Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 2001;37:449-455

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by White, S. J.
Right arrow Articles by Baker, A. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by White, S. J.
Right arrow Articles by Baker, A. H.
Related Collections
Right arrow Other hypertension
Right arrow Peripheral vascular disease
Right arrow Other Treatment

(Hypertension. 2001;37:449.)
© 2001 American Heart Association, Inc.


Scientific Contributions

Identification of Peptides That Target the Endothelial Cell–Specific LOX-1 Receptor

Steve J. White; Stuart A. Nicklin; Tatsuya Sawamura; Andrew H. Baker

From Bristol Heart Institute (S.J.W.), Bristol Royal Infirmary, University of Bristol (UK); the Department of Medicine and Therapeutics (S.A.N., A.H.B.), University of Glasgow (UK); and the Department of Bioscience (T.S.), National Cardiovascular Center Research Institute, Osaka, Japan.

Correspondence to Dr A.H. Baker, Department of Medicine and Therapeutics, University of Glasgow, Glasgow, G11 6NT, UK. E-mail A.H.Baker{at}clinmed.gla.ac.uk


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowAckowledgement
down arrowReferences
 
Current gene delivery vectors demonstrate inefficient and nonselective gene transfer to vascular endothelial cells, limiting their use in cardiovascular gene transfer and therapy. The lectinlike oxidized LDL receptor (LOX-1) is expressed selectively at low levels on endothelial cells but is strongly upregulated in dysfunctional endothelial cells associated with hypertension and atherogenesis. Using LOX-1 as a target receptor, we have sought to isolate peptide ligands that mediate binding to the extracellular domain of LOX-1 as a definitive step in the development of targeted gene transfer aimed at dysfunctional endothelium. To achieve this, we ectopically overexpressed LOX-1 in cells lacking endogenous LOX-1 by using an episomally maintained expression system and designed a novel subtractive phage display strategy to identify peptides selective for LOX-1. After extensive biopanning, we sequenced individual phage and identified 60 novel peptides. This population of peptides contained a number of potential consensus motifs. To define the selectivity of individual peptides for LOX-1 with the use of an independent gene transfer system, we developed a novel adenoviral vector to overexpress LOX-1 transiently in primary cells and cell lines. We then quantified recovery of each peptide from LOX-1–positive and LOX-1–negative cells after adenovirus-mediated gene transfer. This strategy confirmed selectivity to LOX-1 for many peptides and highlighted the peptides LSIPPKA, FQTPPQL, and LTPATAI as principal candidates. These peptides will be useful for the selective targeting of viral and nonviral gene transfer vectors to endothelial cells expressing the LOX-1 receptor in vitro and in vivo and in particular dysfunctional endothelial cells associated with hypertension and atherosclerosis.


Key Words: peptides • hypertension • endothelium • amino acids • gene therapy


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowAckowledgement
down arrowReferences
 
Recent advances in gene transfer have allowed numerous preclinical studies to identify the unique potential for gene therapy in the treatment of diverse cardiovascular diseases.1 2 3 Although proof of concept studies have largely been successful, the use of currently available vectors within clinical situations is limited because of relative inefficiencies in gene transfer to the vasculature. There is therefore urgent need to develop vectors that are safe, selective, and efficient for individual cell types, particularly for cardiovascular disorders such as hypertension and atherosclerosis, in which systemic gene delivery is fundamentally a prerequisite.

Uptake of both viral and nonviral vectors by vascular endothelial cells is poor in vitro, ex vivo, and in vivo compared with the transduction achieved in other, more permissive cell types such as hepatocytes.4 5 This finding limits the use of gene transfer to study diseases associated with the vascular endothelium due to uptake of vector by nontarget tissues, particularly after intravenous injections. In addition, though local delivery to blood vessels leads to efficient transduction of the vascular endothelium, extremely high doses of vector are required, which induce acute toxicity.6 7 In pursuit of more selective and efficient vascular-specific vectors, we have recently demonstrated that small peptide ligands isolated from phage display libraries can retarget adenoviral vectors to quiescent endothelial cells in vitro.8 The ability to target dysfunctional endothelial cells therefore may be achieved with similar technology by identification of ligands that target receptors selectively expressed or upregulated on dysfunctional cells. In this study, we describe the isolation of novel peptides that target LOX-1, a receptor normally expressed at low levels exclusively on venous and arterial vascular endothelial cells9 but strongly upregulated in dysfunctional endothelium associated with hypertension and atherogenesis.10 11 12


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowAckowledgement
down arrowReferences
 
Materials
All chemicals unless otherwise stated were obtained from Sigma Chemical Co. Cell culture reagents were obtained from Gibco BRL unless otherwise stated. The hepG2 cell line was obtained from the European Collection of Animal Cell Cultures. The PhD Phage Display Peptide Library Kit was purchased from New England Biolabs. The phage display library contains random linear peptides constrained at their C-terminus on the PIII coat protein. The library contains a complexity of 2x109 individual clones, representing the entire obtainable repertoire of 7-mer peptide sequences. Mouse monoclonal anti-human LOX-1 antibody clones JTX68 and 5-2 were used for LOX-1 detection.13

Reverse Transcriptase–Polymerase Chain Reaction
Reverse transcriptase–polymerase chain reaction (RT-PCR) was performed by incubation of 1 µg total RNA with random hexamer and Moloney murine leukemia virus RT. cDNA was amplified with LOX-1–specific primers (sense 5' GATGACCTAAAGATTCCAGACTGTG 3'; antisense 5' CCATCCAGAAATGGAAAACTGGAAT 3').

Construction of LZRS–LOX-1 and AdLOX-1 Vectors
The LZRS vector14 contains a copy of the Moloney murine leukemia virus long-terminal repeat (LTR) linked to the ß-galactosidase reporter gene, EBNA-1/oriP maintenance factor/origin of replication, as well as the puromycin resistance gene (a generous gift from G. Nolan). The plasmid LZRS–LOX-1 was constructed by excision of lacZ and insertion of the LOX-1 coding region between the BamHI site and NotI site. PCR was performed with forward primer (created BamHI site, underlined): 5'-GGTCCGGATCCTCAACT-TCAGG and reverse primer (created Not I site, underlined): 5'-TCAATGCGGCCGCTTCTGACGGGGCTGG. Sequence fidelity was confirmed. For RAdLOX-1, an EcoRI fragment representing the complete coding sequence of human LOX-1 was subcloned from pME18s9 into the adenovirus shuttle vector pCA3 downstream of the cytomegalovirus immediate early promoter (CMV IEP). After homologous recombination in 293 cells with pJM17,15 the resulting recombinant adenovirus was plaque-purified and grown to high titer, as previously described.16 The adenoviruses RAdß-gal and RAd66 were used as controls and express the ß-galactosidase gene or no transgene from the CMV IEP, respectively.17 18

Cell Culture and Transfection
The hepG2 cell line was maintained in MEM supplemented with 100 IU/mL penicillin, 100 µg/mL streptomycin, 2 mmol/L L-glutamine, and 10% (vol/vol) FCS, with puromycin selection (1 µg/mL) where necessary. HepG2 cells were transfected by calcium phosphate–mediated gene transfer. Briefly, 5 µg of DNA was transfected into subconfluent hepG2 cells and then placed into puromycin selection 48 hours later. Cells were maintained in puromycin throughout the course of the experiments. Human saphenous vein smooth muscle cells (SMC) were isolated from patients undergoing bypass surgery as described.19 Cells were used below passage 5 and were demonstrated to be {alpha}-smooth muscle actin–positive at passage 1 by immunofluorescence.

Immunofluorescence
Cells were infected with 300 pfu/cell of RAdLOX-1 or RAd66 or mock-infected for 18 hours. Cells were washed and left for a further 48 hours in complete media, then washed and fixed in 4% paraformaldehyde. Cells were permeabilized with 0.1% Triton X-100 and incubated in JTX68 mouse anti–LOX-1 monoclonal antibody or control mouse IgG antisera. Cells were stained with an anti-mouse FITC-conjugated antibody (1:200 dilution, Dako), mounted in Vectashield (Vector Labs), and visualized by fluorescence microscopy.

