(Hypertension. 2001;37:574.)
© 2001 American Heart Association, Inc.
Scientific Contributions |
From the Multidisciplinary Research Group on Hypertension, Clinical Research Institute of Montreal (Canada).
Correspondence to R.M. Touyz, MD, PhD, Clinical Research Institute of Montreal, 110 Pine Ave W, Montreal, H2W 1R7, Canada. E-mail touyzr{at}ircm.qc.ca
| Abstract |
|---|
|
|
|---|
Key Words: kinase renin-angiotensin system hypertrophy arteries hypertension, arterial
| Introduction |
|---|
|
|
|---|
The molecular and cellular mechanisms underlying Ang IIdependent processes in vascular remodeling have not been fully elucidated, but activation of MAP kinases, particularly ERK1/2 and p38 MAP kinase, may be important. We previously demonstrated that increased ERK1/2 signaling by Ang II is associated with VSMC hypertrophy and hyperplasia and that inhibition of MEK1/2, the kinase that activates ERK1/2, normalizes exaggerated responses in VSMCs from SHR.3 9 Ang IIstimulated ERK1/2 activation also plays a role in hypertension-associated aortic and renal vascular fibrosis by stimulating collagen type I formation.10 11 12 13 The role of p38 MAP kinase in these processes is unclear. The p38 MAP kinase pathway typically mediates apoptosis and inflammatory reactions in response to cellular stresses.14 However, there is increasing evidence that p38 MAP kinase is also activated by G proteincoupled receptors, such as AT1, and that this kinase plays an important role in the induction of hypertrophic responses in susceptible cells.14 15 16 Studies with neonatal cardiomyocytes demonstrated that activation of p38 MAP kinasedependent pathways is associated with hypertrophy,17 and in myocardial ischemia, cardiac hypertrophy, and atherosclerosis, upregulation of p38 MAP kinase is, at least in part, responsible for the induction of early-response genes and cell growth.14 18 19 p38 MAP kinase may also influence cardiac hypertrophy by stimulating collagen synthesis and fibrogenesis. Although p38 MAP kinase appears to be important in growth signaling in cardiac cells, little is known about these events in the vasculature, and it is unclear whether p38 MAP kinase influences cellular processes associated with Ang IIdependent vascular remodeling in hypertension.
The objective of this study was to determine whether Ang II activates p38 MAP kinase in VSMCs and to evaluate whether this MAP kinase pathway influences cellular growth and production of extracellular matrix proteins in VSMCs from spontaneously hypertensive rats (SHR). We also evaluated the role of ERK1/2 in these processes. Our data indicate that Ang II increases p38 MAP kinase activity in SHR. These effects are associated with enhanced growth responses, augmented synthesis of collagen, and increased expression of procollagen mRNA. PD98059, a selective inhibitor of the ERK1/2 pathway,20 decreased DNA and protein synthesis, and SB202190, a selective p38 MAP kinase inhibitor,21 abrogated collagen synthesis in SHR but not in Wistar-Kyoto rats (WKY). Moreover, SB202190 decreased Ang IIinduced expression of procollagen in SHR. Results from this study suggest that Ang II increases activity of multiple MAP kinases, which may play differential roles in VSMC function in hypertension. Whereas ERK1/2 appears to be important in vascular hyperplasia and hypertrophy, p38 MAP kinase is an important regulator of collagen synthesis in SHR. These events could contribute to altered VSMC growth and increased deposition of extracellular matrix proteins, important processes in vascular remodeling in hypertension.
| Methods |
|---|
|
|
|---|
Cell Culture
Rats were killed by decapitation. VSMC derived from
mesenteric arteries were isolated and characterized as described in
detail previously.9 Early
passaged cells (passages 4 to 7) were used. Cells were rendered
quiescent by serum deprivation for 36 hours before
experimentation.
Western Blotting of MAP Kinases
Quiescent cells were stimulated with Ang II for
various times. In some experiments, cells were pretreated for 20 to 30
minutes with 10-5 mol/L irbesartan
(selective AT1 receptor antagonist)
or PD123319 (selective AT2 receptor blocker).
This concentration was selected because we previously demonstrated that
AT1 effects in VSMCs are completely blocked by
10-5 mol/L irbesartan and that
AT2 effects in PC12W cells (which exclusively
express AT2 receptors) are completely inhibited
by 10-5 mol/L PD123319. Cells were
prepared for immunoblots according to our previously
described
methods.3 9 Equal
amounts of proteins were loaded on a 10% SDS-polyacrylamide
gel and transferred to PVDF membrane (Boehinger Mannheim) for 1 hour at
100 V. Membranes were blocked with blocking buffer and incubated for 24
hours at 4°C with a phosphospecific ERK1/2 antibody (Calbiochem)
(diluted 1:1000) or phosphospecific p38 MAP kinase antibody
(Calbiochem) (diluted 1:1000). Membranes were washed, incubated with a
goat anti-rabbit horseradish peroxideconjugated antibody (Bio-Rad
Laboratories), diluted 1:2000 for 1 hour, and washed extensively.
Membranes were incubated with Blotting Substrate (POD) (Boehinger
Mannheim), exposed to film, and developed. Band intensity was measured
by computer analysis with the ImageQuant
program.
Determination of DNA and Collagen
Synthesis
DNA synthesis was evaluated by measuring
incorporation of 3H-thymidine into DNA, and
collagen synthesis was determined by measuring
3H-proline incorporation. Quiescent cells
were stimulated for 36 hours with increasing concentrations of Ang II.
To assess the role of ERK1/2-dependent and p38 MAP kinasedependent
pathways, cells were cotreated with PD98059 or SB202190
(10-5 mol/L).
3H-thymidine incorporation was measured as
previously
described.3 9
3H-thymidine (5 µCi/mL) was added to Ang
IIstimulated cells and incubated for 4 hours.
3H-proline incorporation was measured
according to the protocol of Dubey et
al.22
L-3H-proline (1 µCi/mL) was added at the
same time as Ang II addition.
Reverse TranscriptionPolymerase Chain
Reaction Analysis of Procollagen I and III mRNA
Total RNA was extracted from cells with TRIzol (Gibco
BRL, Life Technologies) and treated with RNAse-free DNAse.
Contamination of sample RNA by genomic DNA was excluded by directly
subjecting sample RNA to polymerase chain reaction (PCR) amplification
without a reverse transcription (RT) step. mRNA (0.5 µg) was
reverse-transcribed in a final volume of 20 µL with M-MLV RT and 1
µg/mL oligo(dT) primer. Single-stranded cDNA (4 µL) was used for
PCR to amplify a 405-bp fragment of pro
1(I) collagen (procollagen I)
cDNA with the complementary antisense primer GTTTACAGGAAGCAGACAGG, the
sense primer CGATGGATTCCAGTTCGAGTA, at an annealing temperature of
56°C. For a 447-bp fragment of pro
1(III) collagen (procollagen
III) cDNA, the antisense primer was CCATCCTCTAGAACTGTGTAAGTG, the sense
primer was CCACCCTGAACTCAAGAGTGG, and annealing temperature used was
58°C. GAPDH was used as housekeeping gene. PCR was performed for 22
cycles with Taq polymerase (Gibco-BRL).
Quantification of PCR Products
PCR products (10 µL per lane) were subjected to
electrophoresis with 1.5% agarose gel containing ethidium bromide. The
gel was dried, subjected to ultraviolet light, and photographed. The
band intensities were measured with an ImageQuant software package
(Molecular Dynamics). Signals of the expressed cDNAs were expressed
relative to the intensity of GAPDH cDNA in each coamplified
sample.
Data Analysis
Each experiment was repeated at least 3 times.
Results are presented as mean±SEM and compared by ANOVA or
Students t test where
appropriate. Concentration-response curves were fitted by nonlinear
regression, and the concentration (in mol/L) giving 50% response
(EC50) was determined and
pD2 calculated as -log
EC50. A value of
P<0.05 was considered
significant.
| Results |
|---|
|
|
|---|
|
|
Effects of PD98059 and SB202190 on Ang
IIInduced DNA, Protein, and Collagen Synthesis
Ang II dose-dependently increased synthesis of
DNA with significantly greater effects in cells from SHR
(Emax=309±21% of control,
pD2=8.3±0.08) than from WKY
(Emax=218±13% of control,
pD2=8.1±0.05)
(Figures 2 and 3). Collagen synthesis was also increased by
Ang II in a dose-dependent fashion, with enhanced responsiveness in SHR
(Emax=249±12% of control,
pD2=8.32±0.07) compared with WKY
(Emax=187±11% of control,
pD2=8.07±0.06). To evaluate the role of p38 MAP
kinase and ERK1/2 in Ang IImediated actions, cells were exposed to
SB202190 (selective p38 MAP kinase inhibitor) or PD98059
(selective MEK1/2 inhibitor). ERK1/2 inhibition decreased
Ang IIinduced 3H-thymidine and
3H-proline incorporation and normalized
responses in SHR
(Figures 2 and 3). SB202190 had no effect on DNA synthesis in
either group, whereas it significantly attenuated collagen synthesis in
the SHR group
(Figures 2 and 3).
|
|
To determine whether Ang IIinduced growth effects in SHR are generalized phenomena associated with G proteincoupled receptor activation, we also investigated effects of endothelin-1 (ET-1), a potent vasoactive agonist that has been implicated in the pathogenesis of hypertension. ET-1 induced a small increase in 3H-thymidine incorporation in WKY cells (Emax=166±26% of control), which was not significantly different in cells from SHR (Emax=171±11%). 3H-proline incorporation was only slightly increased by ET-1, with similar responsiveness in cells from WKY (Emax=126±0.5) and SHR (Emax=124±2).
Effects of PD98059 and SB202190 on Ang
IIInduced Procollagen mRNA Expression
To evaluate in greater detail the role of MAP kinases
on collagen synthesis by VSMCs, expression of procollagen I and III
mRNA was determined by measuring the ratio of optical density of
collagen I and III over GAPDH under control conditions and after 40
hours of Ang II stimulation, in the absence or presence of PD98059 or
SB202190
(Figure 4). Ang II induced a 2-fold increase in procollagen I mRNA expression
(P<0.01 versus basal and WKY
counterpart) in SHR cells. Expression of procollagen III mRNA was also
increased by Ang II, but responses did not reach significance
(P=0.057 versus basal and WKY
counterpart). However, at 44 hours, Ang II induced a significant
increase in procollagen III mRNA expression (1.8-fold) in SHR cells.
Procollagen mRNA expression was not significantly altered by Ang II in
cells from WKY, at least for the time period studied. Neither PD98059
nor SB202190 altered procollagen mRNA expression in WKY. In SHR,
SB202190 significantly decreased Ang IIstimulated expression of
procollagen I and III, whereas PD98059 had no effect. SB202190 and
PD98059 alone increased expression of procollagen I
mRNA.
|
| Discussion |
|---|
|
|
|---|
Increasing evidence suggests that Ang II influences vascular
structural changes in small arteries in hypertension. In addition to
the well-known growth-promoting actions of Ang II, this vasoactive
agent induces vascular, cardiac, and renal fibrosis. In cultured
cardiac fibroblasts, Ang II stimulates collagen protein synthesis, and
in vivo, Ang II increases collagen I mRNA expression in rat
hearts.10 23 ACE
inhibition reduced collagen deposition in large and small arteries of
SHR.4 7 24
In the L-NAME model of hypertension, AT1
receptor antagonism prevented activation of collagen I gene in the
renal and aortic vasculature and decreased development of vascular
fibrosis.13 Tharaux et
al11 demonstrated that Ang
II produces an ATI-receptormediated increase
of procol
2(I) gene activity and an overexpression of mRNA
procollagen I in freshly isolated renal and aortic vascular tissue from
transgenic mice harboring the luciferase reporter gene under the
control of the collagen I promoter. In our study, Ang II induced a
dose-dependent increase in 3H-proline
incorporation, indicating a stimulatory effect of Ang II on collagen
synthesis, particularly in cells from SHR. Evaluation of mRNA
expression of procollagen by RT-PCR confirmed that Ang IIinduced
collagen production is increased in SHR. These Ang IIelicited
responses were associated with increased synthesis of DNA and protein,
indicating that in SHR, Ang II stimulates collagen production
as well as hyperplasia and hypertrophy. This does not
appear to be a generalized phenomena associated with ligand binding to
G proteincoupled receptors because ET-1, which, like Ang II, signals
through G proteincoupled receptors, induced only a modest increase in
DNA and collagen synthesis, and responses were not significantly
increased in cells from SHR.
Activation of collagen I gene expression by Ang II in aortic
tissue from mice requires activation of the ERK1/2 and transforming
growth factor-ß1 signaling
pathways.11 These processes
were not dependent on p38 MAP kinase or nuclear
factor-
B.11 In our study,
specific inhibition of MEK1/2 attenuated Ang IIinduced synthesis of
DNA and collagen in WKY and normalized responses in SHR. SB202190, the
selective inhibitor of p38 MAP kinase, did not alter DNA
synthesis in either group, indicating that p38 MAP kinase does not play
a major role in Ang IIinduced cell growth. However, inhibition of the
p38 MAP kinase pathway decreased Ang IIstimulated collagen synthesis
in cells from SHR, with no effect in cells from WKY. In support of
these findings, Ang IIinduced expression of procollagen I and III was
reduced by SB202190 in cells from SHR but not in cells from WKY.
Although PD98059 decreased 3H-proline
incorporation, it did not alter mRNA expression of procollagens,
suggesting that ERK1/2 effects on collagen production are
probably posttranscriptional. These data suggest that in pathological
conditions associated with vascular fibrosis, such as hypertension, p38
MAP kinase activation may be an important mediator of increased
collagen synthesis. Interestingly, PD98059 and SB202190 alone increased
expression of procollagen I mRNA in SHR cells. Although the exact
reasons for these effects are unclear, it may be possible that
inhibition of one pathway, for example, ERK1/2, leads to upregulation
of the other pathway, for example, p38 MAP kinase, which in turn
influences procollagen mRNA expression. Further details regarding these
associations await clarification.
p38 MAP kinase, of which there are at least 4 isoforms
(p38
, ß1/2,
, and
), are typically activated by
inflammatory stimuli and cellular stresses, which induce
apoptosis.25 26
However, p38 MAP kinase has also been associated with
cardiovascular
hypertrophy.15 18 27
The divergent effects of this MAP kinase may be mediated by different
isoforms. We demonstrate that Ang II activates p38 MAPK and
that augmented responses in SHR are associated with processes that
stimulate collagen synthesis. A possible mechanism underlying Ang
IIinduced p38 MAP kinase actions in SHR may be due to oxidative
stressdependent pathways. p38 MAP kinase is a redox-sensitive
kinase,28 29 30
and in hypertension, Ang IIinduced generation of vascular reactive
oxygen species is
increased.31 32
In WKY, Ang II elicited a modest increase in p38 MAP kinase activity,
which did not influence collagen synthesis or mRNA expression of
procollagens. These findings are in keeping with previously reported
data, which failed to demonstrate a p38 MAP kinasedependent pathway
in collagen gene activation by Ang
II.11 Irbesartan but not
PD123319 inhibited Ang IIinduced phosphorylation of
p38 MAP kinase, indicating that in VSMCs, Ang II activation of this MAP
kinase is mediated by the AT1 receptor
subtype.
Mechanisms underlying increased Ang IIinduced hyperresponsiveness in SHR have not been fully elucidated but are probably due to postreceptor phenomena and not to differences at the receptor level. This is supported by our previous findings that Ang receptor density and AT1 receptor mRNA and protein expression are not different in VSMCs from age-matched adult SHR and WKY.33 34 It may be possible that dysregulation of upstream modulators, such as Src, PI3 kinase, or other kinases, could contribute to altered growth signaling by Ang II in cells from genetically hypertensive rats. In support of this are findings that Ang IIinduced activation of Src is increased in SHR and that Src-dependent regulation of p38 MAP kinase and ERK1/2 are altered in VSMCs from SHR.35
Conclusions
The results from our study suggest that Ang II
increases the activity of multiple MAP kinases, which may play
differential roles in VSMC function in hypertension. Whereas ERK1/2
influences vascular hyperplasia and hypertrophy, p38 MAP
kinase is an important regulator of collagen synthesis in SHR. These
events could contribute to altered VSMC growth and increased deposition
of extracellular matrix proteins, important processes in vascular
remodeling in genetic hypertension.
| Acknowledgments |
|---|
Received October 26, 2000; first decision November 27, 2000; accepted December 11, 2000.
| References |
|---|
|
|
|---|
2.
Geisterfer AA,
Peach MJ, Owens GK. Angiotensin II induces
hypertrophy, not hyperplasia, of cultured rat aortic smooth
muscle cells. Circ Res. 1988;62:749756.
3. Touyz RM, Deng L-Y, He G, Schiffrin EL. Angiotensin II stimulates DNA and protein synthesis in vascular smooth muscle cells from human peripheral resistance arteries: role of extracellular signal-regulated kinases. J Hypertens. 1999;17:907917.[Medline] [Order article via Infotrieve]
4.
Benetos A, Levy BI,
Lacolley P, Taillard F, Duriez M, Safar ME. Role of Ang II and
bradykinin on aortic collagen following converting enzyme inhibition in
spontaneously hypertensive rats.
Arterioscler Thromb Vasc Biol. 1997;17:31963201.
5.
Schiffrin EL, Park
J-B, Intengan H, Touyz RM. Correction of arterial structure
and endothelial dysfunction in human essential
hypertension by the angiotensin II receptor
antagonist losartan.
Circulation. 2000;101:16531659.
6.
Schiffrin EL, Deng
LY, Larochelle P. Effects of a ß-blocker or a converting enzyme
inhibitor on small arteries in essential hypertension.
Hypertension. 1994;23:8391.
7. Sharifi AM, Li JS, Endemann D, Schiffrin EL. Comparison of effects of the angiotensin converting enzyme inhibitor enalapril and the calcium channel antagonist amlodipine on small artery structure and composition and on endothelial dysfunction in SHR. J Hypertens. 1998;16:457466.[Medline] [Order article via Infotrieve]
8.
Schwartzkopff B,
Brehm M, Mundhenke M, Strauer BE. Repair of coronary arterioles
after treatment with perindopril in hypertensive heart disease.
Hypertension. 2000;36:220225.
9.
Touyz RM, El
Mabrouk M, Schiffrin EL. Mitogen-activated
protein/extracellular signal-regulated kinase inhibition attenuates Ang
II-mediated signaling and contraction in SHR vascular smooth muscle
cells. Circ Res. 1999;84:505515.
10. Brilla CG, Zhou G, Matsubara L, Weber KT. Collagen metabolism in cultured adult rat cardiac fibroblasts: response to angiotensin II and aldosterone. J Mol Cell Cardiol. 1994;26:809820.[Medline] [Order article via Infotrieve]
11.
Tharaux P-L,
Chatziantoniou C, Fakhouri F, Dussaule J-C. Angiotensin II
activates collagen I through a mechanism involving the MAP/ER
kinase pathway. Hypertension. 2000;36:330336.
12. Kaiura TL, Itoh H, Kent KC. The role of MAP kinase and protein kinase C in fibronectin production in human vascular smooth muscle cells. J Surg Res. 1999;84:212217.[Medline] [Order article via Infotrieve]
13. Boffa JJ, Tharaux PL, Placier S, Ardaillou R, Dussaule JC, Chatziantoniou C. Angiotensin II activates collagen type I gene in the renal vasculature of transgenic mice during inhibition of nitric oxide synthesis: evidence for an endothelin-mediated mechanism. Circulation. 1999;100:10911098.
14. New L, Han J. The p38 MAP kinase pathway and its biological function. Trends Cardiovasc Med. 1998;8:220229.[Medline] [Order article via Infotrieve]
15.
Clerk A, Michael
A, Sugden PH. Stimulation of the p38 MAP kinase in neonatal rat
ventricular myocytes by the G protein-coupled receptor
agonists, endothelin-1 and phenylephrine: a role in cardiac
myocyte hypertrophy? J
Cell Biol. 1998;142:523535.
16.
Kusuhara M,
Takahashi E, Peterson TE, Abe J-I, Ishida M, Han J, Ulevitch R, Berk
BC. p38 Kinase is a negative regulator of ang II signal transduction in
vascular smooth muscle cells: effects on
Na+/H+ exchange
and ERK1/2. Circ Res. 1998;83:824831.
17.
Hines WA, Thoburn
J, Thorburn A. Cell density and contraction regulate p38 MAP
kinase-dependent responses in neonatal rat cardiac myocytes.
Am J Physiol. 1999;277:H331H341.
18. Han J, Jiang Y, Li Z, Kravchenko VV, Ulevitch RJ. Activation of the transcription factor MEF2C by the MAP kinase p38 in inflammation. Nature. 1997;386:296299.[Medline] [Order article via Infotrieve]
19.
Clerk A, Fuller
SJ, Michael A, Sugden PH. Stimulation of stress-regulated MAP kinases
(SAPK/JNKs and p38 MAPK) in perfused rat hearts by oxidative and other
stresses. J Biol Chem. 1998;273:72287234.
20. Frantz B, Klatt T, Pang M, Parsons J, Rolando A, Williams H, Tocci MJ, OKeefe SJ, ONeill EA. The activation state of p38 MAP kinase determines the efficiency of ATP competition for pyridinylimidazole inhibitor binding. Biochemistry. 1998;37:1384613853.[Medline] [Order article via Infotrieve]
21.
Dudley DT, Pang
L, Decker JS, Bridges AJ, Saltiel AR. A synthetic inhibitor
of the mitogen-activated protein kinase cascade.
Proc Natl Acad Sci
U S A. 1995;92:76867689.
22.
Dubey RK,
Gillespie DG, Jackson EK. Adenosine inhibits collagen and
protein synthesis in cardiac fibroblasts: role of
A2B receptors.
Hypertension. 1998;31:943948.
23. Schieffer B, Wirger A, Meybrunn M, Seitz S, Holtz J, Riede UN, Drexler H. Comparative effects of angiotensin-converting enzyme inhibition and angiotensin II type I receptor blockade on cardiac remodeling after myocardial infarction in the rat. Circulation. 1994;89;22732282.
24.
Albaladejo P,
Bouaziz H, Duriez M, Gohlke P, Levy BI, Safar ME, Benetos A.
Angiotensin-converting enzyme inhibition prevents the
increase in aortic collagen in rats.
Hypertension. 1994;23:7482.
25.
Enslen H,
Raingeaud J, Davis R. Selective activation of p38 MAP kinase isoforms
by the MAP kinase kinases MKK3 and MKK6.
J Biol Chem. 1998;273:17411748.
26.
Sugden PH, Clark
A. Stress-response MAPK (JNK, and p38 MAPK) in the
myocardium. Circ
Res. 1998;83:345352.
27.
Wang Y, Huang S,
Sah VP, Ross J Jr, Brown JH, Han J, Chien KR. Cardiac muscle cell
hypertrophy and apoptosis induced by distinct
members of the p38 MAP kinase family.
J Biol Chem. 1998;273:21612168.
28.
Ushio-Fukai M,
Alexander RW, Akers M, Griendling KK. p38 MAPK is a critical component
of the redox-sensitive signaling pathways activated by Ang II.
J Biol Chem. 1998;273:1502215029.
29.
Viedt C, Soto U,
Krieger-Brauer HI, Fei J, Elsing C, Kubler W, Kreuzer J. Differential
activation of MAP kinases in smooth muscle cells by Ang II: involvement
of p22phox and reactive oxygen species.
Arterioscler Thromb Vasc Biol. 2000;20:940948.
30.
Rao GN, Katki KA,
Madamanchi NR, Wu Y, Birrer MJ. JunB forms the majority of the AP-1
complex and is a target for redox regulation by receptor tyrosine
kinase and g protein-coupled receptor agonists in smooth muscle cells.
J Biol Chem. 1999;274:60036010.
31.
Zafari AM,
Ushio-Fukai M, Akers M, Yin Q, Shah A, Harrison DG, Taylor WR,
Griendling KK, Role of NADH/NADPH oxidase-derived
H2O2 in
angiotensin II-induced vascular hypertrophy.
Hypertension. 1998;32:488495.
32.
Touyz RM,
Schiffrin EL. Ang IIinduced superoxide production is mediated
via phospholipase D in human vascular smooth muscle cells.
Hypertension. 1999;34:976982.
33.
Schiffrin EL,
Thome FS, Genest J. Vascular Ang II receptors in SHR.
Hypertension. 1984;6:682688.
34.
Touyz RM,
Endemann D, He G, Li J-S, Schiffrin EL. Role of
AT2 receptors in Ang IIstimulated contraction
of small mesenteric arteries in young SHR.
Hypertension. 1999;33:366372.
35. Touyz RM, He G, El Mabrouk M, Diep Q, Mardigyan V, Schiffrin EL. Differential activation of ERK1/2 and p38 MAP kinase by AT1 receptors in vascular smooth muscle cells from WKY and SHR. J Hypertens. In press.
This article has been cited by other articles:
![]() |
A.C. Montezano, G.E. Callera, A. Yogi, Y. He, R.C. Tostes, G. He, E.L. Schiffrin, and R.M. Touyz Aldosterone and Angiotensin II Synergistically Stimulate Migration in Vascular Smooth Muscle Cells Through c-Src-Regulated Redox-Sensitive RhoA Pathways Arterioscler Thromb Vasc Biol, August 1, 2008; 28(8): 1511 - 1518. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Belmadani, M. Zerfaoui, H. A. Boulares, D. I. Palen, and K. Matrougui Microvessel vascular smooth muscle cells contribute to collagen type I deposition through ERK1/2 MAP kinase, {alpha}v{beta}3-integrin, and TGF-{beta}1 in response to ANG II and high glucose Am J Physiol Heart Circ Physiol, July 1, 2008; 295(1): H69 - H76. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gamberoni, E. Lamma, G. Lodo, J. Marchesini, N. Mascellani, S. Rossi, S. Storari, L. Tagliavini, and S. Volinia Fun&Co: identification of key functional differences in transcriptomes Bioinformatics, October 15, 2007; 23(20): 2725 - 2732. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Louis, A. Kakou, V. Regnault, C. Labat, A. Bressenot, J. Gao-Li, H. Gardner, S. N. Thornton, P. Challande, Z. Li, et al. Role of {alpha}1beta1-integrin in arterial stiffness and angiotensin-induced arterial wall hypertrophy in mice Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2597 - H2604. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-K. Park, R. Fischer, R. Dechend, E. Shagdarsuren, A. Gapeljuk, M. Wellner, S. Meiners, P. Gratze, N. Al-Saadi, S. Feldt, et al. p38 Mitogen-Activated Protein Kinase Inhibition Ameliorates Angiotensin II-Induced Target Organ Damage Hypertension, March 1, 2007; 49(3): 481 - 489. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. K. Mehta and K. K. Griendling Angiotensin II cell signaling: physiological and pathological effects in the cardiovascular system Am J Physiol Cell Physiol, January 1, 2007; 292(1): C82 - C97. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Paravicini and R. M. Touyz Redox signaling in hypertension Cardiovasc Res, July 15, 2006; 71(2): 247 - 258. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. E. Callera, A. C. I. Montezano, A. Yogi, R. C. Tostes, Y. He, E. L. Schiffrin, and R. M. Touyz c-Src-Dependent Nongenomic Signaling Responses to Aldosterone Are Increased in Vascular Myocytes From Spontaneously Hypertensive Rats Hypertension, October 1, 2005; 46(4): 1032 - 1038. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. E. Callera, R. M. Touyz, R. C. Tostes, A. Yogi, Y. He, S. Malkinson, and E. L. Schiffrin Aldosterone Activates Vascular p38MAP Kinase and NADPH Oxidase Via c-Src Hypertension, April 1, 2005; 45(4): 773 - 779. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Otis, S. Campbell, M. D. Payet, and N. Gallo-Payet Angiotensin II Stimulates Protein Synthesis and Inhibits Proliferation in Primary Cultures of Rat Adrenal Glomerulosa Cells Endocrinology, February 1, 2005; 146(2): 633 - 642. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Schiffrin and R. M. Touyz From bedside to bench to bedside: role of renin-angiotensin-aldosterone system in remodeling of resistance arteries in hypertension Am J Physiol Heart Circ Physiol, August 1, 2004; 287(2): H435 - H446. [Full Text] [PDF] |
||||
![]() |
J. Widder, T. Behr, D. Fraccarollo, K. Hu, P. Galuppo, P. Tas, C. E Angermann, G. Ertl, and J. Bauersachs Vascular endothelial dysfunction and superoxide anion production in heart failure are p38 MAP kinase-dependent Cardiovasc Res, July 1, 2004; 63(1): 161 - 167. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ju, D. J. Behm, S. Nerurkar, M. E. Eybye, R. E. Haimbach, A. R. Olzinski, S. A. Douglas, and R. N. Willette p38 MAPK Inhibitors Ameliorate Target Organ Damage in Hypertension: Part 1. p38 MAPK-Dependent Endothelial Dysfunction and Hypertension J. Pharmacol. Exp. Ther., December 1, 2003; 307(3): 932 - 938. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Massett, Z. Ungvari, A. Csiszar, G. Kaley, and A. Koller Different roles of PKC and MAP kinases in arteriolar constrictions to pressure and agonists Am J Physiol Heart Circ Physiol, December 1, 2002; 283(6): H2282 - H2287. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Virdis, M. F. Neves, F. Amiri, E. Viel, R. M. Touyz, and E. L. Schiffrin Spironolactone Improves Angiotensin-Induced Vascular Changes and Oxidative Stress Hypertension, October 1, 2002; 40(4): 504 - 510. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. N. Diep, M. El Mabrouk, J. S. Cohn, D. Endemann, F. Amiri, A. Virdis, M. F. Neves, and E. L. Schiffrin Structure, Endothelial Function, Cell Growth, and Inflammation in Blood Vessels of Angiotensin II-Infused Rats: Role of Peroxisome Proliferator-Activated Receptor-{gamma} Circulation, May 14, 2002; 105(19): 2296 - 2302. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Hypertension Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2001 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |