(Hypertension. 2001;37:414.)
© 2001 American Heart Association, Inc.
Scientific Contributions |
Endothelial Dysfunction and Xanthine Oxidoreductase Activity in Rats With Human Renin and Angiotensinogen Genes
From the Institute of Biomedicine, Department of Pharmacology and Toxicology (E.M.A.M., Z.J.C., K.N., H.V.) and Department of Medical Chemistry (R.L.), University of Helsinki, Helsinki, Finland; Department of Medicine, Helsinki University Central Hospital and Minerva Institute for Medical Research, Helsinki, Finland (I.T.); and Franz Volhard Clinic, Medical Faculty of the Charité, Humboldt University of Berlin and Max Delbrück Center for Molecular Medicine, Berlin, Germany (D.N.M., A.F., U.G., D.G., F.C.L.).
Correspondence to Eero Mervaala, MD, PhD, Assistant Professor, Institute of Biomedicine, Department of Pharmacology and Toxicology, PO Box 8, FIN-00014 University of Helsinki, Finland. E-mail eero.mervaala{at}helsinki.fi
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
We examined whether xanthine oxidoreductase (XOR), a hypoxia-inducible enzyme capable of generating reactive oxygen species, is involved in the onset of angiotensin (Ang) II–induced vascular dysfunction in double-transgenic rats (dTGR) harboring human renin and human angiotensinogen genes. In 7-week-old hypertensive dTGR, the endothelium-mediated relaxation of noradrenaline (NA)-precontracted renal arterial rings to acetylcholine (ACh) in vitro was markedly impaired compared with Sprague Dawley rats. Preincubation with superoxide dismutase (SOD) improved the endothelium-dependent vascular relaxation, indicating that in dTGR, endothelial dysfunction is associated with increased superoxide formation. Preincubation with the XOR inhibitor oxypurinol also improved endothelium-dependent vascular relaxation. The endothelium-independent relaxation to sodium nitroprusside was similar in both strains. In dTGR, serum 8-isoprostaglandin F2
, a
vasoconstrictor and antinatriuretic
arachidonic acid metabolite produced by oxidative
stress, was increased by 100%, and the activity of XOR in the kidney
was increased by 40%. Urinary nitrate plus nitrite
(NOx) excretion, a marker of total body NO
generation, was decreased by 85%. Contractile responses of renal
arteries to Ang II, endothelin-1 (ET-1), and NA were decreased in dTGR,
suggesting hypertension-associated generalized changes in the vascular
function rather than a receptor-specific desensitization. Valsartan (30
mg/kg PO for 3 weeks) normalized blood pressure,
endothelial dysfunction, and the contractile responses
to ET-1 and NA. Valsartan also normalized serum
8-isoprostaglandin F2 levels,
renal XOR activity, and, to a degree, NOx
excretion. Thus, overproduction of Ang II in dTGR induces
pronounced endothelial dysfunction, whereas the
sensitivity of vascular smooth muscle cells to nitric oxide is
unaltered. Ang II–induced endothelial dysfunction is
associated with increased oxidative stress and vascular xanthine
oxidase activity.
Key Words: endothelium • superoxide • arachidonic acid • xanthine • endothelin • angiotensin II • receptors, angiotensin II
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The endothelium regulates vasomotor tone, local hemostasis, and proliferation by releasing vasodilator substances (nitric oxide [NO], prostacyclin, or endothelium-derived hyperpolarizing factor) and vasoconstrictor substances (endothelin-1 [ET-1], angiotensin II [Ang II], thromboxane A2, or free radicals) in response to physiological stimuli.1 2 3 Maintenance of endothelial integrity is critical for the preservation of blood flow and the prevention of thrombosis.2 Ang II may cause oxidative stress in essential hypertension.4 NADPH oxidase is the major source of superoxide in vascular cells and myocytes5 and is induced by Ang II.5 6 7 Xanthine oxidoreductase (XOR) is a hypoxia-inducible enzyme8 also capable of producing superoxide anion in the vascular endothelium.9 10 Spontaneously hypertensive rats (SHR) and Dahl salt-sensitive rats have higher XOR activities in the kidney and other tissues.11 12 We13 have also demonstrated that chronic inhibition of NO synthase by NG-nitro-L -arginine methyl ester (L-NAME) induces renal XOR in SHR. Hypertension and vascular damage in double-transgenic rats (dTGR) harboring the human renin and human angiotensinogen genes are dependent on local Ang II formation.14 15 Perivascular leukocyte infiltration and endothelial adhesion molecule activation play a central role in the pathogenesis of Ang II–induced myocardial and renal damage in dTGR.16 17 Ang II induces perivascular inflammation and cell proliferation, even by blood pressure–independent mechanisms.18 The transcription factors nuclear factor-
