(Hypertension. 2001;37:449.)
© 2001 American Heart Association, Inc.
Scientific Contributions |
From Bristol Heart Institute (S.J.W.), Bristol Royal Infirmary, University of Bristol (UK); the Department of Medicine and Therapeutics (S.A.N., A.H.B.), University of Glasgow (UK); and the Department of Bioscience (T.S.), National Cardiovascular Center Research Institute, Osaka, Japan.
Correspondence to Dr A.H. Baker, Department of Medicine and Therapeutics, University of Glasgow, Glasgow, G11 6NT, UK. E-mail A.H.Baker{at}clinmed.gla.ac.uk
| Abstract |
|---|
|
|
|---|
Key Words: peptides hypertension endothelium amino acids gene therapy
| Introduction |
|---|
|
|
|---|
Uptake of both viral and nonviral vectors by vascular endothelial cells is poor in vitro, ex vivo, and in vivo compared with the transduction achieved in other, more permissive cell types such as hepatocytes.4 5 This finding limits the use of gene transfer to study diseases associated with the vascular endothelium due to uptake of vector by nontarget tissues, particularly after intravenous injections. In addition, though local delivery to blood vessels leads to efficient transduction of the vascular endothelium, extremely high doses of vector are required, which induce acute toxicity.6 7 In pursuit of more selective and efficient vascular-specific vectors, we have recently demonstrated that small peptide ligands isolated from phage display libraries can retarget adenoviral vectors to quiescent endothelial cells in vitro.8 The ability to target dysfunctional endothelial cells therefore may be achieved with similar technology by identification of ligands that target receptors selectively expressed or upregulated on dysfunctional cells. In this study, we describe the isolation of novel peptides that target LOX-1, a receptor normally expressed at low levels exclusively on venous and arterial vascular endothelial cells9 but strongly upregulated in dysfunctional endothelium associated with hypertension and atherogenesis.10 11 12
| Methods |
|---|
|
|
|---|
Reverse TranscriptasePolymerase Chain
Reaction
Reverse transcriptasepolymerase chain reaction
(RT-PCR) was performed by incubation of 1 µg total RNA with random
hexamer and Moloney murine leukemia virus RT. cDNA was amplified with
LOX-1specific primers (sense 5' GATGACCTAAAGATTCCAGACTGTG 3';
antisense 5' CCATCCAGAAATGGAAAACTGGAAT 3').
Construction of LZRSLOX-1 and AdLOX-1
Vectors
The LZRS
vector14 contains a copy of
the Moloney murine leukemia virus long-terminal repeat (LTR) linked to
the ß-galactosidase reporter gene,
EBNA-1/oriP maintenance
factor/origin of replication, as well as the puromycin resistance gene
(a generous gift from G. Nolan). The plasmid LZRSLOX-1 was
constructed by excision of lacZ
and insertion of the LOX-1 coding region between the
BamHI site and
NotI site. PCR was performed
with forward primer (created
BamHI site, underlined):
5'-GGTCCGGATCCTCAACT-TCAGG
and reverse primer (created Not
I site, underlined):
5'-TCAATGCGGCCGCTTCTGACGGGGCTGG.
Sequence fidelity was confirmed. For RAdLOX-1, an
EcoRI fragment
representing the complete coding sequence of human LOX-1
was subcloned from pME18s9
into the adenovirus shuttle vector pCA3 downstream of the
cytomegalovirus immediate early promoter (CMV IEP). After homologous
recombination in 293 cells with
pJM17,15 the resulting
recombinant adenovirus was plaque-purified and grown to high titer, as
previously described.16 The
adenoviruses RAdß-gal and RAd66 were used as controls and express the
ß-galactosidase gene or no transgene from the CMV IEP,
respectively.17 18
Cell Culture and Transfection
The hepG2 cell line was maintained in MEM
supplemented with 100 IU/mL penicillin, 100 µg/mL streptomycin,
2 mmol/L L-glutamine,
and 10% (vol/vol) FCS, with puromycin selection (1 µg/mL) where
necessary. HepG2 cells were transfected by calcium phosphatemediated
gene transfer. Briefly, 5 µg of DNA was transfected into subconfluent
hepG2 cells and then placed into puromycin selection 48 hours later.