Western Blot Analysis
Transduced and control cells were incubated for 48 hours to allow accumulation of the LOX-1 receptor on the cell surface. Cells were then washed in PBS and directly lysed into 1x Laemmli buffer.20 Extracts were electrophoresed on 10% resolving gels and blotted onto Hybond PVDF membranes (Amersham Pharmacia Biotech). Membranes were blocked in 10% FCS for 2 hours and incubated in mouse anti–LOX-1 antibody (1 µg/mL) overnight at 4°C. LOX-1 was visualized with anti-mouse horse radish peroxidase and echochemiluminescence plus (Amersham).

Phage Display
Phage libraries were amplified, purified, and titered according to manufacturer’s protocols. HepG2 cells, either untransfected or transfected with LZRS–LOX-1 or LZRS–ß-gal and selected with puromycin (1 µg/mL), were plated into 6-well plates and cultured until >85% confluent before panning. Before the first round of biopanning was performed, 10 µL (2x1011 pfu) of the library was precleared by incubating the phage in 1 mL of biopanning media (DMEM containing 1% BSA) for 1 hour at 4°C, on 4 successive cultures of control LZRS–ß-gal transfected hepG2 cells (total of 4 hours). Precleared phage were then immediately recovered and biopanned in duplicate on cultures of LRZS–LOX-1–transfected cells (in 1 mL biopanning media at 4°C for 1 hour). Cells were washed 5 times in PBS containing calcium and magnesium and 1% BSA for 5 minutes per wash. Weakly associated phage were eluted in 1 mL 0.2 mol/L glycine (pH 2.2) for 10 minutes on ice, followed by neutralization with 200 µL Tris-HCl (pH 8.0). High-affinity phage (tightly bound phage) were subsequently isolated by lysing the cells in 1 mL of 30 mmol/L Tris/1 mmol/L EDTA (pH 8.0) for 1 hour on ice. Cell debris was removed by centrifugation, and the phage containing supernatant were recovered. Phage obtained at each step were amplified and titered between each round to ensure that 109 pfu of input phage were used at the start of each round of panning. Subsequent rounds of biopanning were performed by incubating 1x109 pfu of phage for 1 hour at 4°C. A clearing step on LZRS–ß-gal–transfected hepG2 cells was performed before incubation and recovery from LZRS–LOX-1–transfected cells to ensure that phage that bound to nontarget receptors on hepG2 cells were not amplified. After 5 rounds of biopanning, Escherichia coli ER2537 were infected with the resulting phage and plated onto LB agar in top agarose. Individual plaques were picked and amplified; single-stranded phage DNA were isolated with the Promega Wizard M13 DNA system (Promega) and sequenced with an ABI 377 DNA sequencer.

Peptide Sequence Analysis
For homology searches and identification of common small peptide motifs, we used the http://www.phil.ibcp.fr website.

Quantification of Recovery From LOX-1–Expressing Cells
Further binding studies were performed by incubating 1x107 pfu of each phage in triplicate with cultures of cells infected with RAdLOX-1 or RAdß-gal, with identical conditions to those described above. Unbound phage were removed by stringent washing, and the resulting cell-associated phage were titered and the percentage recovery quantified for each cell type.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowAckowledgement
down arrowReferences
 
Expression of LOX-1 in Vascular Tissue and Nonvascular Cell Lines
Previous studies have demonstrated the endothelial cell specificity of LOX-1.9 21 To identify LOX-1–negative cells for our biopanning strategy, RT-PCR was performed on mRNA isolated from hepatocytes, placental cells, Hela cells, primary human vascular SMC, and peripheral blood mononuclear cells. LOX-1 mRNA was not detected in human saphenous vein SMC, hepG2 hepatocytes, peripheral blood, or mononuclear or placental cells (not shown). LOX-1 was, however, detected in Hela cells (not shown). We used the hepG2 cell line for our subtractive phage display strategy and for further confirmation of selectivity of identified peptides.

LOX-1 Overexpression in hepG2 Cells and Subtractive Phage Display
We used the Lazarus episomal gene transfer system to overexpress LOX-1 for subtractive phage display because the system couples high-level transgene expression with puromycin selection to ensure that all cells express the respective transgene (Figure 1A). Overexpression of recombinant LOX-1 with this system was demonstrated by RT-PCR of RNA isolated from LZRS–LOX-1–transduced but not LZRS–ß-gal–transduced and hepG2 cells (Figure 1B). LOX-1 protein overexpression was demonstrated by immunofluoresence (Figure 1C).



View larger version (43K):
[in this window]
[in a new window]
 
Figure 1. Evaluation of endogenous and ectopic LOX-1 with LZRS–LOX-1. A, LZRS expression plasmid. Gene expression (either lacZ or LOX-1 cDNA) is driven by Moloney murine leukemia virus 5' LTR. Puromycin gene is expressed by phosphoglycerol kinase-1 (PGK-1) promoter with SV40 polyadenylation (SV40 pA) sequence, which together with Epstein-Barr virus EBNA-1 gene and cis-acting element oriP allow selection and episomal maintenance of plasmid in human cell lines. Ampicillin resistance gene (amp) and pUC origin facilitate bacterial propagation of plasmid. B, RT-PCR analysis for LOX-1 expression from total RNA isolated from LZRS–LOX-1–transfected and LZRS–ß-gal–transfected cells. C, Immunofluorescent staining for LOX-1 in LZRS–LOX-1–transfected and LZRS–ß-gal–transfected and puromycin-selected cells. LOX-1 stained green (FITC).

Rather than immobilizing LOX-1 on plastic, our strategy for isolation of targeting peptides was designed to allow peptides to interact/bind with the extracellular domain of LOX-1 at the cell surface in a native conformation (Figure 2). We therefore exposed the initial input phage library to LZRS–ß-gal–transduced hepG2 cells, recovered unbound phage from the medium, and immediately exposed them to LZRS–LOX-1–transduced hepG2 cells for 1 hour. After stringent washing, the phage that bound tightly were harvested and amplified back to the original input titer of the library and used for subsequent rounds of biopanning. After 5 rounds of biopanning, we isolated and sequenced 60 individual homogenous phage (Table). No homology at either the nucleotide or the amino acid level with published sequences was identified; however, a number of consensus motifs were identified within the populations of peptides. By scoring the most commonly observed amino acid at each position, the primary consensus sequence MTTPPLT is observed. However, this individual peptide was not isolated in our screen, although in theory, it is represented within the phage display library. Motif analysis revealed marked homology between many peptides (Table). For example, peptides 29 and 46 (FTTPPGV and LTTPPKV), peptides 36, 50, and 28 (LTRPPYH, LTRPPYT, and LTRPLTV), and peptides 18 and 55 (MTAPPIQ and MTARPIK). In addition, other peptide motifs were identified and include LTPAXA (in peptides 40 and 51), LSXPP (in peptides 32 and 42), and MQP (peptides 21 and 22), where X represents positions occupied by divergent amino acids. Furthermore, detailed analysis of peptides 17 (FQTPPQL), 30 (FQPFPRL), 32 (LSIPPKA), 40 (LTPATAI), and 51 (LTPARAT), which display high LOX-1 binding (see below), sequentially contain peptides from identical amino acid groups (N-hydrophobic, polar, hydrophobic, small, small, polar, hydrophobic).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 2. Biopanning strategy. A, 2x1011 input phage were incubated with hepG2 cells transduced (and preselected) with control vector LZRS–ß-gal for 1 hour. B, Nonbound phage were removed and immediately incubated for 1 hour with hepG2 cells transduced (and preselected) with LZRS–LOX-1. C, After stringent washing, tightly bound phage were eluted. D, After amplification of "restricted phage pool" back to original titer of input phage, biopanning protocol was repeated a further 4 times, phage-plated, and sequenced (E).