B (NF- B) and activator
protein-1 (AP-1) are involved in the initiation of chemokine and
cytokine overexpression in
dTGR.19 Clozel et
al20 made similar
observations on monocyte/macrophage infiltration and
endothelial dysfunction in SHR. In the present
study, we tested whether increased oxidative stress and XOR activity
are involved in the onset of Ang II–induced vascular dysfunction in
dTGR. |
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
We used 40 male dTGR (4 weeks old) and 10 age-matched normotensive Sprague Dawley (SD) rats (Max Delbrück Center for Molecular Medicine). The dTGR are described elsewhere.14 15 The protocols were approved by the Animal Experimentation Committee of the Institute of Biomedicine, University of Helsinki, Finland, whose standards correspond to those of the American Physiological Society. The rats had free access to chow (NaCl 0.8%) and drinking water. dTGR and normotensive SD control rats were divided into 3 groups: (1) dTGR control group (n=25), (2) dTGR plus valsartan group (n=15), and (3) SD control group (n=10). Valsartan was given by gavage once a day (30 mg/kg) for 3 weeks. This dose produced the maximal antihypertensive effect in dTGR in our previous study.21 Control dTGR and SD rats received the same volume of vehicle (0.5% carboxymethyl cellulose). Systolic blood pressure was measured weekly by a tail-cuff blood pressure analyzer (Apollo-2AB Blood Pressure Analyzer, model 179-2AB, IITC Life Science) 24 hours after the last drug dose. At 7 weeks, urine was collected over 24 hours; the animals were then decapitated, and blood samples were taken for serum 8-isoprostaglandin F2
measurement. The heart and kidneys were excised, washed with ice-cold
saline, blotted dry, and weighed. Tissue samples were snap-frozen in
liquid nitrogen, and samples for autoradiography were
put in isopentane (-35°C). All samples were stored at -80°C
until assayed. For measurements of vascular responses, the renal artery
was carefully excised and cleaned of the adherent connective tissue.
Two successive 2-mm sections, 3 mm distal from the renal
artery-aorta junction, were used. For morphological analysis,
tissue samples were fixed in 4% buffered
paraformaldehyde at room temperature, dehydrated in
graded alcohol, and embedded in paraffin. Two- to 3-µm sections were
cut with a Leitz microtome (Leitz 1512). The sections were
deparaffinized and rehydrated before being stained with
hematoxylin-eosin and Masson trichrome. The tissues were examined
without knowledge of the rats’ identity. The endothelium intact arterial rings were placed between stainless steel hooks and mounted in an organ bath chamber in physiological salt solution (pH 7.4) of the following composition (mmol/L): NaCl 119.0, NaHCO3 25.0, glucose 11.1, CaCl2 1.6, KCl 4.7, KH2PO4 1.2, and MgSO4 1.2 aerated with 95% O2 and 5% CO2. The rings were equilibrated for 60 minutes at 37°C with a resting tension of 1.5g. The force of contraction was measured with an isometric force-displacement transducer and recorded on a polygraph (FTO3C transducer, model 7 C8 Polygraph; Grass Instrument Co). The presence of intact endothelium in the vascular preparations was confirmed by observing the relaxation response to 1 µmol/L acetylcholine (ACh) in rings precontracted with 0.1 µmol/L noradrenaline (NA). The concentration contraction curves to cumulative NA and ET-1 and the concentration relaxation curves to cumulative ACh and sodium nitroprusside were determined. Because of rapid development of tachyphylaxis, Ang II was given as a single concentration (0.1 µmol/L). To evaluate the role of superoxide anion and XOR in the pathogenesis of endothelial dysfunction, relaxation responses to ACh were also examined in dTGR after preincubation with superoxide dismutase (SOD; 750 IU/mL for 45 minutes) and oxypurinol (1 mmol/L for 60 minutes), respectively.
