This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Nicholas, S. B. Articles by Hsueh, W. A. Search for Related Content PubMed PubMed Citation Articles by Nicholas, S. B. Articles by Hsueh, W. A. Pubmed/NCBI databases Compound via MeSH Substance via MeSH Related Collections Animal models of human disease Type 2 diabetes

(Hypertension. 2001;37:722.)
© 2001 American Heart Association, Inc.

Scientific Contributions

Expression and Function of Peroxisome Proliferator–Activated Receptor- in Mesangial Cells

Susanne B. Nicholas; Yasuko Kawano; Shu Wakino; Alan R. Collins; Willa A. Hsueh

From the Department of Medicine, Division of Nephrology (S.B.N.), and Division of Endocrinology, Diabetes, and Hypertension (S.B.N., S.W., A.R.C., W.A.H.), UCLA School of Medicine, Los Angeles, Calif, and Nagasaki University Hospital (Y.K.), Third Department of Internal Medicine, Nagasaki, Japan.

Correspondence to Susanne B. Nicholas, MD, PhD, UCLA School of Medicine, Division of Nephrology and Division of Endocrinology, Warren Hall, Suite 24-130, 900 Veteran Ave, Box 957073, Los Angeles, CA 90095. E-mail sunicholas{at}mednet.ucla.edu

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Peroxisome proliferator–activated receptor- (PPAR) is a novel nuclear receptor, which enhances insulin-mediated glucose uptake. Ligands to PPAR are currently used as therapy for type II diabetes. Using Western blot analysis, RNase protection assay, and immunostaining, we identified the presence of PPAR message and protein in cultured primary rat mesangial cells. Electrophoretic mobility of a labeled PPAR response element (PPRE) was retarded in the presence of mesangial cell nuclear extract, suggesting that PPAR is functional in these cells. The addition of unlabeled PPRE efficiently competed away the PPAR-PPRE protein complex, confirming specificity of binding of the PPAR to the PPRE. PPAR ligands rosiglitazone (1 to 10 µmol/L) and troglitazone (1 to 10 µmol/L) inhibited platelet-derived growth factor–induced DNA synthesis, measured as bromodeoxyuridine incorporation (P<0.01). This inhibition was dose dependent. When administered in antidiabetic doses to streptozotocin-induced diabetic rats, troglitazone substantially normalized albumin excretion at 3 months (from 687.1 to 137.6 µg urinary albumin/mg creatinine, P<0.05) but did not affect hyperglycemia or blood pressure in this model. This treatment also decreased glomerular plasminogen activator inhibitor-1 (PAI-1) expression. These data suggest that PPAR activation may directly attenuate diabetic glomerular disease, possibly by inhibiting mesangial growth, which occurs early in the process of diabetic nephropathy, or by inhibiting PAI-1 expression. PAI-1 inhibits the activation of plasmin and matrix metalloproteinase, which degrade extracellular matrix in the glomerulus. Excess glomerular PAI-1 allows the accumulation of extracellular matrix, leading to glomerulosclerosis. These results have therapeutic implications for diabetic nephropathy as well as for proliferative mesangial diseases of the kidney.

Key Words: diabetes mellitus • insulin • mesangium • kidney • albuminuria

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
The peroxisome proliferator–activated receptors (PPARS) are a subfamily of the nuclear receptor gene superfamily that includes thyroxin, retinoic acid receptor, and vitamin D. These receptors are important in regulating a variety of genes involved in lipid metabolism, fatty acid transport, and cellular catabolism or storage. The PPARs consist of 3 isotypes, PPAR, PPARß, and PPAR.^{1 2} Through alternate promoter usage and splicing, the human PPAR gene is organized into 3 isoforms, PPAR1, PPAR2, and PPAR3, which are differentially expressed and regulated in various tissues.³ PPARs heterodimerize with the 9-cis-retinoic acid receptor (RXR) and, after ligand binding, function as transcription factors in the regulation of adipogenesis and insulin-mediated glucose metabolism.⁴ Recently, they have been identified in vascular smooth muscle cells, in which they inhibit growth and migration, and in monocyte macrophages, in which they inhibit inflammation.^{5 6 7 8}

Thiazolidinediones (TZDs) are ligands for PPAR. Rosiglitazone (RSG) and troglitazone (TRO) not only have demonstrated significant utility as insulin-sensitizing agents^{9 10 11} but also have demonstrated their effectiveness in decreasing albuminuria in patients with early diabetic nephropathy.¹² This effect was not seen with other oral agents despite similar degrees of glucose control. TRO was also reported to decrease albumin excretion in the streptozotocin (STZ)-induced diabetic rat without lowering glucose,¹³ whereas RSG lowered albumin excretion in the obese Zucker diabetic rat.¹⁴

The present investigation demonstrates that PPAR1 message and protein are expressed in mesangial cells (MCs) and upregulated in the presence of glomerular injury. Ligands to PPAR inhibit MC growth, and in the STZ rat, TRO not only decreased albumin excretion but also decreased plasminogen activator inhibitor-1 (PAI-1) in the absence of changes in blood pressure or glucose. Therefore, we hypothesize that PPAR ligands directly affect MC function. Ultimately, PPAR ligands may prove to be useful in the prevention or treatment of diabetic nephropathy.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
MC Culture
Rat glomeruli were isolated from normal adult (200- to 650-g) Sprague-Dawley rats (Charles River, Boston, Mass) by using the sieving technique.¹⁵ Glomerular cores were plated in DMEM containing D-valine with 25 mmol/L HEPES, 20% FBS, 100 IU/mL penicillin, 100 µg/mL streptomycin (Sigma Chemical Co), 2.5 µg/mL amphotericin B (GIBCO), and 1 µmol/L recombinant human insulin (Sigma ). The glomerular cores attached after 10 days. After the fourth or fifth passage, RPMI media containing 20% FBS, 100 IU/mL penicillin, 100 µg/mL streptomycin (Sigma), 2.5 µg/mL amphotericin B (GIBCO), and 1 µmol/L recombinant human insulin (Sigma) facilitated MC growth. MCs were characterized before use by phenotype and immunostaining. These cells have a stellate appearance and stain positively for fibronectin and -smooth muscle actin (Sigma) and negatively for cytokeratin. The cells were used between passages 6 and 10. Nonconfluent cells were serum-starved (0.5% FBS) for 24 hours before use.

Western Blot Analysis
MCs were lysed in lysis buffer (20 mmol/L Tris [pH 7.5], 150 mmol/L NaCl, 1 mmol/L EDTA, 1 mmol/L EGTA, 1% Triton X-100, 2.5 mmol/L sodium pyrophosphate, 1 mmol/L sodium orthovanadate, 1 µg/µL leupeptin, and 1 mmol/L phenylmethylsulfonyl fluoride). Protein concentrations were determined by using the DC protein assay (Bio-Rad). Proteins were separated by SDS-PAGE and transferred to a nitrocellulose membrane (Amersham Life Sciences). The membrane was incubated in 25 mL of blocking buffer (TBS, containing 0.1% Tween 20 and 5% nonfat dry milk) overnight at 4°C, followed by anti-PPAR antibody (Glaxo Wellcome Research and Development) and anti-RXR (Santa Cruz Biotechnology) for 3 hours at room temperature, washed with TBS/Tween 20, and incubated with anti-rabbit IgG horseradish peroxidase–conjugated antibody (1:1000, Amersham Life Sciences) for 1 hour at room temperature. The membranes were then washed with TBS/Tween 20, and protein was detected by enhanced chemiluminescence method as per the manufacturer’s instructions (Amersham Pharmacia Biotechnology).

RNA Isolation and Northern Blot Analysis
Total RNA was isolated by using Trizol reagent (Life Technologies) as per the manufacturer’s instructions. Twenty to 30 µg of total RNA was electrophoresed in 1.2% agarose gels containing formaldehyde, transferred to charged nylon membranes (MCI), and cross-linked in a Stratalinker (Stratagene). The nylon membranes were hybridized with cDNA probes (the PAI-1 cDNA probe was a gift from Dr Edward Feener, Joslin Diabetes Center, Boston, Mass) labeled with [³²P]dCTP (3000 Ci/mmol). The hybridized signals of mRNA of interest were normalized to those of CHOB, a constitutively expressed gene to correct for differences in sample loading.

RNase Protection Assay
Partial cDNA probes for PPAR1, PPAR2, and RXR within the pGEM-3 vectors were provided by Dr Jeffrey Flier (Harvard University, Cambridge, Mass), and cDNA for rat PAI-1 in the pGEM-T Easy vector was obtained from Promega Corp. RNase protection assay (RPA) vectors were linearized with HindIII or EcoRI and labeled by using the RiboQuant in vitro transcription kit (Pharmingen). The RiboQuant RNase protection kit (Pharmingen) was subsequently used. Briefly, [³²P]UTP-labeled RNA probes were incubated with 5 to 10 µg of MC total RNA in hybridization solution for 12 to 16 hours at 56°C followed by 45 minutes at 30°C. After ethanol precipitation, samples were resuspended in 7 µL of gel-loading buffer (80% formamide, 1 mmol/L EDTA [pH 8.0], 50 mmol/L Tris borate [pH 8.3], 0.05% bromophenol blue, and 0.05% xylene cyanol) and electrophoresed on a 6% nondenaturing polyacrylamide gel at 200 to 250 V for 3 hours. Protected bands were visualized by autoradiography.

Immunohistochemistry
MCs were grown in RPMI-1640 with 20% FBS and 1 µmol/L insulin on culture chamber slides as described above. The cells were fixed with 4% paraformaldehyde for 15 minutes. Blocking solution containing 1% BSA in 1x PBS was added, and the cells were incubated with rabbit anti-PPAR antibody (1:300 dilution) or anti-RXR antibody (Biomol Research Laboratories, Inc) at 4°C overnight. Biotinylated secondary antibody (Zymed Laboratories, Inc) was applied for 30 minutes, followed by a 20-minute incubation with streptavidin peroxidase. Peroxidase activity was detected by using aminoethylcarbazole as a chromogen in the liquid AEC kit, as per the manufacturer’s instructions (Zymed Laboratories, Inc). The slides were then counterstained with Mayer’s acid hematoxylin for 3 minutes.

Electrophoretic Mobility Gel Shift Analysis
Nuclear extract from MCs was prepared as described.¹⁶ A double-stranded 20-mer (5'TGAAACTAGGGTAAAGTTCA3') was synthesized according to the sequence of the rat CYP4A1, which has a PPAR response element (PPRE), and radiolabeled with the use of T4 polynucleotide kinase. Ten micrograms of nuclear extract and 25 000 cpm of probe were incubated on ice for 30 minutes in binding buffer (50 mmol/L KCl, 15 mmol/L HEPES [pH 7.9], 1 mmol/L EDTA, 0.5 mmol/L dithiothreitol, 6 mmol/L MgCl₂, 10% glycerol, 2 µg poly[d(I-C)], and 10 µg BSA). DNA-protein complexes were separated by electrophoresis on a 6% native polyacrylamide gel in 1x Tris/borate/EDTA buffer at 4°C. The gel was dried and exposed to radiographic film at -80°C. Competition assays were performed by using 100-fold molar excess unlabeled wild-type and mutant oligonucleotides.

BrdU Incorporation
MCs were plated on 6-well plates, grown to 60% to 70% confluence, and serum-starved in 0.5% FBS for 24 hours. The cells were preincubated with RSG (BRL 49653, 1 to 10 µmol/L) and TRO (1 to 10 µmol/L) for 30 minutes and stimulated with human recombinant platelet-derived growth factor (PDGF-BB, 50 ng/mL, Sigma) for 24 hours. Controls were kept in serum-free media. Cells were incubated with bromodeoxyuridine (BrdU), a thymidine analogue. The cells were methanol-fixed and incubated in 1N HCl for 2 hours. Monoclonal mouse anti-BrdU antibody was added, and cells were incubated for 30 minutes at 37°C. The cells were covered with alkaline phosphatase–conjugated sheep anti-mouse IgG antibody for 30 minutes at 27°C and exposed to color substrate (nitro blue tetrazolium). Each step was separated by several washes with 1x PBS. MC nuclei, which incorporated BrdU, appeared brown and were counted in 4 to 6 different fields per well and related to the total cell number. Data were based on different experiments from 4 preparations of MCs.

STZ-Induced Experimental Diabetes
Normal (200- to 450-g) Sprague-Dawley rats (Charles River) were given a single intraperitoneal injection of STZ (65 mg/kg) and housed in a 12-hour light cycle. Three days after recovery, the blood glucose was measured by glucose analyzer (Beckman) to document hyperglycemia (500 to 650 mg/dL). The STZ-induced diabetic animals were divided into treated and untreated groups. Treated animals were fed TRO (2 g/kg, SmithKline Beecham) for 3 months, and blood pressures were measured weekly by the tail-cuff method. On the day before kidney harvest, diabetic and weight-matched control animals were placed in metabolic cages for 24-hour urine collection, and final plasma glucose was determined.

Plasma Albumin and Urine Creatinine Measurement
Urine from each animal was used for creatinine and albumin determination. Urine albumin concentration was measured by rat albumin enzyme immunoassay as per the manufacturer’s instructions (Cayman). Creatinine was measured by using the colorimetric method, based on the Jaffe reaction,¹⁷ as per the manufacturer’s instructions (Sigma Diagnostics). From these measurements, the ratio of urinary albumin to creatinine was determined.

Statistical Analysis
The raw data are expressed as the mean±SEM. Differences between groups were analyzed by using standard statistical analyses and the Student t test. A level of P<0.05 was considered statistically significant.

	Results

Top Abstract Introduction Methods Results Discussion References

 
PPAR1 and RXR Are Present in MC Nuclear Extract
Protein from MC whole-cell nuclear extract and the glomerular fraction were obtained from normal Sprague-Dawley rats and compared with that from the cytoplasmic extract by Western blot analysis. Nuclear extracts from adipocytes and preadipocytes were used as positive and negative controls, respectively (Figure 1A). The double band observed in adipocyte nuclear extract is presumed to be due to alternative splicing and is always present. PPAR protein was absent from MC cytoplasmic extract but was present in MC nuclear extract, whole-cell extract, and glomerular fractions. RXR protein, the heterodimeric partner of PPAR, was present in readily detectable amounts in most samples but only minimally present in cytoplasmic extract. We examined total RNA obtained from MCs in culture, glomerular and nonglomerular fractions of kidney, and the whole kidney, with the use of RPAs to identify PPAR mRNA. Figure 1B indicates minimal expression of PPAR2 in any of the samples. However, PPAR was present in whole kidney, in glomerular and nonglomerular cortical tissue, and in cultured MCs, as was message for RXR. PPAR1 is the primary form of the receptor in other tissues outside of adipose tissue. Similar findings were recently demonstrated by Asano et al.¹⁸

View larger version (39K): [in this window] [in a new window]   Figure 1. Analysis of PPAR1, PPAR2, and RXR in MCs. A, Western blot analysis was performed by using nuclear extract (NE), whole-cell extract, and cytoplasmic extract from primary MCs as well as glomerular fraction from normal rat kidneys. NEs from differentiated 3T3-L1 adipocytes and undifferentiated 3T3-L1 preadipocytes were used as positive and negative controls, respectively. B, Total RNA from cultured MCs, whole kidney, and glomerular and nonglomerular fractions was used for RPA. C, Immunostaining was performed on cultured primary MCs.

Cultured rat primary MCs were immunostained to confirm the nuclear localization of both PPAR and RXR. As Figure 1C shows, both nuclear transcription factors localize to the nuclei of MCs. There was little or no staining for PPAR or RXR in the cytoplasm. All figures are representative of at least 3 separate experiments.

PPAR Binds to Its DNA Response Element in Primary MCs
An electrophoretic mobility shift assay was performed to determine whether the PPAR protein detected in the present study is potentially functional. The DNA response element for PPAR (PPRE) was used as labeled probe in Figure 2. Nuclear extract from primary MCs was incubated with labeled PPRE and run on an electrophoretic gel. Lane 1 shows that the mobility of the free probe was not retarded and ran to the bottom of the gel. Lane 2 shows that incubation of labeled PPRE with nuclear protein formed a complex, which retarded its mobility on the gel. In lane 3, the shifted band was efficiently competed away in the presence of unlabeled probe, indicating that protein binding to the labeled PPRE was specific. There was no binding of nuclear protein when labeled mutated PPRE was incubated with nuclear extract (lane 4). Furthermore, there was no competition for binding to the wild-type PPRE in the presence of cold unlabeled mutated PPRE (lane 5) and nuclear protein. These results suggest that the PPAR protein found in primary MCs binds specifically to the PPRE and, therefore, is potentially functional.

View larger version (54K): [in this window] [in a new window]   Figure 2. Electrophoretic mobility shift assay. This competition assay was performed by using synthetically labeled oligonucleotide containing PPRE (lane 1) and nuclear extract from primary MCs. All lanes contained labeled probe. Lanes are as follows: 2, band shift in the presence of primary MC nuclear extract; 3, result of positive competition in the presence of excess unlabeled probe; 4, result of labeled mutated PPRE incubated with MC nuclear extract; and 5, result of negative competition in the presence of labeled wild-type PPRE and unlabeled mutated PPRE. This is representative of at least 3 assays.

TZDs Inhibit PDGF-Stimulated Growth of MCs and Ang II–Induced PAI-1 Expression In Vitro
PDGF-BB, which activates both and ß PDGF receptors, is the most potent mitogen for MC growth.^{19 20} Therefore, PDGF was used to achieve a maximum proliferative response in MCs. Cultured primary MCs were preincubated with RSG (BRL 49653, 1 to 10 µmol/L) or TRO (1 to 10 µmol/L) for 30 minutes, followed by stimulation with PDGF (50 ng/mL) for 24 hours. Figure 3 shows a dose-dependent inhibition of PDGF-induced primary MC growth measured by labeled BrdU incorporation. Therefore, activation of the PPAR receptor in MCs significantly attenuates DNA synthesis. Proliferation of human hepatic stellate cells may also undergo an inhibitory response to PPAR activation.²¹

View larger version (18K): [in this window] [in a new window]   Figure 3. PPAR ligands inhibit PDGF-stimulated MC proliferation. Primary MCs were serum-starved in 0.5% FBS for 24 hours. Cells were pretreated for 30 minutes with RSG (BRL 49653, 1 to 10 µmol/L) or TRO (1 to 10 µmol/L), followed by stimulation with PDGF (50 ng/mL) for 24 hours. DNA synthesis was determined by BrdU incorporation. Results are expressed as percentage of PDGF-stimulated cells per treatment compared with control (n=4). *P<0.05.

PAI-1 expression is induced by angiotensin II (Ang II) in MCs. This effect is probably Ang II type 1 (AT₁) receptor–mediated, inasmuch as the AT₁ receptor blocker losartan decreased PAI-1 expression. TRO (10 µmol/L) also inhibited Ang II–induced PAI-1 expression (Figure 4). No effect of TRO was seen on Ang II–induced collagen I or fibronectin expression (data not shown).

View larger version (73K): [in this window] [in a new window]   Figure 4. Troglitazone (Tro) decreases Ang II–induced PAI-1 expression. Cultured rat primary MCs were serum-starved for 24 hours with 0.5% FBS. The cells were pretreated with losartan (Los, 100 mmol/L) and Tro (1 µmol/L) for 30 minutes, followed by Ang II (10-6 mol/L). Total RNA was collected for Northern blot analysis. PAI-1 expression was compared with that of constitutively expressed CHOB.

Effect of TRO in STZ-Induced Diabetic Rats
To determine whether the functional effect of PPAR activation demonstrated by our in vitro experiments is translated in vivo, STZ-induced diabetic (fasting blood glucose 500 to 650 mg/dL) rats were fed chow or TRO (2 g/kg) plus chow, after the induction of diabetes, for 3 months. Glomerular PPAR expression was increased 4-fold in kidneys from the diabetic animals compared with normal age-matched animal kidneys (Figure 5A). TRO treatment did not increase glomerular PPAR expression over the diabetic levels. In contrast, PAI-1 expression was also increased in glomerular cores taken from the diabetic kidneys compared with control kidneys; TRO attenuated PAI-1 expression to normal levels (Figure 5B). TRO also effectively normalized the urine albumin-to-creatinine ratio in the treated animals (Figure 5C). In this animal model, there was no difference between the TRO-treated and untreated animal groups in blood pressure (104±1.9 [n=7] versus 109±1.8 [n=7] mm Hg, respectively) or glucose (639±29 [n=7] versus 654±17 [n=7] mg/dL, respectively). These results are similar to recently published data.^{22 23}

View larger version (23K): [in this window] [in a new window]   Figure 5. TRO effects in STZ-induced diabetic rats. STZ-induced diabetic rats were fed chow (n=8) or TRO (2 g/kg) plus chow (n=4) for 3 months and compared with age-matched control rats (n=7). PPAR and PAI-1 expression were determined by RPAs using glomerular RNA, and the albumin-to-creatinine ratio was measured. A, Bar graph represents quantitative analysis of at least 3 RPAs of glomerular PPAR expression. Diabetes increases PPAR expression. B, Representative RPA of PAI-1 expression in glomerular RNA is shown. Bar graph represents quantitative analysis of at least 3 experiments. N indicates normal. TRO normalized PAI-1 expression. C, Urine albumin-to-creatinine ratio was determined on 24-hour urine collection from study animals. TRO normalized the urine albumin-to-creatinine ratio compared with that of control animals (n=7). *P<0.5 vs control.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
The present study shows that the TZDs, originally intended as insulin sensitizers, also have a direct effect on MCs, which may contribute in part to their action to reduce and even normalize microalbuminuria. Specifically, we have demonstrated that PPAR1 is expressed in the glomerular fraction of the kidney, is localized to the nuclei of MCs, and could activate a PPRE. TZD activation of MC PPAR inhibited PDGF-stimulated cell growth and Ang II–induced PAI-1 expression, indicating that PPAR is functional in MCs.

Because TZDs are now commonly used oral hypoglycemics in type II diabetes, we were specifically interested in their effects on the microvascular complications of diabetes that may extend beyond glucose control. The process of diabetic nephropathy involves extracellular matrix (ECM) expansion, and to some extent, early mesangial proliferation may contribute to the renal pathology.^{24 25} Therefore, we focused on TZD actions that may affect these mechanisms. Because activation of PPAR has been suggested to inhibit growth in vascular smooth muscle cells, ocular endothelial cells, and cancer cells,^{7 26 27 28} this effect seemed a likely target of TZD action in MCs. Indeed, in vascular smooth muscle cells, TZDs inhibit G₀G₁S phase progression in the cell cycle by inhibition of growth factor–induced downregulation of the cyclin-dependent kinase inhibitor, p27.²⁹ The maintenance of high levels of p27 in vascular smooth muscle cells inhibits cell cycle progression. The mechanism of inhibition of growth in other cell types by TZDs remains to be determined. In STZ-induced diabetic nephropathy, prominent MC proliferation occurs as early as 3 days and is associated with a glomerular macrophage infiltration and an increase in PDGF immunostaining.²⁵ The glomerular cell proliferation persisted throughout the 30 days of the study. It is possible that some of the effects of TZDs in diabetic nephropathy may be the inhibition of cell growth and/or inflammation associated with macrophage infiltration.

Enhanced MC production and decreased metabolism of fibronectin, laminin, and collagens III and IV ultimately restrict glomerular filtering capacity, leading to overt nephropathy, which progresses to end-stage renal disease. Transforming growth factor-ß1 (TGF-ß1), a cytokine, has emerged as a key culprit in the development of glomerulosclerosis.^{30 31 32 33} Overproduction of TGF-ß1 occurs in diabetic glomeruli as a result of hyperglycemia, Ang II, insulin and insulin-like growth factor-1, increased stretch (due to hypertension), and other factors. TGF-ß1 increases the mesangial production of ECM proteins and decreases their metabolism, leading to progressive glomerular ECM accumulation and, ultimately, fibrosis. In cultured MCs, TGF-ß1 and other growth factors (Ang II and insulin) stimulate the synthesis and secretion of plasminogen activation inhibitor 1 (PAI-1) which regulates a cascade of events importantly controlling degradation of ECM.^{34 35} PAI-1 prevents ECM breakdown, inasmuch as monoclonal antibodies against PAI-1 enhance ECM degradation.³⁶

Although we did not see major effects of TZDs on ECM expression, TRO inhibited PAI-1 expression in cultured MCs to which Ang II was added and in glomerular cores of rats made diabetic with STZ. Indeed, PAI-1 expression was upregulated in diabetic glomeruli compared with normal glomeruli, consistent with its potential role to prevent ECM breakdown, leading to ECM accumulation in diabetic nephropathy. The inhibition of PAI-1 expression by TRO treatment was associated with a decrease in albumin excretion in the absence of a change in glucose or blood pressure. Whether the changes in glomerular PAI-1 expression contributed to the normalization of the albumin-to-creatinine ratio remains to be determined, but in a model of renal irradiation fibrosis, inhibition of the renin-angiotensin system decreased both renal PAI-1 expression and interstitial fibrosis.³⁶ Moreover, bleomycin-induced pulmonary fibrosis was substantially attenuated in the PAI-1 knockout mouse.³⁷ Thus, PAI-1 has been implicated as an important profibrotic factor. TRO has been reported to decrease circulating PAI-1 levels in patients with diabetes and with polycystic ovarian disease; in both of these clinical situations, plasma PAI-1 levels and activity are elevated.^{38 39}

The increase in PPAR expression in diabetic glomeruli is of interest and is similar to the upregulation seen in vascular injury.⁷ The endogenous PPAR ligand, PGJ2, is a known potent inhibitor of macrophage inflammatory functions,⁴⁰ and the increase in PPAR in tissue injury may be an attempt to limit cell growth, inflammation, and the injury response.⁴¹ Pharmacological activation of these receptors early after injury may limit disease. The present study shows a direct role for PPAR ligands in reducing microalbuminuria and implies that these agents may have therapeutic implications in the treatment of diabetic nephropathy. TZDs may potentially alter expression of multiple genes involved in diabetic glomerulosclerosis.

	Acknowledgments

 
This work was supported by a grant from the National Institutes of Health, (DK-30254-16 to W.A.H.) and the Howard Hughes Institute (to S.B.N.). The authors thank Maria Shlovsky for her diligence and Ron Law for his generous input.

Received October 26, 2000; first decision December 7, 2000; accepted December 15, 2000.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Dreyer C, Krey G, Keller H, Givel F, Helftenbein G, Wahli W. Control of the peroxisomal b-oxidation pathway by a novel family of nuclear hormone receptors. Cell. 1992;68:879–887.[Medline] [Order article via Infotrieve]

2. Issemann I, Green S. Activation of a member of the steroid hormone receptor superfamily by peroxisome proliferators. Nature. 1990;347:645–650.[Medline] [Order article via Infotrieve]

3. Zhu Y, Qi C, Korenberg JR, Chen XN, Noya D, Rao MD, Reddy JK. Structural organization of mouse peroxisome proliferator-activated receptor (mPPAR) gene: alternative promoter use and different splicing yield two mPPAR isoforms. Proc Natl Acad Sci U S A. 1995;92:7921–7925.[Abstract/Free Full Text]

4. Willson TM, Cobb JE, Cowan DJ, Wiethe RW, Correa ID, Prakash SR, Beck KD, Moore LB, Kliewer SA, Lehmann JM. The structure-activity relationship between peroxisome proliferator-activated receptor gamma agonism and the antihyperglycemic activity of thiazolidinediones. J Med Chem. 1996;39:665–668.[Medline] [Order article via Infotrieve]

5. Jiang C, Ting AT, Seed B. PPAR-gamma agonists inhibit production of monocyte inflammatory cytokines. Nature. 1998;291:82–86.

6. Kintscher U, Goetze S, Wakino S, Kim S, Nagpal S, Chandraratna RAS, Graf K, Fleck E, Hsueh WA, Law RE. Peroxisome proliferator-activated receptor and retinoid X receptor ligands inhibit monocyte chemotactic protein-1-directed migration of monocytes. Eur J Pharmacol. 2000;401:259–270.[Medline] [Order article via Infotrieve]

7. Law RE, Goetze S, Xi X-P, Jackson S, Kawano Y, Demer L, Fishbein MC, Meehan WP, Hsueh WA. Expression and function of PPAR in rat and human vascular smooth muscle cells. Circulation. 2000;101:1311–1318.[Abstract/Free Full Text]

8. Ricote M, Li AC, Willson TM, Delly DJ, Glass CK. The peroxisome proliferator-activated-gamma is a negative regulator of macrophage activation. Nature. 1998;391:79–82.[Medline] [Order article via Infotrieve]

9. Henry RR. Thiazolidinediones. Endocrinol Metab Clin North Am. 1997;26:553–573.[Medline] [Order article via Infotrieve]

10. Saku K, Zhang B, Ohta T, Arakawa K. Troglitazone lowers blood pressure and enhances insulin sensitivity in Watanabe heritable hyperlipidemic rabbits. Am J Hypertens. 1997;10(pt 1):1027–1033.

11. Walker AB, Chattington PD, Buckingham RE, Williams G. The thiazolidinedione rosiglitazone (BRL-49653) lowers blood pressure and protects against impairment of endothelial function in Zucker fatty rats. Diabetes. 1999;48:1448–1453.[Abstract]

12. Imano E, Kanda T, Nakatani Y, Nishida T, Arai K, Motomura M, Kajimoto Y, Yamasaki Y, Hori M. Effect of troglitazone on microalbuminuria in patients with incipient diabetic nephropathy. Diabetes Care. 1998;21:2135–2139.[Abstract]

13. Fujii M, Takemura R, Yamaguchi M, Hasegawa G, Shigeta H, Nakano K, Kondo M. Troglitazone (CS-045) ameliorates albuminuria in streptozotocin-induced diabetic rats. Metabolism. 1997;46:981–983.[Medline] [Order article via Infotrieve]

14. Buckingham RE, Al-Barazanji KA, Toseland CDN, Slaughter M, Connor SC, West A, Bond B, Turner NC, Clapham JC. Peroxisome proliferator-activated receptor- agonist, rosiglitazone, protects against nephropathy and pancreatic islet abnormalities in Zucker fatty rats. Diabetes. 1998;47:1326–1334.[Abstract]

15. Potier M, L’Azou B, Cambar J. Isolated glomeruli and cultured mesangial cells as in vitro models to study immunosuppressive agents. Cell Biol Toxicol. 1996;12:263–270.[Medline] [Order article via Infotrieve]

16. Graves RA, Tontonoz P, Spelgelman BM. Analysis of a tissue-specific enhancer: ARF6 regulates adipogenic gene expression. Mol Cell Biol. 1992;12:1202–1208.[Abstract/Free Full Text]

17. Jaffe M. Uber den Niederschlag, welchen Picrinsaure in normalen Harnerzeugt und uber eine neue Reaction des Kreatinins. Physiol Chem. 1886;10:391.

18. Asano T, Wakisaka M, Yoshinari M, Iiono K, Sonoki K, Iwase M, Fijishima M. Peroxisome proliferator-activated receptor gamma (PPARgamma 1) expresses in rat mesangial cells and PPARgamma agonists modulate its differentiation. Biochim Biophys Acta. 2000;1497:148–154.[Medline] [Order article via Infotrieve]

19. Hart CE, Forstrom J, Kelly JD, Seifert RA, Smith RA, Ross R, Murray MJ, Bowen-Pope DF. Two classes of PDGF receptor recognize different isoforms of PDGF. Science. 1988;240:1529–1531.[Abstract/Free Full Text]

20. Matsui T, Heidaran M, Miki T, Popescu N, La Rochelle W, Kraus M, Pierce J, Aaronson S. Isolation of a novel receptor cDNA establishes the existence of two PDGF receptor genes. Science. 1989;243:800–804.[Abstract/Free Full Text]

21. Galli A, Stewart M, Dorris R, Crabb D. High-level expression of RXR and the presence of endogenous ligands contribute to expression of a peroxisome proliferator-activated receptor-responsive gene in hepatoma cells. Arch Biochem Biophys. 1998;354:288–294.[Medline] [Order article via Infotrieve]

22. Isshiki K, Haneda M, Koya D, Maeda S, Sugimoto T, Kikkawa R. Thiazolidinedione compounds ameliorate glomerular dysfunction independent of their insulin-sensitizing action in diabetic rats. Diabetes. 2000;49:1022–1032.[Abstract]

23. Kato K, Satoh H, Endo Y, Yamada D, Midorikawa S, Sato W, Mizuno K, Fujita T, Tsukamoto K, Watanabe T. Thiazolidinediones down-regulate plasminogen activator inhibitor type 1 expression in human vascular endothelial cells: a possible role for PPARgamma in endothelial function. Biochem Biophys Res Commun. 1999;258:431–435.[Medline] [Order article via Infotrieve]

24. Bennett CM, Hsueh WA. Measurement of renin and interpretation of plasma renin activity. In: Massry S, ed. Textbook of Nephrology. Baltimore, Md: Williams and Wilkins; 1987.

25. Young BA, Johnson RJ, Alpers CE, Eng E, Gordon K, Floege J, Couser WG, Seidel K. Cellular events in the evolution of experimental diabetic nephropathy. Kidney Int. 1995;47:935–944.[Medline] [Order article via Infotrieve]

26. Elstner E, Muller C, Koshizuka K, Williamson EA, Park D, Asou H, Shintaku P, Said JW, Heber D, Koeffler HP. Ligands for peroxisome proliferator-activated receptor gamma and retinoic acid receptor inhibit growth and induce apoptosis of human breast cancer cells in vitro and in BNX mice. Proc Natl Acad Sci U S A. 1998;95:8806–8811.[Abstract/Free Full Text]

27. Mueller E. Effects of ligand activation of peroxisome proliferator-activated receptor gamma in human prostate cancer. Proc Natl Acad Sci U S A. 2000;97:10990–10995.[Abstract/Free Full Text]

28. Murata T, He S, Hangai M, Ishibashim T, Xi XP, Kim S, Hsueh WA, Ryan SJ, Law RE, Hinton DR. Peroxisome proliferator-activated receptor-gamma ligands inhibit choroidal neovascularization. Invest Ophthalmol Vis Sci. 2000;41:2309–2317.[Abstract/Free Full Text]

29. Wakino S, Kintsher U, Kim S, Yin F, Hsueh WA, Law RE. Peroxisome proliferator-activated receptor gamma ligands inhibit retinoblastoma phosphorylation and G1S transition in vascular smooth muscle cells. J Biol Chem. 2000;275:22435–22441.[Abstract/Free Full Text]

30. Anderson PW, Zhang XY, Tian J, Correale JD, Xi XP, Yang D, Graf K, Law RE, Hseuh WA. Insulin and angiotensin II are additive in stimulating TGF-B1 and matrix mRNA in mesangial cells. Kidney Int. 1996;50:745–753.[Medline] [Order article via Infotrieve]

31. Cortes P, Riser RL, Zhao X, Narins RG. Glomerular volume expansion and mesangial cell mechanical strain: mediators of glomerular pressure injury. Kidney Int. 1994;45:S11–S16.

32. Kagami S, Border WA, Miller DE, Noble NA. Angiotensin II stimulates extracellular matrix protein synthesis through induction of transforming growth factor-B expression in rat glomerular mesangial cells. J Clin Invest. 1994;93:2431–2437.

33. Kreisberg JI, Kreisberg SH. High glucose activates protein kinase C and stimulates fibronectin gene expression by enhancing a cAMP response element. Kidney Int. 1995;51(suppl):S3–S11.

34. Kagami S, Kujara T, Okada K, Kuroda Y, Border W, Noble N. Dual effects of angiotensin II on the plasminogen/plasmin system in rat mesangial cells. Kidney Int. 1997;51:664–671.[Medline] [Order article via Infotrieve]

35. Oikawa T, Freeman M, Lo W, Vaughn D, Fogo A. Modulation of plasminogen activator inhibitor-1 in vivo: a new mechanism for the anti-fibrotic effect of renin-angiotensin inhibitor. Kidney Int. 1997;51:164–172.[Medline] [Order article via Infotrieve]

36. Baricos W, Cortez S, El-Dahr S, Schnaper H. ECM degradation by cultured human mesangial cells is mediated by a PA/plasmin/MMP-2 cascade. Kidney Int. 1995;47:1039–1047.[Medline] [Order article via Infotrieve]

37. Eitzman D, McCoy R, Zheng X, Fay W, Shen T, Ginsburg D, Simon R. Bleomycin-induced pulmonary fibrosis in transgenic mice that either lack or overexpress the murine plasminogen activator inhibitor-1 gene. J Clin Invest. 1996;97:232–237.[Medline] [Order article via Infotrieve]

38. Ehrman DA, Schneider DJ, Sobel BE, Cavagghan MK, Imperial J, Rosenfield RL, Polonsky KS. Troglitazone improves defects in insulin action, insulin secretion, ovarian steroidogenesis, and fibrinolysis in women with polycystic ovary syndrome. J Clin Endocrinol Metab. 1997;82:2108–2116.[Abstract/Free Full Text]

39. Kruszynska TT, Yu JG, Olefsky JM, Sobel BE. Effects of troglitazone on blood concentrations of plasminogen activator inhibitor I in patients with type 2 diabetes and in lean and obese normal subjects. Diabetes. 2000;49:633–639.[Abstract]

40. Reilly CM, Oates JC, Cook JA, Morrow JD, Halushka PV, Gilkeson GS. Inhibition of mesangial cell nitric oxide in MRL/lpr mice by prostaglandin J2 and proliferator activation receptor-gamma agonists. J Immunol. 2000;164:1498–1504.[Abstract/Free Full Text]

41. Law RE, Meehan WP, Xi XP, Wuthrich DA, Coats W, Faxon D, Hsueh WA. Troglitazone inhibits vascular smooth muscle cell growth and intimal hyperplasia. J Clin Invest. 1996;98:1897–1905.[Medline] [Order article via Infotrieve]

This article has been cited by other articles:

				H. Zhang, J. Saha, J. Byun, M. Schin, M. Lorenz, R. T. Kennedy, M. Kretzler, E. L. Feldman, S. Pennathur, and F. C. Brosius III Rosiglitazone reduces renal and plasma markers of oxidative injury and reverses urinary metabolite abnormalities in the amelioration of diabetic nephropathy Am J Physiol Renal Physiol, October 1, 2008; 295(4): F1071 - F1081. [Abstract] [Full Text] [PDF]

				X. Ruan, F. Zheng, and Y. Guan PPARs and the kidney in metabolic syndrome Am J Physiol Renal Physiol, May 1, 2008; 294(5): F1032 - F1047. [Abstract] [Full Text] [PDF]

				X. Yu, C. Li, X. Li, and L. Cai Rosiglitazone Prevents Advanced Glycation End Products-Induced Renal Toxicity Likely through Suppression of Plasminogen Activator Inhibitor-1 Toxicol. Sci., April 1, 2007; 96(2): 346 - 356. [Abstract] [Full Text] [PDF]

				J. Weissgarten, S. Berman, S. Efrati, M. Rapoport, Z. Averbukh, and L. Feldman Apoptosis and proliferation of cultured mesangial cells isolated from kidneys of rosiglitazone-treated pregnant diabetic rats Nephrol. Dial. Transplant., May 1, 2006; 21(5): 1198 - 1204. [Abstract] [Full Text] [PDF]

				Y. Li, X. Wen, B. C. Spataro, K. Hu, C. Dai, and Y. Liu Hepatocyte Growth Factor Is a Downstream Effector that Mediates the Antifibrotic Action of Peroxisome Proliferator-Activated Receptor-{gamma} Agonists J. Am. Soc. Nephrol., January 1, 2006; 17(1): 54 - 65. [Abstract] [Full Text] [PDF]

				U. Panchapakesan, S. Sumual, C. A. Pollock, and X. Chen PPAR{gamma} agonists exert antifibrotic effects in renal tubular cells exposed to high glucose Am J Physiol Renal Physiol, November 1, 2005; 289(5): F1153 - F1158. [Abstract] [Full Text] [PDF]

				B. Staels and J.-C. Fruchart Therapeutic Roles of Peroxisome Proliferator-Activated Receptor Agonists Diabetes, August 1, 2005; 54(8): 2460 - 2470. [Abstract] [Full Text] [PDF]

				M. Herrera and J. L. Garvin Recent Advances in the Regulation of Nitric Oxide in the Kidney Hypertension, June 1, 2005; 45(6): 1062 - 1067. [Abstract] [Full Text] [PDF]

				G. Gruden, G. Setti, A. Hayward, D. Sugden, S. Duggan, D. Burt, R. E. Buckingham, L. Gnudi, and G. Viberti Mechanical Stretch Induces Monocyte Chemoattractant Activity via an NF-{kappa}B-Dependent Monocyte Chemoattractant Protein-1-Mediated Pathway in Human Mesangial Cells: Inhibition by Rosiglitazone J. Am. Soc. Nephrol., March 1, 2005; 16(3): 688 - 696. [Abstract] [Full Text] [PDF]

				S. Zafiriou, S. R. Stanners, S. Saad, T. S. Polhill, P. Poronnik, and C. A. Pollock Pioglitazone Inhibits Cell Growth and Reduces Matrix Production in Human Kidney Fibroblasts J. Am. Soc. Nephrol., March 1, 2005; 16(3): 638 - 645. [Abstract] [Full Text] [PDF]

				Y. Guan Peroxisome Proliferator-Activated Receptor Family and Its Relationship to Renal Complications of the Metabolic Syndrome J. Am. Soc. Nephrol., November 1, 2004; 15(11): 2801 - 2815. [Abstract] [Full Text] [PDF]

				U. Panchapakesan, C. A. Pollock, and X. M. Chen The effect of high glucose and PPAR-{gamma} agonists on PPAR-{gamma} expression and function in HK-2 cells Am J Physiol Renal Physiol, September 1, 2004; 287(3): F528 - F534. [Abstract] [Full Text] [PDF]

				P. K. Chatterjee, N. S.A Patel, S. Cuzzocrea, P. A.J Brown, K. N Stewart, H. Mota-Filipe, D. Britti, W. Eberhardt, J. Pfeilschifter, and C. Thiemermann The cyclopentenone prostaglandin 15-deoxy-{Delta}12,14-prostaglandin J2 ameliorates ischemic acute renal failure Cardiovasc Res, February 15, 2004; 61(3): 630 - 643. [Abstract] [Full Text] [PDF]

				B. Guo, D. Koya, M. Isono, T. Sugimoto, A. Kashiwagi, and M. Haneda Peroxisome Proliferator-Activated Receptor-{gamma} Ligands Inhibit TGF-{beta}1-Induced Fibronectin Expression in Glomerular Mesangial Cells Diabetes, January 1, 2004; 53(1): 200 - 208. [Abstract] [Full Text] [PDF]

				A. D. Dobrian, S. D. Schriver, A. A. Khraibi, and R. L. Prewitt Pioglitazone Prevents Hypertension and Reduces Oxidative Stress in Diet-Induced Obesity Hypertension, January 1, 2004; 43(1): 48 - 56. [Abstract] [Full Text] [PDF]

				C. Baylis, E.-A. Atzpodien, G. Freshour, and K. Engels Peroxisome Proliferator-Activated Receptor {gamma} Agonist Provides Superior Renal Protection versus Angiotensin-Converting Enzyme Inhibition in a Rat Model of Type 2 Diabetes with Obesity J. Pharmacol. Exp. Ther., December 1, 2003; 307(3): 854 - 860. [Abstract] [Full Text] [PDF]

				T. Kuncewicz, E. A. Sheta, I. L. Goldknopf, and B. C. Kone Proteomic Analysis of S-Nitrosylated Proteins in Mesangial Cells Mol. Cell. Proteomics, March 1, 2003; 2(3): 156 - 163. [Abstract] [Full Text] [PDF]

				M. Arici, R. Chana, A. Lewington, J. Brown, and N. J. Brunskill Stimulation of Proximal Tubular Cell Apoptosis by Albumin-Bound Fatty Acids Mediated by Peroxisome Proliferator Activated Receptor-{gamma} J. Am. Soc. Nephrol., January 1, 2003; 14(1): 17 - 27. [Abstract] [Full Text] [PDF]

				S.-M. Herrmann, J. Ringel, J.-G. Wang, J. A. Staessen, and E. Brand Peroxisome Proliferator-Activated Receptor-{gamma}2 Polymorphism Pro12Ala Is Associated With Nephropathy in Type 2 Diabetes: The Berlin Diabetes Mellitus (BeDiaM) Study Diabetes, August 1, 2002; 51(8): 2653 - 2657. [Abstract] [Full Text] [PDF]

				K. Scholz-Pedretti, A. Gans, K.-F. Beck, J. Pfeilschifter, and M. Kaszkin Potentiation of TNF-{alpha}-Stimulated Group IIA Phospholipase A2 Expression by Peroxisome Proliferator-Activated Receptor {alpha} Activators in Rat Mesangial Cells J. Am. Soc. Nephrol., March 1, 2002; 13(3): 611 - 620. [Abstract] [Full Text] [PDF]

				S. Arima, K. Kohagura, K. Takeuchi, Y. Taniyama, A. Sugawara, Y. Ikeda, M. Abe, K. Omata, and S. Ito Biphasic Vasodilator Action of Troglitazone on the Renal Microcirculation J. Am. Soc. Nephrol., February 1, 2002; 13(2): 342 - 349. [Abstract] [Full Text] [PDF]

				F. Zheng, A. Fornoni, S. J. Elliot, Y. Guan, M. D. Breyer, L. J. Striker, and G. E. Striker Upregulation of type I collagen by TGF-beta in mesangial cells is blocked by PPARgamma activation Am J Physiol Renal Physiol, April 1, 2002; 282(4): F639 - F648. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Nicholas, S. B. Articles by Hsueh, W. A. Search for Related Content PubMed PubMed Citation Articles by Nicholas, S. B. Articles by Hsueh, W. A. Pubmed/NCBI databases Compound via MeSH Substance via MeSH Related Collections Animal models of human disease Type 2 diabetes