Cells were maintained in puromycin throughout the course of the
experiments. Human saphenous vein smooth muscle cells (SMC) were
isolated from patients undergoing bypass surgery as
described.19 Cells were used
below passage 5 and were demonstrated to be
-smooth muscle
actinpositive at passage 1 by
immunofluorescence.
Immunofluorescence
Cells were infected with 300 pfu/cell of RAdLOX-1 or
RAd66 or mock-infected for 18 hours. Cells were washed and left for a
further 48 hours in complete media, then washed and fixed in 4%
paraformaldehyde. Cells were
permeabilized with 0.1% Triton X-100 and incubated in
JTX68 mouse antiLOX-1 monoclonal antibody or control mouse IgG
antisera. Cells were stained with an anti-mouse FITC-conjugated
antibody (1:200 dilution, Dako), mounted in Vectashield (Vector Labs),
and visualized by fluorescence
microscopy.
Western Blot Analysis
Transduced and control cells were incubated for 48
hours to allow accumulation of the LOX-1 receptor on the cell surface.
Cells were then washed in PBS and directly lysed into 1x Laemmli
buffer.20 Extracts were
electrophoresed on 10% resolving gels and blotted onto Hybond PVDF
membranes (Amersham Pharmacia Biotech). Membranes were blocked in 10%
FCS for 2 hours and incubated in mouse antiLOX-1 antibody (1 µg/mL)
overnight at 4°C. LOX-1 was visualized with anti-mouse horse radish
peroxidase and echochemiluminescence plus
(Amersham).
Phage Display
Phage libraries were amplified, purified, and titered
according to manufacturers protocols. HepG2 cells, either
untransfected or transfected with LZRSLOX-1 or LZRSß-gal and
selected with puromycin (1 µg/mL), were plated into 6-well plates and
cultured until >85% confluent before panning. Before the first round
of biopanning was performed, 10 µL
(2x1011 pfu) of the library
was precleared by incubating the phage in 1 mL of biopanning media
(DMEM containing 1% BSA) for 1 hour at 4°C, on 4 successive cultures
of control LZRSß-gal transfected hepG2 cells (total of 4 hours).
Precleared phage were then immediately recovered and biopanned in
duplicate on cultures of LRZSLOX-1transfected cells (in 1 mL
biopanning media at 4°C for 1 hour). Cells were washed 5 times in PBS
containing calcium and magnesium and 1% BSA for 5 minutes per wash.
Weakly associated phage were eluted in 1 mL 0.2 mol/L glycine (pH 2.2)
for 10 minutes on ice, followed by neutralization with 200 µL
Tris-HCl (pH 8.0). High-affinity phage (tightly bound phage) were
subsequently isolated by lysing the cells in 1 mL of 30 mmol/L
Tris/1 mmol/L EDTA (pH 8.0) for 1 hour on ice. Cell debris was
removed by centrifugation, and the phage containing
supernatant were recovered. Phage obtained at each step were amplified
and titered between each round to ensure that
109 pfu of input phage were used at the
start of each round of panning. Subsequent rounds of biopanning were
performed by incubating 1x109 pfu of phage
for 1 hour at 4°C. A clearing step on LZRSß-galtransfected
hepG2 cells was performed before incubation and recovery from
LZRSLOX-1transfected cells to ensure that phage that bound to
nontarget receptors on hepG2 cells were not amplified. After 5 rounds
of biopanning, Escherichia coli
ER2537 were infected with the resulting phage and plated onto LB agar
in top agarose. Individual plaques were picked and amplified;
single-stranded phage DNA were isolated with the Promega Wizard M13 DNA
system (Promega) and sequenced with an ABI 377 DNA
sequencer.
Peptide Sequence Analysis
For homology searches and identification of common
small peptide motifs, we used the http://www.phil.ibcp.fr
website.
Quantification of Recovery From
LOX-1Expressing Cells
Further binding studies were performed by incubating
1x107 pfu of each phage in triplicate with
cultures of cells infected with RAdLOX-1 or RAdß-gal, with identical
conditions to those described above. Unbound phage were removed by
stringent washing, and the resulting cell-associated phage were titered
and the percentage recovery quantified for each cell
type.
| Results |
|---|
|
|
|---|
LOX-1 Overexpression in hepG2 Cells and
Subtractive Phage Display
We used the Lazarus episomal gene transfer system to
overexpress LOX-1 for subtractive phage display because the system
couples high-level transgene expression with puromycin selection to
ensure that all cells express the respective transgene
(Figure 1A). Overexpression of recombinant LOX-1 with this
system was demonstrated by RT-PCR of RNA isolated from
LZRSLOX-1transduced but not LZRSß-galtransduced and hepG2
cells
(Figure 1B). LOX-1 protein overexpression was demonstrated by
immunofluoresence
(Figure 1C).
|
Rather than immobilizing LOX-1 on plastic, our strategy for isolation of targeting peptides was designed to allow peptides to interact/bind with the extracellular domain of LOX-1 at the cell surface in a native conformation (Figure 2). We therefore exposed the initial input phage library to LZRSß-galtransduced hepG2 cells, recovered unbound phage from the medium, and immediately exposed them to LZRSLOX-1transduced hepG2 cells for 1 hour. After stringent washing, the phage that bound tightly were harvested and amplified back to the original input titer of the library and used for subsequent rounds of biopanning. After 5 rounds of biopanning, we isolated and sequenced 60 individual homogenous phage (Table). No homology at either the nucleotide or the amino acid level with published sequences was identified; however, a number of consensus motifs were identified within the populations of peptides. By scoring the most commonly observed amino acid at each position, the primary consensus sequence MTTPPLT is observed. However, this individual peptide was not isolated in our screen, although in theory, it is represented within the phage display library. Motif analysis revealed marked homology between many peptides (Table). For example, peptides 29 and 46 (FTTPPGV and LTTPPKV), peptides 36, 50, and 28 (LTRPPYH, LTRPPYT, and LTRPLTV), and peptides 18 and 55 (MTAPPIQ and MTARPIK). In addition, other peptide motifs were identified and include LTPAXA (in peptides 40 and 51), LSXPP (in peptides 32 and 42), and MQP (peptides 21 and 22), where X represents positions occupied by divergent amino acids. Furthermore, detailed analysis of peptides 17 (FQTPPQL), 30 (FQPFPRL), 32 (LSIPPKA), 40 (LTPATAI), and 51 (LTPARAT), which display high LOX-1 binding (see below), sequentially contain peptides from identical amino acid groups (N-hydrophobic, polar, hydrophobic, small, small, polar, hydrophobic).
|
|
Homogenous Phage Recovery
As we identified many candidate peptides, we performed
secondary screens to identify the best binding peptides. To perform
this, we developed and used an independent expression system
(recombinant adenovirus). After development and purification of the
novel LOX-1 recombinant adenovirus (RAdLOX-1), we initially confirmed
its ability to overexpress LOX-1. Vascular SMC infected with RAdLOX-1
demonstrated high-level immunofluorescent staining for LOX-1
with no staining in mock-infected or control RAd66-infected cells
(Figure 3, A through C). To ensure that the recombinant LOX-1
was the correct molecular weight, Western blot analysis was
performed on SMC
(Figure 3D). As expected, high-level overexpression of LOX-1
was detected in cell extracts isolated from RAdLOX-1 but not control
infected cells
(Figure 3D). We next biopanned homogenous phage on
RAdLOX-1infected and control RAdß-galinfected cells to quantify
phage selectivity. Vastly different recoveries were observed
(Figure 4). Although some phage clearly demonstrated limited
recovery and therefore low affinity for LOX-1transduced cells, a
number of phage repeatedly demonstrated higher recovery from
LOX-1expressing cells compared with LOX-1negative cells. In
particular, phage expressing the peptides 17 (FQTPPQL), 32 (LSIPPKA),
and 40 (LTPATAI) demonstrated consistently high recoveries from
LOX-1 but not control transduced cells. However, many other peptides
also demonstrated consistently high recoveries from
LOX-1expressing cells
(Figure 4). This profile was reproduced in 2 further
independent experiments.