For autoradiographic studies, frozen kidney sections (20 µm thick) were cut on a cryostat at -17°C, thaw-mounted onto Super Frost Plus slides, dried in a dessicator under reduced pressure at 4°C overnight, and stored at -80°C with silica gel until further processing for autoradiographic studies. ACE, angiotensin receptors (AT1 and AT2), and neutral endopeptidase were quantified by in vitro autoradiography as described previously.22 23 24 25 26 27
Renal AT1 mRNA expression was measured with real-time quantitative reverse transcription–polymerase chain reaction (RT-PCR; ABI’s Prism 7700 Sequence Detection System, Perkin Elmer) according to the instructions of the TaqMan EZ RT-PCR TaqMan kit protocol. The following RT-PCR primers and TaqMan-probe for GAPDH and AT1 receptor were used: GAPDH forward, AAGCTGGTCATCAATGGGAAAC; GAPDH reverse, ACCCCATTTGATGTTAGCGG; GAPDH probe, CATCACCATCTTCCAGGAGCGCGCGAT, FAM (6-carboxytetrafluorescein) and TAMRA (quencher) labeled; AT1 receptor forward, CCATCGTCCACCCAATGAAG; AT1 receptor reverse, TGCAGGTGACTTTGGCCAC; and AT1 receptor probe, FAM-TCGCCTTCGCCGCACGATG-TAMRA.
Renal XOR activity was measured fluorometrically as
described in detail
previously,12 and urinary
nitrate plus nitrite concentration (NOx) was
measured with a commercially available nitrate/nitrite
colorimetric assay kit (Cayman). Serum
8-isoprostaglandin F2
concentration was determined by ELISA (Cayman) according to the
instructions of the manufacturer.
Data are presented as mean±SEM. Statistically significant differences in mean values were tested by ANOVA and the Tukey multiple range test. ANOVA for repeated measurements was applied for data consisting of repeated observations at successive time points. The differences were considered significant at P<0.05. Data were analyzed with SYSTAT statistical software.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Valsartan treatment normalized blood pressure, cardiac hypertrophy, and 24-hour proteinuria in dTGR (Table). ACh evoked a dose-dependent relaxation in both strains (Figure 1A). However, endothelium-dependent vascular relaxations to ACh were markedly impaired in dTGR compared with controls (Figure 1A). Maximal relaxation in the renal arteries was 43±13% in dTGR and 94±2% in SD rats, respectively (P<0.05). Valsartan treatment improved vascular relaxation responses to ACh (Figure 1A). Preincubation of the renal arteries with SOD (Figure 1B) and oxypurinol (Figure 1C) markedly improved endothelium-dependent vascular relaxations to ACh in dTGR. In an additional in vitro experiment, we examined the effects of SOD and oxypurinol on endothelium-dependent vascular relaxation in 7-week-old normotensive SD rats (n=5). Preincubation of the renal arteries with SOD did not markedly influence the endothelium-dependent vascular relaxation to ACh (maximal relaxation 80.0±5.2% versus 72.7±7.2%, P=0.46). Endothelium-dependent vascular relaxation in response to ACh was also unaltered by preincubation with oxypurinol (80.2±4.2% versus 73.1±8.0%, P=0.47). Serum 8-isoprostaglandin F2
levels were increased by 100% in dTGR
(Figure 1D), and the activity of XOR in the kidney was
increased by 40%
(Figure 1E), whereas urinary NOx
excretion was decreased by 85%
(Figure 1F). Valsartan treatment improved vascular relaxation
responses to ACh
(Figure 1A), normalized serum 8-isoprostaglandin
F2 levels
(Figure 1D), renal XOR activity
(Figure 1E), and, to a degree, NOx
excretion
(Figure 1F).
|
|
Endothelium-independent vascular relaxation to sodium nitroprusside was similar between dTGR and SD rats (Figure 2A). Valsartan improved endothelium-independent vascular relaxation (Figure 2A). Contractions to a single dose of Ang II (0.1 µmol/L) were more pronounced in SD rats than in untreated and valsartan-treated dTGR (Figure 2B). The contractile responses to NA (Figure 2C) and ET-1 (Figure 2D) were also markedly impaired in dTGR but were normalized by valsartan. The vascular media-to-lumen ratio tended to be slightly increased in dTGR compared with SD rats (0.20±0.04 versus 0.14±0.09); however, this difference did not reach statistical significance (P=0.32). The vascular morphology between SD and dTGR was similar by light microscopy.
|
In dTGR, AT1 and AT2 receptor expressions in the cortex and medulla were markedly decreased, whereas ACE expression was unchanged (Table). Valsartan slightly increased cortical AT1 receptor expression. AT1 expression in medulla, as well as AT2 and ACE expressions, was unchanged. In dTGR, renal AT1 mRNA expression was markedly decreased compared with SD rats (Table). Valsartan treatment increased renal AT1 mRNA expression to levels found in SD rats.
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Hypertension, disturbances in renal hemodynamics, and perivascular inflammation in dTGR are due to local Ang II formation in the heart, kidney, and vasculature. Because the endothelium in large part controls vasomotor tone, as well as intrarenal hemodynamics, by releasing endothelium-derived vasoactive substances, we characterized renal vascular functions in dTGR. Furthermore, we tested whether increased oxidative stress and XOR activity are involved in the onset of Ang II–induced vascular dysfunction in dTGR. We found that hypertension in dTGR is associated with impaired endothelium-mediated vascular relaxation, whereas endothelium-independent vascular relaxation in dTGR was unchanged. Ang II–induced endothelial dysfunction was associated with increased superoxide formation and vascular XOR activity, because preincubations of the arteries with SOD and oxypurinol markedly improved ACh-mediated vascular relaxation, respectively. Furthermore, the serum level of 8-isoprostaglandin F2
, a
vasoconstrictor and antinatriuretic
arachidonic acid metabolite produced by oxidative
stress,28 was increased by
100% in dTGR, and the activity of XOR in the kidney was increased by
40%. We also demonstrated that urinary NOx
excretion, a commonly used marker of total body NO generation, was
markedly decreased in dTGR. Taken together, our findings indicate that
overproduction of Ang II in dTGR induces pronounced
endothelial dysfunction, whereas the sensitivity of
vascular smooth muscle cells to NO is unaltered. Ang II–induced
endothelial dysfunction is associated with increased
oxidative stress and vascular xanthine oxidase activity.
Ang II induces pronounced endothelial
dysfunction when infused into normotensive
rats.7 29
Interestingly, subpressor Ang II doses selectively modify vascular NO
bioavailability.29 Moreover,
endothelial dysfunction may precede other established
Ang II–induced vascular
effects.29 Ang II stimulates
superoxide generation by increasing the activity of the NAD(P)H oxidase
in vitro6 and in
vivo.7 Furthermore,
endothelial dysfunction in Ang II–infused rats can be
corrected by liposome-encapsulated SOD and AT1
receptor blockade.7 Even a
subpressor dose of Ang II causes oxidative stress, as measured by the
production of 8-isoprostaglandin
F2, a
noncyclooxygenase–produced metabolite of
arachidonic
acid.4 30 In
agreement with these findings, we showed here that the serum
8-isoprostaglandin F2 level was
100% increased in untreated dTGR and that preincubation of the
renal arteries with SOD effectively improved ACh-mediated,
endothelium-dependent vascular relaxation. Our findings
agree with previous studies conducted in other transgenic animal models
with increased Ang II
production.31 32 33
Whether or not endothelial dysfunction in dTGR is due
to the direct effects of Ang II on endothelial cells
and/or Ang II–induced hypertension is capable of impairing
endothelial function indirectly remains to be
determined. We also demonstrated in the present study that chronic
AT1 receptor blockade effectively normalized
endothelium-dependent vascular relaxation in dTGR.
AT1 receptor blockade also slightly improved the
sensitivity of vascular smooth muscle cells to NO.
XOR plays an important role in purine catabolism by producing urate from the ATP degradation products xanthine and hypoxanthine. Previous studies by us and others have shown that SHR and Dahl salt-sensitive rats have higher XOR activities in the kidney and other tissues.11 12 We have also demonstrated that chronic inhibition of NO synthase by L-NAME induces renal XOR in SHR.13 In the present study, preincubation of renal arteries with the XOR inhibitor oxypurinol improved endothelium-dependent vascular relaxation by 20%. Renal XOR activity was also increased substantially in dTGR. Hence, our data support the notion that endothelial dysfunction in dTGR is mediated, at least in part, by reactive oxygen species generated by XOR. However, we would like to emphasize that endothelial dysfunction in dTGR was only partially corrected by XOR inhibition, whereas it was completely normalized by SOD. Therefore, it is very likely that, compared with XOR, other enzyme systems capable of producing reactive oxygen species (ie, NADH/NADPH oxidase and uncoupled endothelial NO synthase) play a more important role in the onset of Ang II–induced vascular dysfunction in dTGR.
In the renal artery, the contractile response to Ang II was less prominent in dTGR than in SD rats. This finding is in line with a previous study by Arnet et al32 using aortic rings from TGR(mRen2)27 rats. We18 reported recently that Ang II concentrations in the plasma and kidney are 4- to 5-fold higher in dTGR than in SD rats. AT1 receptor protein expression and AT1 mRNA were both decreased in dTGR kidneys. Our findings clearly indicate that high circulating Ang II and tissue Ang II concentrations induce agonist-dependent AT1 receptor downregulation in dTGR. Our data thus contradict the recent findings in TGR(mRen2)27 rats, where fulminant hypertension and elevated circulating and tissue Ang II concentrations were associated with markedly increased AT1 receptor expression in renal vasculature and glomeruli.34 We also showed that AT2 receptors are downregulated in dTGR. Hence, our findings indicate that intrarenal AT1 and AT2 receptors are subject to negative feedback regulation.
Previous studies35 have underscored the major importance of the endothelin system in the regulation of kidney hemodynamics and functions. Furthermore, recent data36 suggest that in acute renal failure, endothelial dysfunction is associated with increased circulating and tissue ET-1 levels. Cell culture studies have revealed that Ang II is a powerful stimulator of ET-1 synthesis and release in vascular smooth muscle and endothelial cells. We showed that the vascular contractile responses to ET-1 in dTGR were markedly attenuated in the renal arteries and that chronic AT1 receptor blockade was associated with normalization of ET-1 contractile responses in dTGR. We37 reported recently that the ET-A/ET-B receptor antagonist bosentan markedly ameliorates end-organ damage in dTGR, which supports these findings. Interestingly, vascular contractile responses to NA were also attenuated in dTGR and were normalized by valsartan treatment. Previous studies have shown that Ang II stimulates sympathetic nervous system centrally and peripherally through activation of the presynaptic AT1 receptors. Taken together, our findings of the diminished vascular contractile responses to Ang II, ET-1, and NA in dTGR support generalized vascular changes associated with hypertension rather than a receptor-specific desensitization.
In conclusion, our findings indicate that overproduction of Ang II in dTGR induces pronounced endothelial dysfunction, whereas the sensitivity of vascular smooth muscle cells to NO is unaltered. Ang II–induced endothelial dysfunction is associated with increased oxidative stress and vascular xanthine oxidase activity.
|
Acknowledgments |
|---|
This study was supported by grants from the Finnish Foundation for Cardiovascular Research, the Academy of Finland, the Sigrid Jusélius Foundation, and the Helsinki University Central Hospital Research Grant. We are grateful to Anneli von Behr, Terhi Ilomäki, Tuula Riihimäki, Toini Siiskonen, and Sari Laakkonen for expert technical assistance. Finally, these studies would not have been successful without the tireless support of Detlev and Ursula Ganten.
|
Footnotes |
|---|
E. Mervaala and Z.J. Cheng contributed equally to this work.
Received October 26, 2000; first decision December 20, 2000; accepted December 20, 2000.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Harrison DG. Cellular and molecular mechanisms of endothelial dysfunction. J Clin Invest. 1997;100:2153–2157.[Medline] [Order article via Infotrieve]
2. Kojda G, Harrison D. Interactions between NO and reactive oxygen species: pathophysiological importance in atherosclerosis, hypertension, diabetes and heart failure. Cardiovasc Res. 1999;43:562–571.[Medline] [Order article via Infotrieve]
3.
McIntyre M,
Bohr DF, Dominiczak AF. Endothelial function in
hypertension: the role of superoxide anion.
Hypertension. 1999;34:539–545.
4.
Romero JC,
Reckelhoff JF. Role of angiotensin and oxidative stress in
essential hypertension.
Hypertension. 1999;34:943–949.
5.
Griendling K,
Sorescu D, Ushio-Fukai M. NAD(P)H oxidase: role of
cardiovascular biology and disease.
Circ Res. 2000;86:494–501.
6.
Griendling
KK, Minieri D, Ollerenshaw D, Alexander RW. Angiotensin II
stimulates NADH and NADPH oxidase activity in cultured vascular smooth
muscle cells. Circ Res. 1994;74:1141–1148.
7. Rajagopalan S, Kurz S, Munzel T, Tarpey M, Freeman BA, Griendling KK, Harrison DG. Angiotensin II-mediated hypertension in the rat increases vascular superoxide production via membrane NADH/NADPH oxidase activation: contribution to alterations of vasomotor tone. J Clin Invest. 1996;97:1916–1923.[Medline] [Order article via Infotrieve]
8. Panus PC, Wright SA, Chumley PH, Radi R, Freeman BA. The contribution of vascular endothelial xanthine dehydrogenase/oxidase to oxygen mediated injury. Arch Biochem Biophys. 1992;294:695–702.[Medline] [Order article via Infotrieve]
9. Parks DA, Granger DN. Xanthine oxidase: biochemistry, distribution and physiology. Acta Physiol Scand Suppl. 1986;548:87–99.
10.
Houston M,
Estevez A, Chumley P, Aslan M, Marklund S, Parks DA, Freeman BA.
Binding of xanthine oxidase to vascular endothelium.
J Biol Chem. 1999;274:4985–4994.
11.
