibition induced by moxonidine. In the rabbit pulmonary artery, rilmenidine and oxymetazoline are potent full agonists, whereas in the human atrial appendages they are antagonists at the ₂-autoreceptors, sharing this property with rauwolscine, phentolamine, and idazoxan. In contrast, prazosin is ineffective. In addition, a partial nucleotide and amino acid sequence of the rabbit _2A-adrenoceptor (a region known to substantially influence the pharmacological characteristics of the ₂-adrenoceptor) revealed marked differences between the rabbit and the human _2A-adrenoceptor. The sympathetic nerves of both the human atrial appendages and rabbit pulmonary artery are endowed with _2A-autoreceptors, at which, however, both rilmenidine and oxymetazoline exhibit different properties (antagonism and agonism, respectively). The antagonistic property of rilmenidine at human _2A-adrenoceptors indicates that in contrast to the suggestion based on rabbit data, the hypotensive property of the drug in humans is not due to activation of _2A-adrenoceptors but other, presumably I₁-imidazoline receptors, are probably involved.

Key Words: receptors, adrenergic, alpha • human • norepinephrine • rabbits • rilmenidine

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Four subtypes of ₂-adrenoceptors, _2A, _2B, _2C, and _2D, have been defined on the basis of their pharmacological properties.¹ The _2A-adrenoceptors (present in humans, pigs, and rabbits) and _2D-adrenoceptors (in rats, mice, guinea pigs, and cattle) represent species homologs of the same receptor.^{1 2} Although molecular genetics indicate that _2A- and _2D-adrenoceptors are structurally very similar among the species, both recombinant and native receptors exhibit different pharmacological properties. Differences in potency and intrinsic activity of -adrenoceptor ligands even exist between the _2A-adrenoceptors of different species. For example, oxymetazoline behaved as an agonist at the _2A-adrenoceptors of the rabbit pulmonary artery but as an antagonist at the _2A-adrenoceptors of the human saphenous vein.² Therefore, it is not possible to reliably predict the action of a given -adrenoceptor ligand at human _2A-adrenoceptors on the basis of data obtained for _2A-adrenoceptors of other species, in particular the rabbit. Nevertheless, on the basis of results obtained in rabbits, rilmenidine has been suggested to decrease blood pressure in humans by activating _2A-adrenoceptors in the rostral ventrolateral medulla^{3 4} without the necessity to postulate an action at I₁-imidazoline receptors.^{5 6} A prerequisite for this hypothesis was the assumption that rilmenidine activates not only rabbit but also human _2A-adrenoceptors, which, however, has not yet been proved; in contrast, rilmenidine exhibited no intrinsic activity (and only very low affinity) at recombinant human _2A-adrenoceptors.⁷ Because native _2A-adrenoceptors in the brain and on cardiovascular sympathetic nerve terminals (inhibitory presynaptic ₂-autoreceptors) are identical, the latter can be used as a model for the former.

Whereas it is generally accepted that the presynaptic ₂-autoreceptors in the rabbit cardiovascular system belong to the _2A-subtype, their subclassification in human cardiovascular tissue is equivocal: In the human saphenous vein, the presynaptic ₂-autoreceptor was found to be of the _2A-subtype,² but in the human heart, it was suggested to belong to the _2C-subtype⁸ ; if true, the latter would be an exception to the general rule that the presynaptic ₂-autoreceptor is of the _2A/D-subtype.⁹ Because the discrepancies in the subclassification of the presynaptic ₂-adrenoceptors in human cardiovascular tissue may be due to misinterpretation of pharmacological data, the first aim of the present study was to reinvestigate whether or not the presynaptic ₂-adrenoceptor in the human heart actually belongs to the _2C-subtype. For this purpose, ₂-adrenoceptor ligands that clearly discriminate between _2A- and _2C-adrenoceptors such as prazosin have been applied. On the basis of the results obtained in this context, it should be examined whether native resemble recombinant human _2A-adrenoceptors in that rilmenidine exhibits no intrinsic activity; in vivo, this should result in antagonism instead of the agonism shown for the rabbit _2A-adrenoceptors. The characterization of rilmenidine as an antagonist at human _2A-adrenoceptors would be of high clinical significance because it would exclude the possibility that the hypotensive effect of this drug is due to central _2A-adrenoceptor activation. In contrast, this would provide strong indirect evidence for an involvement of other receptors, in particular I₁-imidazoline receptors, in the antihypertensive effect of rilmenidine. Second, to investigate whether differences in the pharmacological characteristics of the _2A-autoreceptors in rabbit pulmonary artery and human atrial appendages were related to differences in molecular structure of these receptors, a partial nucleotide sequence of the rabbit _2A-adrenoceptor assumed to be relevant for the pharmacological character of the adrenoceptor was determined and compared with those of the human _2A-adrenoceptor.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Superfusion Experiments
Segments of pulmonary artery were excised from male White New Zealand rabbits, and segments of macroscopically normal human right atrial appendages were obtained from normotensive 35- to 70-year-old male or female patients undergoing open heart surgery. The atrial appendages were routinely removed for cannulation of the right atria. The patients were not treated with adrenoceptor agonists or antagonists or with drugs influencing the storage or release of norepinephrine. The study was approved by the local ethics committee. The experiments with animal tissue were conducted in accordance with the German Law for Care and Use of Laboratory Animals. Tissue preparation and the protocol of the superfusion experiments with rabbit pulmonary artery and human atrial appendages has been described in detail previously.^{10 11} The electrically (2 Hz or in a few experiments 6 Hz) evoked tritium overflow from the superfused preparations preincubated with [³H]norepinephrine was determined, which in the presence of blockade of neuronal and extraneuronal uptake reflects the action potential–induced release of tritiated and endogenous norepinephrine from the sympathetic neurons. Results are given as mean±SEM. Student’s t test for unpaired data was used for comparison of mean values. As an estimate of potency, the concentration that reduces evoked tritium overflow by 35% (IC_35%) was determined by interpolation between the 2 nearest points of the concentration-response curve. pIC_35% are the negative logarithms of these concentrations. Apparent pA₂ values at the level of the IC_35% were determined according to formula (4) of Furchgott.¹²

Cloning and Sequencing of Rabbit _2A-Adrenoceptor
Genomic DNA was isolated from brain cortex of White New Zealand rabbits. The solution then was extracted twice with phenol/chloroform/isoamylalcohol (25:24:1). The aqueous phase was purified with a Chroma Spin 30 column (Clontech) according to the manufacturer. The purified DNA was used as template for subsequent polymerase chain reaction (PCR) amplification of the _2A-adrenoceptor DNA under the following conditions: primer sequences were chosen for the 4th (sense primer: 5'GGAATTCATCTCCTTCCCGCC(A/G)CTCAT3') and 5th (antisense primer: 5'GGACTAGTCAC(A/G)TAGACCAGGATCATGAT3') transmembrane regions. PCR was performed in a total of 100 µL containing 15 nmol/L primer (each), 5 U Taq DNA Polymerase (Gibco), 2 mmol/L MgCl₂, 200 µmol/L dNTPs (each), 10 µL 10x Taq-Buffer (Gibco), and 5 µL template DNA. PCR was performed for 37 cycles (94°C, 1 minute; 64°C, 1 minute; 72°C, 3 minutes). PCR products were separated by agarose gel electrophoresis, and the band of interest was cut off the gel, purified with "GeneElute" columns (Supelco), ligated into the "TA-cloning" vector pCRII (Invitrogen) and transformed into Escherichia coli InV' (Invitrogen). The _2A-adrenoceptor DNA was sequenced on both strands by the dideoxynucleotide chain termination method¹³ with the use of the Sequenase 2.0 Kit (Amersham) and [''-³⁵S]-dATP. Sequencing products were run on 6% denaturing polyacrylamide gels and bands were visualized by autoradiography with XAR-5 (Kodak) films overnight.

Drugs used were (-)-[2,5,6-³H]norepinephrine (specific activity 55 Ci/mmol, New England Nuclear); prazosin hydrochloride, cocaine hydrochloride, corticosterone, rauwolscine hydrochloride (Sigma); oxymetazoline hydrochloride (Merck); desipramine hydrochloride, phentolamine hydrochloride (CIBA-GEIGY); moxonidine (Beiersdorf-Lilly); (±)-idazoxan hydrochloride (Reckitt and Colman); methiothepin maleate (Hoffmann-La Roche); and rilmenidine dihydrogenphosphate (Servier). Drugs were dissolved in saline except for corticosterone, which was dissolved in propaniol-1,2. The vehicles had no effect on basal tritium efflux or evoked tritium overflow.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Superfusion Experiments
Basal Tritium Efflux
Under control conditions, basal tritium efflux from strips of the human atrial appendages and rabbit pulmonary artery preincubated with [³H]norepinephrine decreased with time (not shown; for details, see References ² and ¹⁴ ). Basal tritium efflux in the presence of the ₂-adrenoceptor ligands and methiothepin did not significantly differ from that in the absence of these drugs (not shown).

Electrically Evoked Tritium Overflow Under Control Conditions
When no test drug was administered throughout superfusion, the tritium overflow evoked by the reference stimulation period S₂ at 2 Hz (standard frequency) amounted to 11.6±1.9 nCi (corresponding to 0.90±0.13% of tissue tritium; n=20) in human atrial appendages and to 7.6±1.1 nCi (corresponding to 0.52±0.05% of tissue tritium; n=21) in rabbit pulmonary artery. In the control experiments (absence of -adrenoceptor agonists), the evoked tritium overflow in both tissues either slightly decreased from S₂ to S₅ or remained approximately constant, as reflected by S_n/S₂ ratios close to unity (data not shown; for details, see legend to the Figure and References ² and ¹⁴ ).

View larger version (25K): [in this window] [in a new window]   Figure 1. A, Effect of moxonidine on electrically evoked tritium overflow from human atrial appendages and interaction with 2-adrenoceptor antagonists. Shown are experiments without 2-adrenoceptor antagonist () and experiments in presence of 0.1 µmol/L rauwolscine (•), 0.1 µmol/L idazoxan (), 0.3 µmol/L phentolamine (), and 1 µmol/L prazosin (). Values are mean±SEM of 5 to 11 experiments. B, Effect of moxonidine on electrically evoked tritium overflow from human atrial appendages and interaction with oxymetazoline and rilmenidine. Shown are experiments in absence of oxymetazoline and rilmendine () and experiments in presence of 0.1 µmol/L oxymetazoline (•) or 1 µmol/L rilmenidine (). Mean±SEM of 6 to 8 experiments. C, Effects of rilmenidine and (D) oxymetazoline on electrically evoked tritium overflow from human atrial appendages () and rabbit pulmonary artery (). Mean±SEM of 6 to 10 experiments. Five periods of transmural electrical stimulation (2 Hz; S1-S5) were applied. Agonists in A through D were applied at increasing concentrations from 12 minutes before until 20 minutes after onset of S3, S4, and S5. Interacting drugs were present from 14 minutes before S1 until end of experiments. Ordinate: S3/S2, S4/S2, and S5/S2 overflow ratios, expressed as percentage of ratios in corresponding control experiments. All inhibitory effects of moxonidine, rilmenidine, and oxymetazoline by >30% were significantly different from corresponding controls (at least P<0.05; for the sake of clarity, asterisks indicating levels of significance have been omitted), +P<0.05 (compared with effect of respective moxonidine concentration in absence of interacting drugs).

Effects of ₂-Adrenoceptor Ligands on Evoked Tritium Overflow
Human Atrial Appendages
Moxonidine inhibited the electrically evoked tritium overflow (Figure 1A and 1B and Table 1), whereas rilmenidine failed to do so (Figure 1C and Table 1). Oxymetazoline (in the presence of 0.03 µmol/L methiothepin to prevent stimulation of presynaptic inhibitory 5-HT_1D receptors¹⁵ ) was also ineffective (Figure 1D and Table 1). At an increased frequency of stimulation (6 Hz, 360 impulses), rilmenidine enhanced evoked tritium overflow (overflow in the presence of the rilmenidine concentrations indicated, expressed as percentage of that in drug-free controls: 1 µmol/L, 105±11%; 10 µmol/L, 119±12%; 30 µmol/L, 159±21%, P<0.01; n=9 to 13). In interaction experiments, 1 µmol/L rilmenidine produced a slight rightward shift and 0.1 µmol/L oxymetazoline a more pronounced rightward shift of the concentration-response curve for moxonidine (Figure 1B), yielding apparent pA₂ values of 6.17 and 7.77 (determined at the level of the IC_35% of moxonidine), respectively (Table 1). Phentolamine (0.3 µmol/L), rauwolscine (0.1 µmol/L), and idazoxan (0.1 µmol/L) also shifted the concentration-response curve of moxonidine to the right (Figure 1A; apparent pA₂ values: 8.22, 8.33, and 7.99, respectively; Table 1), whereas 1 µmol/L prazosin did not (Figure 1A).

View this table: [in this window] [in a new window]   Table 1. Agonistic and Antagonistic Potencies

Rabbit Pulmonary Artery
Rilmenidine and oxymetazoline inhibited the electrically evoked tritium overflow (Figure and Table 1). At the highest concentration investigated, the compounds inhibited the electrically evoked tritium overflow by 70%.

Cloning and Sequencing of Rabbit _2A-Adrenoceptor
The nucleotide and amino acid sequence data for the rabbit clone (present study) and the amino acid sequence of the human, porcine, rat, and mouse clones (found by BLAST search in protein databases at http://www.ncbi.nlm.nih.gov/cgi-bin/BLAST/nph-newblast) are given in Table 2. The sequence for the rabbit clone is homologous to the other _2A/D sequences and shows a cysteine (TGC) at position 201. As compared with the human sequence in this region, the rabbit clone exhibits a 75% homology in the deduced amino acid sequence and a 69% homology in the nucleotide sequence (Table 2). The rabbit amino acid sequence differs from the human sequence in positions 174, 181, 184, 185, 186, 199, 202, and 207; only the changes in position 174 and 199 are conservative. Moreover, there is a deletion at the human amino acid positions 182 and 183.

View this table: [in this window] [in a new window]   Table 2. Nucleotide and Amino Acid Sequence and Homologies

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
Subclassification of Presynaptic ₂-Autoreceptor in Human Heart Atrium
In a first investigation designed to subclassify the ₂-autoreceptors in human atrial appendages, prazosin (which in addition to its antagonistic property at ₁-adrenoceptors is a potent antagonist at _2B- and _2C-adrenoceptors) failed to antagonize the inhibitory effect of the full ₂-adrenoceptor agonist UK14304 on electrically evoked norepinephrine release under experimental conditions comparable to the present ones (see Figure 4 in Reference ¹⁶ ). However, at modified stimulation parameters (5 trains of 10 pulses at 100 Hz), a slight nonparallel rightward shift of the concentration-response curve of UK14304 by 0.1 µmol/L prazosin was found that was overinterpreted as a hint at an antagonism at _2C-adrenoceptors.⁸ This conclusion appeared at that time to be supported by a comparison with the ₂-autoreceptors in the human kidney, which had been suggested to be of the _2C-subtype.¹⁷ However, in a recent reinvestigation by the same group, the presynaptic ₂-autoreceptors in the human kidney could be unequivocally subclassified as _2A,⁹ which is in agreement with the subclassification of the ₂-autoreceptors in human saphenous vein² and brain.¹⁸ This conforms to the rule that ₂-autoreceptors belong predominantly to the genetic _2A/D-subtype of the ₂-adrenoceptor.⁹

In the present experiments, 5 lines of evidence argue in favor of an identity of the ₂-autoreceptors with the _2A-subtype and against an identity with the _2B- or _2C-subtypes: (1) Prazosin (1 µmol/L) did not counteract the moxonidine-induced inhibition of evoked norepinephrine release, although this concentration is 11 and 32 times higher than its binding affinity at recombinant _2B- and _2C-adrenoceptors (Table 1). Prazosin concentrations >1 µmol/L could not be applied because they produced a marked increase in basal tritium efflux. (2) The lack of intrinsic activity of oxymetazoline in the native human atrial appendages would be compatible with both an _2A and _2C character. However, the relatively high potency of oxymetazoline in shifting the concentration-response curve for moxonidine to the right (ie, in acting as an antagonist: apparent pA₂ value 7.77) argues against an _2C as well as an _2B character of these receptors. (3) The affinity ratio of oxymetazoline/rauwolscine is particularly suitable to discriminate between the ₂-adrenoceptor subtypes (for details see Reference ⁹ ). In human atrial appendages, this ratio (3.6) is close to that for recombinant _2A-sites (4.2) but distinctly different from the ratios for recombinant _2B-sites (356) and _2C-sites (317). (4) When the potencies of the compounds acting as antagonists at the presynaptic ₂-adrenoceptors of the human heart (Table 1) were compared with their affinities for human recombinant _2A-, _2B-, and _2C-adrenoceptors, there was a significant correlation for _2A-adrenoceptors (r=0.93; P<0.03; regression line almost identical to the line of identity) but not for _2B- and _2C-adrenoceptors. (5) Moxonidine was recently shown to be devoid of agonistic activity at human recombinant _2B- and _2C-adrenoceptors, whereas it acted as a full agonist at the human recombinant _2A-adrenoceptor (Table 1 and Reference ¹⁹ ).

Different Pharmacological Properties of Human and Rabbit ₂-Autoreceptors
Although both ₂-autoreceptors in human (Reference ² ; present study) and rabbit blood vessels² can be classified as _2A-adrenoceptors on the basis of the effects of ₂-adrenoceptor antagonists, the results of the present study highlight pronounced differences in the effects of rilmenidine and oxymetazoline. They were full agonists at rabbit ₂-autoreceptors but they antagonized the inhibitory effect of moxonidine on evoked norepinephrine release from human atrial appendages. Their antagonistic potency is very similar to their affinity determined in radioligand binding studies (Table 1). At a stimulation frequency of 6 Hz, at which the concentration of the endogenous norepinephrine in the synaptic cleft is much higher, leading to a more pronounced activation of the _2A-autoreceptors than at 2 Hz, rilmenidine enhanced evoked [³H]norepinephrine release; in other words, it again exhibited the typical behavior of an antagonist at _2A-autoreceptors in that it disinhibited release. Interestingly, it has recently been reported that rilmenidine was also devoid of agonistic activity at the _2A-adrenoceptors in porcine tail artery and urinary bladder,²⁰ which are structurally most similar to the human _2A-adrenoceptors (Table 2).

Relation Between Pharmacological Subclassification and Genetic Encoding of the Receptor
The construction, expression, and pharmacological characterization of chimeric mouse _2D/human _2A-adrenoceptors²¹ and mutant _2A-adrenoceptors²² led to the assumption that the amino acid sequence spanning the fifth transmembrane region, in particular the cysteine residue at position 201, might determine the pharmacological properties of the _2A-adrenoceptor. In fact, the human and porcine genes for the _2A-adrenoceptor have a cysteine at position 201, whereas the rat and mouse genes that code for ₂-adrenoceptors with an _2D pharmacology have a serine at this position (Table 2). The sequence for the rabbit clone in the region considered here is homologous to the so-far-known other _2A sequences and shows a cysteine at position 201 (Table 2). As mentioned above, the pharmacological properties of the rabbit ₂-adrenoceptor basically conform to the _2A character,² which would be in agreement with the cysteine in position 201 as a determinant of the pharmacological properties. However, the differences observed with respect to the effects of rilmenidine and oxymetazoline point to other structural features that can modify the properties of the receptor. According to that, compared with the sequence of the human _2A-adrenoceptor, there are substantial changes of 6 amino acids (4 changes of highly conserved amino acids) and a deletion of 2 amino acids (Table 2). Taken together, our observations of different pharmacological characteristics of human and rabbit _2A-adrenoceptors are reflected by substantial differences between both receptors in the nucleotide and amino acid sequence.

Implications for the Antihypertensive Effect of Rilmenidine
As outlined in the introduction, rilmenidine has been suggested to decrease blood pressure in humans by activating ₂-adrenoceptors in the rostral ventrolateral medulla,^{5 6} which belong to the _2A-subtype.^{3 4} However, in view of the antagonistic property of rilmenidine at human _2A-adrenoceptors found here, this possibility must be excluded. Therefore, the hypotensive effect of the drug must be due to another mechanism, probably to an activation of I₁-imidazoline receptors (for review, see References ^{23 24} ).

	Acknowledgments

 
This study was supported by a grant from the Deutsche Forschungsgemeinschaft. The technical assistance of Dorothea Funccius, Marlies Hartwig, and Babette Lentz is gratefully acknowledged.

Received September 27, 1999; first decision November 12, 1999; accepted March 6, 2000.

	References

Top Abstract Introduction Methods Results Discussion References

 

1. Bylund DB, Eikenburg DC, Hieble JP, Langer SZ, Lefkowitz RJ, Minneman KP, Molinoff PB, Ruffolo RR. International Union of Pharmacology nomenclature on adrenoceptors. Pharmacol Rev. 1994;46:121–136.[Medline] [Order article via Infotrieve]
2. Molderings GJ, Göthert M. Subtype determination of presynaptic ₂-autoreceptors in the rabbit pulmonary artery and human saphenous vein. Naunyn Schmiedebergs Arch Pharmacol. 1995;352:483–490.[Medline] [Order article via Infotrieve]
3. DeVos H, Vauquelin G, De Keyser J, De Backer JP, van Liefde I. Regional distribution of _2A- and _2B-adrenoceptors subtypes in postmortem human brain. J Neurochem. 1992;58:1555–1560.[Medline] [Order article via Infotrieve]
4. Sastre M, Garcia-Sevilla JA. ₂-Adrenoceptor subtypes identified by [³H]-RX-821002 binding in the human brain: the agonist guanoxabenz does not discriminate different forms of the predominant _2A subtype. J Neurochem. 1994;63:1077–1085.[Medline] [Order article via Infotrieve]
5. Bock C, Niederhoffer N, Szabo B. Analysis of the receptor involved in the central hypotensive effect of rilmenidine and moxonidine. Naunyn Schmiedebergs Arch Pharmacol. 1999;359:262–271.[Medline] [Order article via Infotrieve]
6. Szabo B, Boch C, Nordheim U, Niederhoffer N. Mechanism of sympathoinhibition produced by the clonidine-like drugs rilmenidine and moxonidine. Ann N Y Acad Sci. 1999;881:253–264.[Free Full Text]
7. Jasper JR, Lesnick JD, Chang LK, Yamanishi SS, Chang TK, Hsu SAO, Daun DA, Bonhaus DW, Eglen RM. Ligand efficacy and potency at recombinant ₂ adrenergic receptors. Biochem Pharmacol. 1998;55:1035–1043.[Medline] [Order article via Infotrieve]
8. Rump LC, Bohmann C, Schaible U, Schöllhorn J, Limberger N. _2C-Adrenoceptor-modulated release of noradrenaline in human right atrium. Br J Pharmacol. 1995;116:2617–2624.[Medline] [Order article via Infotrieve]
9. Trendelenburg AU, Sutej I, Wahl CA, Molderings GJ, Rump LC, Starke K. A re-investigation of questionable subclassifications of presynaptic ₂-autoreceptors: rat vena cava, rat atria, human kidney and guinea-pig urethra. Naunyn Schmiedebergs Arch Pharmacol. 1997;356:721–737.[Medline] [Order article via Infotrieve]
10. Göthert M, Molderings GJ. Involvement of presynaptic imidazoline receptors in the ₂-adrenoceptor-independent inhibition of noradrenaline release by imidazoline derivatives. Naunyn Schmiedebergs Arch Pharmacol. 1991;343:271–282.[Medline] [Order article via Infotrieve]
11. Molderings GJ, Linkungu J, Göthert M. Presynaptic cannabinoid and imidazoline receptors in the human heart and their potential relationship. Naunyn Schmiedebergs Arch Pharmacol. 1999;360:157–164.[Medline] [Order article via Infotrieve]
12. Furchgott RF. The classification of adrenoceptors (adrenergic receptors): an evaluation from the standpoint of receptor theory. In: Blaschko H, Muscholl E, eds. Handbook of Experimental Pharmacology. (Catecholamines, Vol XXXIII). Berlin/Heidelberg/New York: Springer; 1972:283–335.
13. Sanger F, Nicklen S, Coulson AR. DANN sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A. 1977;74:5463–5467.[Abstract/Free Full Text]
14. Molderings GJ, Frölich D, Likungu J, Göthert M. Inhibition of norepinephrine release via presynaptic 5-HT_1D receptors in human atrium. Naunyn Schmiedebergs Arch Pharmacol. 1996;353:272–280.[Medline] [Order article via Infotrieve]
15. Schoeffter P, Hoyer D. Interaction of the -adrenoceptor agonist oxymetazoline with serotonin 5-HT_1A, 5-HT_1B, 5-HT_1C and 5-HT_1D receptors. Eur J Pharmacol. 1991;196:213–216.[Medline] [Order article via Infotrieve]
16. Rump LC, Riera-Knorrenschild G, Schwertfeger E, Bohmann C, Spillner G, Schollmeyer P. Dopaminergic, and -adrenergic control of neurotransmission in human right atrium. J Cardiovasc Pharmacol. 1995;26:462–470.[Medline] [Order article via Infotrieve]
17. Trendelenburg AU, Limberger N, Rump LC. ₂-Adrenergic receptors of the _2C subtype mediate inhibition of norepinephrine release in human kidney cortex. Mol Pharmacol. 1994;45:1168–1176.[Abstract]
18. Raiteri M, Bonanno G, Maura G, Pende M, Andrioli GC, Ruelle A. Subclassification of release-regulating ₂-autoreceptors in human brain cortex. Br J Pharmacol. 1992;107:1146–1151.[Medline] [Order article via Infotrieve]
19. Zhu QM, Lesnick JD, Jasper JR, MacLennan SJ, Dillon MP, Eglen RM, Blue DR. Cardiovascular effects of rilmenidine, moxonidine and clonidine in conscious wild-type and D79N _2A-adrenoceptor transgenic mice. Br J Pharmacol. 1999;126:1522–1530.[Medline] [Order article via Infotrieve]
20. Ali A, Cheng HY, Ting KN, Wilson VG. Rilmenidine reveals differences in the pharmacological characteristics of prejunctional ₂-adrenoceptors in the guinea-pig, rat and pig. Br J Pharmacol. 1998;125:127–135.[Medline] [Order article via Infotrieve]
21. Link R, Daunt D, Barsh G, Chruscinski A, Kobilka B. Cloning of 2 mouse genes encoding ₂-adrenergic receptor subtypes and identification of a single amino acid in the mouse ₂-C10 homolog responsible for an interspecies variation in antagonist binding. Mol Pharmacol. 1992;42:16–27.[Abstract]
22. Salminen T, Varis M, Nyrönen T, Pihlavisto M, Hoffren AM, Lönnberg T, Marjamäki A, Frang H, Savola JM, Scheinin M, Johnson MS. Three-dimensional models of 2A-adrenergic receptor complexes provide a structural explanation for ligand binding. J Biol Chem. 1999;274:23405–23413.[Abstract/Free Full Text]
23. Ernsberger P, Haxhiu MA. The I₁-imidazoline binding site is a functional receptor mediating vasodepression via the ventral medulla. Am J Physiol. 1997;273:R1572–R1579.
24. Head GA. Central imidazoline- and ₂-receptors involved in the cardiovascular actions of centrally acting antihypertensive agents. N York Acad Sci. 1999;881:279–286.
25. Molderings GJ, Hentrich F, Göthert M. Pharmacological characterization of the imidazoline receptor which mediates inhibition of norepinephrine release in the rabbit pulmonary artery. Naunyn Schmiedebergs Arch Pharmacol. 1991;344:630–638.[Medline] [Order article via Infotrieve]
26. Starke K, Montel H, Gayk W, Merker R. Comparison of the effects of clonidine on pre- and postsynaptic adrenoceptors in the rabbit pulmonary artery. Naunyn Schmiedebergs Arch Pharmacol. 1974;285:133–150.[Medline] [Order article via Infotrieve]

This article has been cited by other articles:

				D. M. Platt, J. K. Rowlett, and R. D. Spealman Noradrenergic Mechanisms in Cocaine-Induced Reinstatement of Drug Seeking in Squirrel Monkeys J. Pharmacol. Exp. Ther., August 1, 2007; 322(2): 894 - 902. [Abstract] [Full Text] [PDF]

				W. Raasch, B. Jungbluth, U. Schafer, W. Hauser, and P. Dominiak Modification of Noradrenaline Release in Pithed Spontaneously Hypertensive Rats by I1-Binding Sites in Addition to alpha 2-Adrenoceptors J. Pharmacol. Exp. Ther., March 1, 2003; 304(3): 1063 - 1071. [Abstract] [Full Text] [PDF]

				D. P. Naselsky, D. Ashton, R. R. Ruffolo Jr., and J. P. Hieble Rabbit alpha 2-Adrenoceptors: Both Platelets and Adipocytes Have alpha 2A-Pharmacology J. Pharmacol. Exp. Ther., July 1, 2001; 298(1): 219 - 225. [Abstract] [Full Text]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Molderings, G. J. Articles by Göthert, M. Search for Related Content PubMed PubMed Citation Articles by Molderings, G. J. Articles by Göthert, M. Pubmed/NCBI databases Compound via MeSH Substance via MeSH Hazardous Substances DB OXYMETAZOLINE TRITIUM Related Collections Receptor pharmacology