|
|
| Discussion |
|---|
|
|
|---|
Sixty individual clones were isolated and 60 different peptides identified. Although no single peptide was sequenced from multiple clones, we and others have previously shown that individual peptides isolated in this manner are efficient in binding to their designated receptor target in postphage display analysis.8 22 The primary consensus sequence in this population was MTTPPLT; however, no two peptide sequences were 100% identical. Small peptide motifs such as LTPAXA, LSXPP, TPP, TXPP, MQP, or MTP appeared in this population of peptides. Although the overall significance of these motifs is currently unknown, we believe that the isolation of a number of peptides possessing identical motifs may be important in the binding of individual phage to LOX-1. As a classic example of this, tripeptide motifs have previously been shown to be extremely important in protein interactions and signaling in eukaryotes such as RGD and RGE sequences necessary for activation of different members of the integrin family.23
Because peptides in this study were demonstrated to bind tightly to LOX-1expressing hepG2 cells in comparison to control hepG2 cells, the presence of a strong universal peptide consensus may not be entirely important. Indeed, previous studies with phage display have identified populations of peptides from phage display protocols that are only identical across tripeptide motifs.24 25 26 One of these motifs, GFE, was shown to home specifically and at high levels to lung endothelium in vivo,25 whereas peptides expressing the motif RDV were shown to preferentially home to retina in vivo.25 Although this GFE motif was not found to have homology to any published protein sequence, it was subsequently identified as binding to lung dipeptidase,27 for which retargeted adenoviral vectors have now been constructed,28 demonstrating the power of phage display to identify functionally important peptide sequences for targeting gene transfer vectors. Further indication of potential functional significance of the LOX-1binding peptides was discovered when 5 of the highest binding peptides (peptides 17, 30, 32, 40, and 51) all contained the same sequential pattern of amino acids groups. The overall hydrophobic nature of these peptides and the strict order in which they appear suggests that the peptides may all bind to the same site of LOX-1, possibly a pocket or groove. It has been suggested from other studies29 that peptides isolated by phage display often bind sites of protein-protein interaction, raising the possibility that the LOX-1binding peptides may target a functionally important binding site, allowing the use of candidate peptides as inhibitors (or activators) of the receptor.
Clearly, the next stage in the development of this technology is to incorporate candidate peptides into tropism-modified viral vectors and nonviral systems. Such approaches have been shown to result in retargeting of gene delivery with peptides with known target receptors on the cell surface, such as integrins or E-selectin30 31 32 and peptides for which the receptor is unknown.8 33 By using the LOX-1 receptor, we aim to achieve for the first time targeted gene transfer aimed specifically at dysfunctional endothelium, a development with both experimental and clinical implications for future gene transfer studies in cardiovascular disease.
| Ackowledgement |
|---|
|
|
|---|
Received October 25, 2000; first decision November 30, 2000; accepted December 11, 2000.
| References |
|---|
|
|
|---|
2.
Libby P. Gene
therapy of restenosis. Circ
Res. 1998;82:404406.
3.
Phillips MI. Is
gene therapy for hypertension possible?
Hypertension. 1999;33:813.
4. Jaffe HA, Danel C, Longenecker G, Metzger M, Setoguchi Y, Rosenfeld MA, Gant TW, Thorgeirsson SS, Stratford-Perricaudet LD, Perricaudet M, Adenovirus-mediated in vivo gene transfer and expression in normal rat liver. Nat Genet. 1992;1:372378.[Medline] [Order article via Infotrieve]
5. Merrick AF, Shewring LD, Sawyer GJ, Gustafsson KT, Fabre JW. Comparison of adenovirus gene transfer to vascular endothelial cells in cell culture, organ culture, and in vivo. Transplantation. 1996;62:10851089.[Medline] [Order article via Infotrieve]
6.
Lemarchand P, Jones
M, Yamada I, Crystal RG. In vivo gene transfer and expression in normal
uninjured blood vessels using replication-deficient recombinant
adenovirus vectors. Circ Res. 1993;72:11321138.
7.
Channon KM, Qian H,
Youngblood SA, Olmez E, Shetty GA, Neplioueva V, Blazing MA, George SE.
Acute host-mediated endothelial injury after adenoviral
gene transfer in normal rabbit arteries.
Circ Res. 1998;82:12531262.