View this table:
[in this window]
[in a new window]
 
Table 1. Peptide Sequences Isolated After Biopanning

Homogenous Phage Recovery
As we identified many candidate peptides, we performed secondary screens to identify the best binding peptides. To perform this, we developed and used an independent expression system (recombinant adenovirus). After development and purification of the novel LOX-1 recombinant adenovirus (RAdLOX-1), we initially confirmed its ability to overexpress LOX-1. Vascular SMC infected with RAdLOX-1 demonstrated high-level immunofluorescent staining for LOX-1 with no staining in mock-infected or control RAd66-infected cells (Figure 3, A through C). To ensure that the recombinant LOX-1 was the correct molecular weight, Western blot analysis was performed on SMC (Figure 3D). As expected, high-level overexpression of LOX-1 was detected in cell extracts isolated from RAdLOX-1 but not control infected cells (Figure 3D). We next biopanned homogenous phage on RAdLOX-1–infected and control RAdß-gal–infected cells to quantify phage selectivity. Vastly different recoveries were observed (Figure 4). Although some phage clearly demonstrated limited recovery and therefore low affinity for LOX-1–transduced cells, a number of phage repeatedly demonstrated higher recovery from LOX-1–expressing cells compared with LOX-1–negative cells. In particular, phage expressing the peptides 17 (FQTPPQL), 32 (LSIPPKA), and 40 (LTPATAI) demonstrated consistently high recoveries from LOX-1 but not control transduced cells. However, many other peptides also demonstrated consistently high recoveries from LOX-1–expressing cells (Figure 4). This profile was reproduced in 2 further independent experiments.



View larger version (76K):
[in this window]
[in a new window]
 
Figure 3. Characterization of RAdLOX-1. A through C, Immunofluorescent detection of LOX-1 on RAdCMV-infected (A) and RAdLOX-1–infected vascular SMC (B and C) with anti–LOX-1 antibody (A, B) or nonimmune control antisera (C). Arrows in B indicate examples of LOX-1–expressing cells. Nuclei were counterstained with propidium iodide (red). D, Western blot analysis for LOX-1 expression 66 hours after infection with respective adenoviruses. Arrow indicates 52-kDa LOX-1 protein.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 4. Recovery studies for homogenous phage on LOX-1–expressing cells; 107 pfu of homogenous phage were biopanned on cells transduced with ß-gal or LOX-1 for 1 hour. After stringent washing, phage were recovered, plated, quantified, and expressed as fold-recovery for LOX-1–expressing cells against control.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowAckowledgement
down arrowReferences
 
If gene therapy is to be used in clinical cardiovascular medicine, the development of selective and efficient gene transfer vectors is an absolute requirement. At present, both viral and nonviral gene delivery vehicles produce highly inefficient and nonselective transduction of both vascular SMCs and vascular endothelial cells. For viral vectors, this is primarily due to the lack of their specific receptors on vascular cells. As a definitive step, in this study we have isolated a panel of small peptide ligands that have the ability to bind to the extracellular domain of the LOX-1 receptor, a protein implicated strongly in endothelial dysfunction. We demonstrate that the phage display technology used resulted in the isolation of a substantial panel of novel peptides, with a number of novel consensus peptide motifs identified. Furthermore, we were able to demonstrate that many of the peptides were selective to LOX-1–positive cells by using an independent expression system.

Sixty individual clones were isolated and 60 different peptides identified. Although no single peptide was sequenced from multiple clones, we and others have previously shown that individual peptides isolated in this manner are efficient in binding to their designated receptor target in postphage display analysis.8 22 The primary consensus sequence in this population was MTTPPLT; however, no two peptide sequences were 100% identical. Small peptide motifs such as LTPAXA, LSXPP, TPP, TXPP, MQP, or MTP appeared in this population of peptides. Although the overall significance of these motifs is currently unknown, we believe that the isolation of a number of peptides possessing identical motifs may be important in the binding of individual phage to LOX-1. As a classic example of this, tripeptide motifs have previously been shown to be extremely important in protein interactions and signaling in eukaryotes such as RGD and RGE sequences necessary for activation of different members of the integrin family.23

Because peptides in this study were demonstrated to bind tightly to LOX-1–expressing hepG2 cells in comparison to control hepG2 cells, the presence of a strong universal peptide consensus may not be entirely important. Indeed, previous studies with phage display have identified populations of peptides from phage display protocols that are only identical across tripeptide motifs.24 25 26 One of these motifs, GFE, was shown to home specifically and at high levels to lung endothelium in vivo,25 whereas peptides expressing the motif RDV were shown to preferentially home to retina in vivo.25 Although this GFE motif was not found to have homology to any published protein sequence, it was subsequently identified as binding to lung dipeptidase,27 for which retargeted adenoviral vectors have now been constructed,28 demonstrating the power of phage display to identify functionally important peptide sequences for targeting gene transfer vectors. Further indication of potential functional significance of the LOX-1–binding peptides was discovered when 5 of the highest binding peptides (peptides 17, 30, 32, 40, and 51) all contained the same sequential pattern of amino acids groups. The overall hydrophobic nature of these peptides and the strict order in which they appear suggests that the peptides may all bind to the same site of LOX-1, possibly a pocket or groove. It has been suggested from other studies29 that peptides isolated by phage display often bind sites of protein-protein interaction, raising the possibility that the LOX-1–binding peptides may target a functionally important binding site, allowing the use of candidate peptides as inhibitors (or activators) of the receptor.

Clearly, the next stage in the development of this technology is to incorporate candidate peptides into tropism-modified viral vectors and nonviral systems. Such approaches have been shown to result in retargeting of gene delivery with peptides with known target receptors on the cell surface, such as integrins or E-selectin30 31 32 and peptides for which the receptor is unknown.8 33 By using the LOX-1 receptor, we aim to achieve for the first time targeted gene transfer aimed specifically at dysfunctional endothelium, a development with both experimental and clinical implications for future gene transfer studies in cardiovascular disease.


*    Ackowledgement
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*Ackowledgement
down arrowReferences
 
This work was supported by the British Heart Foundation (PG97/018 and PG99/097).

Received October 25, 2000; first decision November 30, 2000; accepted December 11, 2000.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
up arrowAckowledgement
*References
 
1. Baker AH, Mehta D, George SJ, Angelini GD. Prevention of vein graft failure: potential applications for gene therapy. Cardiovasc Res. 1997;35:442–450.[Abstract/Free Full Text]

2. Libby P. Gene therapy of restenosis. Circ Res. 1998;82:404–406.[Free Full Text]

3. Phillips MI. Is gene therapy for hypertension possible? Hypertension. 1999;33:8–13.[Free Full Text]

4. Jaffe HA, Danel C, Longenecker G, Metzger M, Setoguchi Y, Rosenfeld MA, Gant TW, Thorgeirsson SS, Stratford-Perricaudet LD, Perricaudet M, Adenovirus-mediated in vivo gene transfer and expression in normal rat liver. Nat Genet. 1992;1:372–378.[Medline] [Order article via Infotrieve]

5. Merrick AF, Shewring LD, Sawyer GJ, Gustafsson KT, Fabre JW. Comparison of adenovirus gene transfer to vascular endothelial cells in cell culture, organ culture, and in vivo. Transplantation. 1996;62:1085–1089.[Medline] [Order article via Infotrieve]

6. Lemarchand P, Jones M, Yamada I, Crystal RG. In vivo gene transfer and expression in normal uninjured blood vessels using replication-deficient recombinant adenovirus vectors. Circ Res. 1993;72:1132–1138.[Abstract/Free Full Text]

7. Channon KM, Qian H, Youngblood SA, Olmez E, Shetty GA, Neplioueva V, Blazing MA, George SE. Acute host-mediated endothelial injury after adenoviral gene transfer in normal rabbit arteries. Circ Res. 1998;82:1253–1262.[Abstract/Free Full Text]

8. Nicklin SA, White SJ, Watkins SJ, Hawkins RE, Baker AH. Selective targeting of gene transfer to vascular endothelial cells by use of peptides isolated by phage display. Circulation. 2000;102:231–237.[Abstract/Free Full Text]

9. Sawamura T, Kume N, Aoyama T, Moriwaki H, Hoshikawa H, Aiba Y, Tanaka T, Miwa S, Katsura Y, Kita T, Masaki T. An endothelial receptor for oxidized low-density lipoprotein. Nature. 1997;386:73–77.[Medline] [Order article via Infotrieve]

10. Kataoka H, Kume N, Mijamoto S, Minami M, Moriwaki H, Murase T, Sawamura T, Hashimoto N, Kita T. Expression of lectin-like oxidized low-density lipoprotein receptor-1 in human atherosclerotic lesions. Circulation. 1999;99:3110–3117.[Abstract/Free Full Text]

11. Chen M, Kakatuani M, Minami M, Kataoka H, Kume N, Narumija S, Kita T, Masaki T, Sawamura T. Increased expression of lectinlike oxidized LDL receptor-1 in initial atherosclerotic lesions of Watanabe heritable hyperlipidemic rabbits. Arterioscler Thromb Vasc Biol. 2000;20:1107–1115.[Abstract/Free Full Text]

12. Nagase M, Hirose S, Sawamura T, Musaki T, Fujita T. Enhanced expression of endothelial oxidized low-density lipoprotein receptor (LOX-1) in hypertensive rats. Biochem Biophys Res Commun. 1997;237:496–498.[Medline] [Order article via Infotrieve]

13. Aoyama T, Fujiwara H, Masaki T, Sawamura T. Induction of the lectin-like oxidized low-density lipoprotein receptor LOX-1 by lysophosphatidylcholine in cultured endothelial cells. J Mol Cell Cardiol. 1998;31:2101–2112.

14. Kinsella TD, Nolan GP. Episomal vectors rapidly and stably produce high-titer recombinant retrovirus. Hum Gene Ther. 1996;7:1405–1413.[Medline] [Order article via Infotrieve]

15. McGrory WJ, Bautista DS, Graham FL. A simple technique for the rescue of early region I mutations into infectious human adenovirus type 5. Virology. 1988;163:614–617.[Medline] [Order article via Infotrieve]

16. Nicklin SA, Baker AH. Simple methods for preparing recombinant adenoviruses for high efficiency transduction of vascular cells. In: Baker AH, ed. Vascular Disease: Molecular Biology and Gene Transfer Protocols (Methods in Molecular Medicine). New York, NY: Humana Press; 1999.

17. Wilkinson GWG, Akrigg A. Constitutive and enhanced expression from the CMV major IE promoter in a defective adenovirus vector. Nucleic Acids Res. 1992;20:2233–2239.[Abstract/Free Full Text]

18. Baker AH, Zaltsman AB, George SJ, Newby AC. Divergent effects of tissue inhibitor of metalloproteinase-1,-2 or -3 overexpression on rat vascular smooth muscle cell invasion, proliferation and death in vitro. J Clin Invest. 1998;101:1478–1487.[Medline] [Order article via Infotrieve]

19. Southgate K, Newby AC. Serum-induced proliferation of rabbit aortic smooth muscle cells from the contractile state is inhibited by 8-Br-cAMP but not 8-Br-cGMP. Atherosclerosis. 1990;82:113–112.[Medline] [Order article via Infotrieve]

20. Laemmli UK. Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature. 1970;227:680–685.[Medline] [Order article via Infotrieve]

21. Minami M, Kume N, Kataoka H, Morimoto M, Hayashida K, Sawamura T, Masaki T, Kita T. Transforming growth factor-ß1 increases the expression of lectin-like oxidised low-density lipoprotein receptor-1. Biochem Biophys Res Commun. 2000;272:357–361.[Medline] [Order article via Infotrieve]

22. Xia H, Anderson B, Mao Q, Davidson BL. Recombinant human adenovirus: targeting to the human transferrin receptor improves gene transfer to brain microcapillary endothelium. J Virol. 2000;74:11359–11366.[Abstract/Free Full Text]

23. Gladson CL, Cheresh DA. The {alpha}v integrins. In: Takada Y, ed. Integrins: The Biological Problems. Boca Raton, Fla: CRC Press; 1994:83–99.

24. Arap W, Pasqualini R, Ruoslahti E. Cancer treatment by targeted drug delivery to tumor vasculature in a mouse model. Science. 1998;279:377–380.[Abstract/Free Full Text]

25. Rajotte D, Arap W, Hagedorn M, Koivunen E, Pasqualini R, Ruoslahti E. Molecular heterogeneity of the vascular endothelium revealed by in vivo phage display. J Clin Invest. 1998;102:430–437.[Medline] [Order article via Infotrieve]

26. Pasqualini R, Ruoslahti E. Organ targeting in vivo using phage display peptide libraries. Nature. 1996;380:364–366.[Medline] [Order article via Infotrieve]

27. Rajotte D, Ruoslahti E. Membrane dipeptidase is the receptor for a lung-targeting peptide identified by in vivo phage display. J Biol Chem. 1999;274:11593–11598.[Abstract/Free Full Text]

28. Trepel M, Grifman M, Weitzman M, Pasqualini R. Molecular adaptors for vascular-targeted adenoviral gene delivery. Hum Gene Ther. 2000;11:1971–1981.[Medline] [Order article via Infotrieve]

29. Fairbrother WJ, Christinger HW, Cochran AG, Fuh G, Keenan CJ, Quan C, Shriver SK, Tom JY, Wells JA, Cunningham BC. Novel peptides selected to bind to vascular endothelial growth factor receptor-binding site. Biochemistry. 1998 37;17754–17764.

30. Wickham TJ, Carrion ME, Kovesdi I. Targeting of adenovirus penton base to new receptors through replacement of its RGD motif with other receptor-specific peptide motifs. Gene Ther. 1995;2:750–756.[Medline] [Order article via Infotrieve]

31. Hart SL, Collins L, Gustafsson K, Fabre JW. Integrin-mediated transfection with peptides containing arginine-glycine-aspartic acid domains. Gene Ther. 1997;4:1225–1230.[Medline] [Order article via Infotrieve]

32. Harari OA, Wickham TJ, Stocker CJ, Kovesdi I, Segal DM, Huehns TY, Sarraf C, Haskard DO. Targeting an adenoviral gene vector to cytokine-activated vascular endothelium via E-selectin. Gene Ther. 1999;6:801–807.[Medline] [Order article via Infotrieve]

33. Romanczuk H, Galer CE, Zabner J, Barsomian G, Wadsworth SC, O’Riordan CR. Modification of an adenoviral vector with biologically selected peptides: a novel strategy for gene delivery to cells of choice. Hum Gene Ther. 1999;10:2615–2626.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
J Biomol ScreenHome page
R. E. Herman, E. G. Makienko, M. G. Prieve, M. Fuller, M. E. Houston Jr, and P. H. Johnson
Phage Display Screening of Epithelial Cell Monolayers Treated with EGTA: Identification of Peptide FDFWITP that Modulates Tight Junction Activity
J Biomol Screen, December 1, 2007; 12(8): 1092 - 1101.
[Abstract] [PDF]


Home page
Infect. Immun.Home page
U. Gasanov, C. Koina, K. W. Beagley, R. J. Aitken, and P. M. Hansbro
Identification of the Insulin-Like Growth Factor II Receptor as a Novel Receptor for Binding and Invasion by Listeria monocytogenes
Infect. Immun., January 1, 2006; 74(1): 566 - 577.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
Z. Li, R. Zhao, X. Wu, Y. Sun, M. Yao, J. Li, Y. Xu, and J. Gu
Identification and characterization of a novel peptide ligand of epidermal growth factor receptor for targeted delivery of therapeutics
FASEB J, December 1, 2005; 19(14): 1978 - 1985.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
D. Ghosh and M. A. Barry
Selection of Muscle-Binding Peptides from Context-Specific Peptide-Presenting Phage Libraries for Adenoviral Vector Targeting
J. Virol., November 1, 2005; 79(21): 13667 - 13672.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
L. G. Melo, M. Gnecchi, A. S. Pachori, D. Kong, K. Wang, X. Liu, R. E. Pratt, and V. J. Dzau
Endothelium-Targeted Gene and Cell-Based Therapies for Cardiovascular Disease
Arterioscler. Thromb. Vasc. Biol., October 1, 2004; 24(10): 1761 - 1774.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by White, S. J.
Right arrow Articles by Baker, A. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by White, S. J.
Right arrow Articles by Baker, A. H.
Related Collections
Right arrow Other hypertension
Right arrow Peripheral vascular disease
Right arrow Other Treatment