Suzuki H,
DeLano FA, Parks DA, Jamshidi N, Granger DN, Ishii H, Suematsu M,
Zweifach BW, Schmid-Schönbein GW. Xanthine oxidase activity
associated with arterial blood pressure in spontaneously
hypertensive rats. Proc Natl Acad Sci
U S A. 1998;95:4754–4759.
12.
Laakso J,
Mervaala E, Himberg J-J, Teräväinen T-L, Karppanen H, Vapaatalo H,
Lapatto R. Increased kidney xanthine oxidoreductase activity in
salt-induced experimental hypertension.
Hypertension. 1998;32:902–906.
13. Laakso J, Vaskonen T, Mervaala E, Vapaatalo H, Lapatto R. Inhibition of nitric oxide synthase induces renal xanthine oxidoreductase activity in spontaneously hypertensive rats. Life Sci. 1999;65:2679–2685.[Medline] [Order article via Infotrieve]
14.
Ganten D,
Wagner J, Zeh K, Bader M, Michel JP, Paul M, Zimmermann F, Ruf P,
Hilgenfeldt U, Ganten U, Kaling M, Bachmann S, Fukamizu A, Mullins JJ,
Murakami K. Species specificity of renin kinetics in transgenic rats
harboring human renin and angiotensinogen genes.
Proc Natl Acad Sci
U S A. 1992;89:7806–7810.
15.
Bohlender
J, Fukamizu A, Lippoldt A, Nomura T, Dietz R, Ménard J, Murakami K,
Luft FC, Ganten D. High human renin hypertension in transgenic rats.
Hypertension. 1997;29:428–434.
16.
Luft FC,
Mervaala EMA, Muller DN, Gross V, Schmidt F, Park J-K, Schmitz C,
Lippoldt A, Breu V, Dechend R, Dragun D, Schneider W, Ganten D, Haller
H. Hypertension-induced end-organ damage: a new transgenic approach to
an old problem. Hypertension. 1999;33:212–218.
17.
Mervaala
EMA, Muller DN, Park J-K, Schmidt F, Löhn M, Breu V, Dragun D, Ganten
D, Haller H, Luft FC. Monocyte infiltration and adhesion molecules in a
rat model of high human renin hypertension.
Hypertension. 1999;33:389–395.
18.
Mervaala
EMA, Muller DN, Schmidt F, Park J-K, Gross V, Bader M, Breu V, Ganten
D, Haller H, Luft FC. Blood pressure-independent effects in rats with
human renin and angiotensinogen genes.
Hypertension. 2000;35:587–594.
19.
Müller DN,
Dechend R, Mervaala EMA, Park J-K, Schmidt F, Fiebeler A, Theuer J,
Breu V, Ganten D, Haller H, Luft FC. NF-kappaB inhibition ameliorates
angiotensin II-induced inflammatory damage in rats.
Hypertension. 2000;35:193–201.
20.
Clozel M,
Kuhn H, Hefti F, Baumgartner HR. Endothelial
dysfunction and subendothelial monocyte
macrophages in hypertension: effect of angiotensin
converting enzyme inhibition.
Hypertension. 1991;18:132–141.
21.
Mervaala
EMA, Dehmel B, Gross V, Lippoldt A, Bohlender J, Milia AF, Ganten D,
Luft FC. ACE inhibition and AT1 receptor
blockade modify pressure-natriuresis by different mechanisms in rats
with human renin and angiotensinogen genes.
J Am Soc Nephrol. 1999;10:1669–1680.
22. Kohzuki M, Johnston CI, Chai SY, Jackson B, Perich R, Paxton D, Mendelsohn FAO. Measurement of angiotensin converting enzyme induction and inhibition using quantitative in vitro autoradiography: tissue selective induction after chronic lisinopril treatment. J Hypertens. 1991;9:579–587.[Medline] [Order article via Infotrieve]
23. Zhuo J, Song K, Harris PJ, Mendelsohn FAO. In vitro autoradiographic reveals predominantly AT1 angiotensin II receptors in rat kidney. Renal Physiol Biochem. 1992;15:231–239.[Medline] [Order article via Infotrieve]
24.
Zhuo J,
Ohishi M, Mendelsohn FAO. Roles of AT1 and
AT2 receptors in the hypertensive ren-2 gene
transgenic rat kidney.
Hypertension. 1999;33:347–353.
25. Burrell LM, Farina NK, Risvanis J, Woollard D, Casley D, Johnston CI. Inhibition of neutral endopeptidase, the degradative enzyme for natriuretic peptides, in rat kidney after oral SCH 42495. Clin Sci. 1997;93:43–50.[Medline] [Order article via Infotrieve]
26.
Fournié-Zaluski
MC, Soleilhac JM, Turcaud S, Lai-Kuen R, Crine P, Beaumont A, Roques
BP. Development of [125I]RB104, a potent
inhibitor of neutral endopeptidase 24.11,
and its use in detecting nanogram quantities of the enzyme by
"inhibitor gel electrophoresis."
Proc Natl Acad Sci
U S A. 1992;89:6388–6392.
27.
Tikkanen T,
Tikkanen I, Rockell MD, Allen TJ, Johnston CI, Cooper ME, Burrell LM.
Dual inhibition of neutral endopeptidase and
angiotensin-converting enzyme in rats with hypertension and
diabetes mellitus.
Hypertension. 1998;32:778–785.
28.
Patrono C,
FitzGerald GA. Isoprostanes: potential markers of oxidant stress in
atherothrombotic disease. Arterioscler
Thromb Vasc Dis. 1997;17:2309–2315.
29.
Wattanapitayakul
SK, Weinstein DM, Holycross BJ, Bauer JA. Endothelial
dysfunction and peroxynitrite formation are early events in
angiotensin-induced cardiovascular
disorders. FASEB J. 2000;14:271–278.
30.
Haas JA,
Krier JD, Bolterman RJ, Juncos LA, Romero JC. Low-dose
angiotensin II increases free isoprostane levels in plasma.
Hypertension. 1999;34:983–986.
31. Pinto YM, Buikema H, van Hilst WH, Scholtens E, van Geel P-P, de Graeff PA, Wagner J, Paul M. Cardiovascular end-organ damage in Ren-2 transgenic rats compared to spontaneously hypertensive rats. J Mol Med. 1997;75:371–377.[Medline] [Order article via Infotrieve]
32. Arnet UA, Novosel D, Barton M, Noll G, Ganten D, Luscher TF. Endothelial dysfunction in the aorta of transgenic rats harboring the mouse Ren-2 gene. Endothelium. 1999;6:175–184.[Medline] [Order article via Infotrieve]
33.
Didion SP,
Sigmund CD, Faraci FM. Impaired endothelial function in
transgenic mice expressing both human renin and human
angiotensinogen.
Stroke. 2000;31:760–765.
34. Zhuo J, Ohishi M, Mendelsohn FAO. Roles of AT1 and AT2 receptors in the hypertensive ren-2 gene transgenic rat kidney. Hypertension. 1999;33:347–353.
35.
Schiffrin
E. Role of endothelin-1 in hypertension.
Hypertension. 1999;34:876–881.
36.
Ruschitzka
F, Shaw S, Gygi D, Noll G, Barton M, Luscher TF.
Endothelial dysfunction in acute renal failure: role of
circulating and tissue endothelin-1.
J Am Soc Nephrol. 1999;10:953–962.
37.
Müller DN,
Mervaala EMA, Schmidt F, Park JK, Dechen R, Genersch E, Breu V,
Löffler M-M, Schneider W, Ganten D, Haller H, Luft FC. Bosentan
ameliorates end-organ damage by inhibiting inflammation in rats with
high human renin hypertension.
Hypertension. 2000;36:282–290.
This article has been cited by other articles:
 |
|
 |
|
  L. Lavie and P. Lavie Molecular mechanisms of cardiovascular disease in OSAHS: the oxidative stress link Eur. Respir. J., June 1, 2009; 33(6): 1467 - 1484. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. M. Paravicini and R. M. Touyz NADPH Oxidases, Reactive Oxygen Species, and Hypertension: Clinical implications and therapeutic possibilities Diabetes Care, February 1, 2008; 31(Supplement_2): S170 - S180. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Alvarez, J. V. Perez-Giron, R. Hernanz, A. M. Briones, A. Garcia-Redondo, A. Beltran, M. J. Alonso, and M. Salaices Losartan Reduces the Increased Participation of Cyclooxygenase-2-Derived Products in Vascular Responses of Hypertensive Rats J. Pharmacol. Exp. Ther., April 1, 2007; 321(1): 381 - 388. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. G. Sanchez-Lozada, E. Tapia, R. Lopez-Molina, T. Nepomuceno, V. Soto, C. Avila-Casado, T. Nakagawa, R. J. Johnson, J. Herrera-Acosta, and M. Franco Effects of acute and chronic L-arginine treatment in experimental hyperuricemia Am J Physiol Renal Physiol, April 1, 2007; 292(4): F1238 - F1244. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. M. Paravicini and R. M. Touyz Redox signaling in hypertension Cardiovasc Res, July 15, 2006; 71(2): 247 - 258. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-H. Chen, T.-H. Cheng, H. Lin, N.-L. Shih, Y.-L. Chen, Y.-S. Chen, C.-F. Cheng, W.-S. Lian, T.-C. Meng, W.-T. Chiu, et al. Reactive Oxygen Species Generation Is Involved in Epidermal Growth Factor Receptor Transactivation through the Transient Oxidization of Src Homology 2-Containing Tyrosine Phosphatase in Endothelin-1 Signaling Pathway in Rat Cardiac Fibroblasts Mol. Pharmacol., April 1, 2006; 69(4): 1347 - 1355. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Pacher, A. Nivorozhkin, and C. Szabo Therapeutic effects of xanthine oxidase inhibitors: renaissance half a century after the discovery of allopurinol. Pharmacol. Rev., March 1, 2006; 58(1): 87 - 114. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H-H Chao, J-J Chen, C-H Chen, H Lin, C-F Cheng, W-S Lian, Y-L Chen, S-H Juan, J-C Liu, J-Y Liou, et al. Inhibition of angiotensin II induced endothelin-1 gene expression by 17-{beta}-oestradiol in rat cardiac fibroblasts Heart, May 1, 2005; 91(5): 664 - 669. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. L. Schiffrin and R. M. Touyz Calcium, Magnesium, and Oxidative Stress in Hyperaldosteronism Circulation, February 22, 2005; 111(7): 830 - 831. [Full Text] [PDF]
|
|
|
|
 |
|
 M. Wellner, R. Dechend, J.-K. Park, E. Shagdarsuren, N. Al-Saadi, T. Kirsch, P. Gratze, W. Schneider, S. Meiners, A. Fiebeler, et al. Cardiac gene expression profile in rats with terminal heart failure and cachexia Physiol Genomics, February 10, 2005; 20(3): 256 - 267. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Wassmann, K. Wassmann, and G. Nickenig Modulation of Oxidant and Antioxidant Enzyme Expression and Function in Vascular Cells Hypertension, October 1, 2004; 44(4): 381 - 386. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Chabrashvili, C. Kitiyakara, J. Blau, A. Karber, S. Aslam, W. J. Welch, and C. S. Wilcox Effects of ANG II type 1 and 2 receptors on oxidative stress, renal NADPH oxidase, and SOD expression Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2003; 285(1): R117 - R124. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Spiekermann, U. Landmesser, S. Dikalov, M. Bredt, G. Gamez, H. Tatge, N. Reepschlager, B. Hornig, H. Drexler, and D. G. Harrison Electron Spin Resonance Characterization of Vascular Xanthine and NAD(P)H Oxidase Activity in Patients With Coronary Artery Disease: Relation to Endothelium-Dependent Vasodilation Circulation, March 18, 2003; 107(10): 1383 - 1389. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Landmesser, S. Spiekermann, S. Dikalov, H. Tatge, R. Wilke, C. Kohler, D. G. Harrison, B. Hornig, and H. Drexler Vascular Oxidative Stress and Endothelial Dysfunction in Patients With Chronic Heart Failure: Role of Xanthine-Oxidase and Extracellular Superoxide Dismutase Circulation, December 10, 2002; 106(24): 3073 - 3078. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. N. Muller, A. Mullally, R. Dechend, J.-K. Park, A. Fiebeler, B. Pilz, B.-M. Loffler, D. Blum-Kaelin, S. Masur, H. Dehmlow, et al. Endothelin-Converting Enzyme Inhibition Ameliorates Angiotensin II-Induced Cardiac Damage Hypertension, December 1, 2002; 40(6): 840 - 846. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. N. Muller, E. Shagdarsuren, J.-K. Park, R. Dechend, E. Mervaala, F. Hampich, A. Fiebeler, X. Ju, P. Finckenberg, J. Theuer, et al. Immunosuppressive Treatment Protects Against Angiotensin II-Induced Renal Damage Am. J. Pathol., November 1, 2002; 161(5): 1679 - 1693. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Rathaus and J. Bernheim Oxygen species in the microvascular environment: regulation of vascular tone and the development of hypertension Nephrol. Dial. Transplant., February 1, 2002; 17(2): 216 - 221. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Bagi, Z. Ungvari, and A. Koller Xanthine Oxidase-Derived Reactive Oxygen Species Convert Flow-Induced Arteriolar Dilation to Constriction in Hyperhomocysteinemia: Possible Role of Peroxynitrite Arterioscler Thromb Vasc Biol, January 1, 2002; 22(1): 28 - 33. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||