8.
Nicklin SA, White
SJ, Watkins SJ, Hawkins RE, Baker AH. Selective targeting of gene
transfer to vascular endothelial cells by use of
peptides isolated by phage display.
Circulation. 2000;102:231237.
9. Sawamura T, Kume N, Aoyama T, Moriwaki H, Hoshikawa H, Aiba Y, Tanaka T, Miwa S, Katsura Y, Kita T, Masaki T. An endothelial receptor for oxidized low-density lipoprotein. Nature. 1997;386:7377.[Medline] [Order article via Infotrieve]
10.
Kataoka H, Kume
N, Mijamoto S, Minami M, Moriwaki H, Murase T, Sawamura T, Hashimoto N,
Kita T. Expression of lectin-like oxidized low-density lipoprotein
receptor-1 in human atherosclerotic lesions.
Circulation. 1999;99:31103117.
11.
Chen M, Kakatuani
M, Minami M, Kataoka H, Kume N, Narumija S, Kita T, Masaki T, Sawamura
T. Increased expression of lectinlike oxidized LDL receptor-1 in
initial atherosclerotic lesions of Watanabe heritable
hyperlipidemic rabbits.
Arterioscler Thromb Vasc Biol. 2000;20:11071115.
12. Nagase M, Hirose S, Sawamura T, Musaki T, Fujita T. Enhanced expression of endothelial oxidized low-density lipoprotein receptor (LOX-1) in hypertensive rats. Biochem Biophys Res Commun. 1997;237:496498.[Medline] [Order article via Infotrieve]
13. Aoyama T, Fujiwara H, Masaki T, Sawamura T. Induction of the lectin-like oxidized low-density lipoprotein receptor LOX-1 by lysophosphatidylcholine in cultured endothelial cells. J Mol Cell Cardiol. 1998;31:21012112.
14. Kinsella TD, Nolan GP. Episomal vectors rapidly and stably produce high-titer recombinant retrovirus. Hum Gene Ther. 1996;7:14051413.[Medline] [Order article via Infotrieve]
15. McGrory WJ, Bautista DS, Graham FL. A simple technique for the rescue of early region I mutations into infectious human adenovirus type 5. Virology. 1988;163:614617.[Medline] [Order article via Infotrieve]
16. Nicklin SA, Baker AH. Simple methods for preparing recombinant adenoviruses for high efficiency transduction of vascular cells. In: Baker AH, ed. Vascular Disease: Molecular Biology and Gene Transfer Protocols (Methods in Molecular Medicine). New York, NY: Humana Press; 1999.
17.
Wilkinson GWG,
Akrigg A. Constitutive and enhanced expression from the CMV major IE
promoter in a defective adenovirus vector.
Nucleic Acids Res. 1992;20:22332239.
18. Baker AH, Zaltsman AB, George SJ, Newby AC. Divergent effects of tissue inhibitor of metalloproteinase-1,-2 or -3 overexpression on rat vascular smooth muscle cell invasion, proliferation and death in vitro. J Clin Invest. 1998;101:14781487.[Medline] [Order article via Infotrieve]
19. Southgate K, Newby AC. Serum-induced proliferation of rabbit aortic smooth muscle cells from the contractile state is inhibited by 8-Br-cAMP but not 8-Br-cGMP. Atherosclerosis. 1990;82:113112.[Medline] [Order article via Infotrieve]
20. Laemmli UK. Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature. 1970;227:680685.[Medline] [Order article via Infotrieve]
21. Minami M, Kume N, Kataoka H, Morimoto M, Hayashida K, Sawamura T, Masaki T, Kita T. Transforming growth factor-ß1 increases the expression of lectin-like oxidised low-density lipoprotein receptor-1. Biochem Biophys Res Commun. 2000;272:357361.[Medline] [Order article via Infotrieve]
22.
Xia H, Anderson
B, Mao Q, Davidson BL. Recombinant human adenovirus: targeting to the
human transferrin receptor improves gene transfer to brain
microcapillary endothelium.
J Virol. 2000;74:1135911366.
23.
Gladson CL,
Cheresh DA. The
v integrins. In: Takada Y,
ed. Integrins: The Biological
Problems. Boca Raton, Fla: CRC Press;
1994:8399.
24.
Arap W,
Pasqualini R, Ruoslahti E. Cancer treatment by targeted drug delivery
to tumor vasculature in a mouse model.
Science. 1998;279:377380.
25. Rajotte D, Arap W, Hagedorn M, Koivunen E, Pasqualini R, Ruoslahti E. Molecular heterogeneity of the vascular endothelium revealed by in vivo phage display. J Clin Invest. 1998;102:430437.[Medline] [Order article via Infotrieve]
26. Pasqualini R, Ruoslahti E. Organ targeting in vivo using phage display peptide libraries. Nature. 1996;380:364366.[Medline] [Order article via Infotrieve]
27.
Rajotte D,
Ruoslahti E. Membrane dipeptidase is the receptor for a lung-targeting
peptide identified by in vivo phage display.
J Biol Chem. 1999;274:1159311598.
28. Trepel M, Grifman M, Weitzman M, Pasqualini R. Molecular adaptors for vascular-targeted adenoviral gene delivery. Hum Gene Ther. 2000;11:19711981.[Medline] [Order article via Infotrieve]
29. Fairbrother WJ, Christinger HW, Cochran AG, Fuh G, Keenan CJ, Quan C, Shriver SK, Tom JY, Wells JA, Cunningham BC. Novel peptides selected to bind to vascular endothelial growth factor receptor-binding site. Biochemistry. 1998 37;1775417764.
30. Wickham TJ, Carrion ME, Kovesdi I. Targeting of adenovirus penton base to new receptors through replacement of its RGD motif with other receptor-specific peptide motifs. Gene Ther. 1995;2:750756.[Medline] [Order article via Infotrieve]
31. Hart SL, Collins L, Gustafsson K, Fabre JW. Integrin-mediated transfection with peptides containing arginine-glycine-aspartic acid domains. Gene Ther. 1997;4:12251230.[Medline] [Order article via Infotrieve]
32. Harari OA, Wickham TJ, Stocker CJ, Kovesdi I, Segal DM, Huehns TY, Sarraf C, Haskard DO. Targeting an adenoviral gene vector to cytokine-activated vascular endothelium via E-selectin. Gene Ther. 1999;6:801807.[Medline] [Order article via Infotrieve]
33. Romanczuk H, Galer CE, Zabner J, Barsomian G, Wadsworth SC, ORiordan CR. Modification of an adenoviral vector with biologically selected peptides: a novel strategy for gene delivery to cells of choice. Hum Gene Ther. 1999;10:26152626.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
R. E. Herman, E. G. Makienko, M. G. Prieve, M. Fuller, M. E. Houston Jr, and P. H. Johnson Phage Display Screening of Epithelial Cell Monolayers Treated with EGTA: Identification of Peptide FDFWITP that Modulates Tight Junction Activity J Biomol Screen, December 1, 2007; 12(8): 1092 - 1101. [Abstract] [PDF] |
||||
![]() |
U. Gasanov, C. Koina, K. W. Beagley, R. J. Aitken, and P. M. Hansbro Identification of the Insulin-Like Growth Factor II Receptor as a Novel Receptor for Binding and Invasion by Listeria monocytogenes Infect. Immun., January 1, 2006; 74(1): 566 - 577. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Li, R. Zhao, X. Wu, Y. Sun, M. Yao, J. Li, Y. Xu, and J. Gu Identification and characterization of a novel peptide ligand of epidermal growth factor receptor for targeted delivery of therapeutics FASEB J, December 1, 2005; 19(14): 1978 - 1985. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Ghosh and M. A. Barry Selection of Muscle-Binding Peptides from Context-Specific Peptide-Presenting Phage Libraries for Adenoviral Vector Targeting J. Virol., November 1, 2005; 79(21): 13667 - 13672. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. G. Melo, M. Gnecchi, A. S. Pachori, D. Kong, K. Wang, X. Liu, R. E. Pratt, and V. J. Dzau Endothelium-Targeted Gene and Cell-Based Therapies for Cardiovascular Disease Arterioscler Thromb Vasc Biol, October 1, 2004; 24(10): 1761 - 1774. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Hypertension Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2001 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |