This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Fiebeler, A. Articles by Luft, F. C. Search for Related Content PubMed PubMed Citation Articles by Fiebeler, A. Articles by Luft, F. C. Related Collections Remodeling ACE/Angiotension receptors Hypertrophy Myocardial cardiomyopathy disease Oxidant stress

(Hypertension. 2001;37:787.)
© 2001 American Heart Association, Inc.

Scientific Contributions

Mineralocorticoid Receptor Affects AP-1 and Nuclear Factor-B Activation in Angiotensin II–Induced Cardiac Injury

Anette Fiebeler¹; Folke Schmidt¹; Dominik N. Müller¹; Joon-Keun Park; Ralf Dechend; Markus Bieringer; Erdenechimeg Shagdarsuren; Volker Breu; Hermann Haller; Friedrich C. Luft

From the Franz Volhard Clinic and Max Delbrück Center, Medical Faculty of the Charité, Humboldt University of Berlin, and Department of Medicine-Nephrology, Hoffmann La Roche Inc, Basel, Schwitzerland; and Hannover Medical School, University of Hannover, Germany.

Correspondence to Dr Friedrich C. Luft, Franz Volhard Clinic, Wiltberg Str 50, 13125 Berlin, Germany. E-mail luft{at}fvk-berlin.de

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Aldosterone is implicated in cardiac hypertrophy and fibrosis. We tested the role of the mineralocorticoid receptor in a model of angiotensin II–induced cardiac injury. We administered spironolactone (SPIRO; 20 mg · kg^-1 · d^-1), valsartan (VAL; 10 mg · kg^-1 · d^-1), or vehicle to rats double transgenic for the human renin and angiotensinogen genes (dTGR). We investigated basic fibroblast growth factor (bFGF), platelet-derived growth factor, transforming growth factor-ß₁, and the transcription factors AP-1 and nuclear factor (NF)-B. We used immunohistochemistry, electrophoretic mobility shift assays, and TaqMan RT-PCR. Untreated dTGR developed hypertension, cardiac hypertrophy, vasculopathy, and fibrosis with a 50% mortality rates at 7 weeks. SPIRO and VAL prevented death and reversed cardiac hypertrophy, while only VAL normalized blood pressure. Both drugs prevented vasculopathy. bFGF was markedly upregulated in dTGR, whereas platelet-derived growth factor-B and transforming growth factor-ß₁ were little changed. VAL and SPIRO suppressed this upregulation. Both AP-1 and NF-B were activated in dTGR compared with controls. VAL and SPIRO reduced both transcription factors and reduced bFGF, collagen I, fibronectin, and laminin in the interstitium. These findings show that aldosterone promotes hypertrophy, cardiac remodeling, and fibrosis, independent of blood pressure. The effects involve AP-1, NF-B, and bFGF. Mineralocorticoid receptor blockade downregulates these effectors and reduces angiotensin II–induced cardiac damage.

Key Words: angiotensin • nuclear factors • receptors, mineralocorticoid • spironolactone

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
In a recent study, patients with heart failure after myocardial infarction exhibited a 30% reduced mortality rates with mineralocorticoid receptor blockade compared with control subjects.¹ A direct relationship has been shown between death and serum aldosterone concentrations in heart failure patients.² After myocardial infarction, the renin-angiotensin-aldosterone system contributes to cardiac remodeling; local tissue angiotensin (Ang) II and aldosterone are increased.^{3 4} The effects of aldosterone on the kidney are well recognized; however, less appreciated are the facts that aldosterone also induces collagen, fibronectin, and laminin and contributes directly to fibrosis.^{5 6 7} Vascular smooth muscle and endothelial cells respond to aldosterone with increased ITP, [Ca²⁺]_i, and protein kinase C activity, as well as with ion channel activation. Aldosterone-induced genes include the G protein K-Ras and several serum glucocorticoid kinase proteins.⁸ Furthermore, genes important for cell cycle progression, such as c-myc, c-fos, and c-jun, are upregulated by aldosterone.⁸ Aldosterone-induced cardiac fibrosis can be prevented with spironolactone (SPIRO), as well as with Ang II type 1 receptor (AT₁) blockade.⁹ We investigated the effect of SPIRO in rats harboring the human renin and angiotensinogen genes (dTGR). They produce Ang II locally and develop hypertension and severe end-organ damage.¹⁰

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Four-week-old male dTGR (n=20) and age-matched Sprague-Dawley (SD; n=10) rats were investigated after due approval. The dTGR line and characteristics have been described previously.¹¹ In the treatment groups (15 per group), dTGR rats received drugs for 3 weeks. Either SPIRO (20 mg · kg^-1 · d^-1 IP) or valsartan (VAL) (10 mg · kg^-1 · d^-1 PO) was administered. Immunohistochemical studies were performed as described previously.¹² Antibodies were purchased against monocyte/macrophages (ED-1; Serotec), rabbit anti-mouse IgG (DAKO), collagen I (South Bio ABS), fibronectin (Paesel), bFGF (Transduction Laboratories), and transforming growth factor (TGF)-ß₁ (Santa Cruz). Nuclear extracts, electrophoretic mobility shift assay (EMSA), and supershift assay for nuclear factor (NF)-B and AP-1 were performed according to a protocol described earlier.¹² Briefly, 10 µg total heart homogenates was incubated in binding reaction medium [0.66 µg poly(dI/dC), 1 µg BSA, 1 mmol/L DTT, 20 mmol/L HEPES, pH 8.4, 60 mmol/L KCl, and 8% Ficoll] with 0.5 ng of ³²P-dATP end-labeled oligonucleotide, containing the NF-B–binding site from the MHC enhancer (H2K: 5'-gatcCAGGGCTGGGGATTCCCCATCTCCACAGG)or containing the consensus sequence for AP-1 (Santa Cruz) (5'-GAT CGA ACT GAC CGC CCG CCG CCC GT-3'). In competition assays, 50 ng unlabeled H2K or AP-1 oligonucleotides was used. Nuclear extracts were supershifted with antibodies against the NF-B subunits p50 and p65 and the AP-1 subunits c-fos and c-jun, respectively (all antibodies from Santa Cruz). For RT-PCR, RNA was isolated according to the TRIZOL protocol (Gibco Life Technology). Primers were synthesized (BioTez) for the following sequences: GAPDH, c-fos, basic fibroblast growth factor (bFGF), platelet-derived growth factor (PDGF)-B, TGF-ß₁, and aldosterone synthase. Real-time quantitative RT-PCR was performed with the TaqMan system (PE Biosystems). Forty cycles of PCR were performed according to the EZ-RT-PCR TaqMan kit protocol instructions with Mangan concentrations of 3 µmol/L for GAPDH; 4 µmol/L for PDGF-B, TGF-ß₁, and bFGF; and 2 mmol/L for aldosterone synthase. The sequences were GAPDH-F, AAGCTGGTCATCAATGGGAAAC; GAPDH-R, ACCCCATTTGATGTTAGCGG; GAPDH-P, CATCACCATCTTCCAGGAGCGCGCGAT; bFGF-F, GGAGTTGTGTCCATCAAGGGA; bFGF-R, AGCAGCCGTCCATCTTCCT; bFGF-P, TGTGTGCGAACCGGTACCTGGCT; TGF-ß₁-F, TCCCAAACGTCGAGGTGAC; TGF-ß₁-R, CCATGAGGAGCAGGAAGGG; TGF-ß₁-P: TGGGCACCATCCATGACATGAACC; PDGF-F, TCAGAA-GCGGGCTACTATACCAT; PDGF-R, TTGAATGAGAGCTGGACCTGG; PDGF-P, CGGGCCTTCCATGCGGACG; AldSyn-F, TGTGAGCTGAAGGGAGGAGG; AldSyn-R, GGTCTTGCCAGCCACACAT; AldSyn-P, TGGCAATGGCTCTCAGGGTGACAG; c-fos-F, CCATGATGTTCTCGGGTTTCA; c-fos-R, GCGCTACTGCAGC-GGG; and c-fos-P: CGCGGACTACGAGGCGTCATCC.

Each sample was tested twice. For quantification, the target sequence was normalized in relation to the GAPDH gene. Data are mean±SEM. ANOVA and the Scheffé test were used to test statistically significant differences in mean values.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Nine of 20 vehicle-treated dTGR rats died before the end of week 7; the mortality rate was 45%. In contrast, 1 rat in the SPIRO group and no VAL-treated or SD rats died (P<0.001). The dTGR rats showed an increase in systolic blood pressure between weeks 5 to 7. Blood pressure in SPIRO-treated rats was slightly, but not significantly, lower compared with vehicle-treated dTGR rats (161±11 versus 182±8 mm Hg, P=0.24) at week 7 (Figure 1A). However, the blood pressure of SPIRO-treated rats was significantly higher than SD controls and VAL-treated dTGR rats (161±14 versus 109±2 versus 121±9 mm Hg, P<0.01, respectively; Figure 1A). Heart weight per body weight (Figure 1B) for the various groups were 5.7±0.2 for vehicle-treated dTGR rats, 4.2±0.1 for SPIRO-treated dTGR rats, 3.6±0.1 for VAL-treated dTGR rats, and 3.6±0.1 mg/g for SD rats. Thus, without affecting body weight, SPIRO treatment reduced heart weight (P<0.001), but not as well as did VAL treatment.

View larger version (28K): [in this window] [in a new window]   Figure 1. Systolic blood pressure (A), cardiac index (B), and plasma aldosterone concentrations (C) from vehicle-treated dTGR rats, SPIRO-treated dTGR rats, VAL-treated dTGR rats, and vehicle-treated SD rats. SPIRO had a marginal blood pressure-reducing effect compared with VAL treatment. Cardiac index and plasma aldosterone levels were both reduced by SPIRO and VAL treatment. D, Quantified data for ED-1–positive cell infiltration and amelioration with SPIRO and VAL.

Plasma aldosterone levels were markedly elevated in untreated dTGR rats; the mean value was 15±5 nmol/L compared with 0.7±0.2 nmol/L in the control group. In the treated groups, plasma aldosterone was significantly reduced. The VAL and SPIRO groups had values of 1.6±0.2 and 2.1±1.0 nmol/L, respectively (Figure 1C). No difference in the mRNA expression of aldosterone synthase, the key enzyme for aldosterone production, was detected after blocking the aldosterone receptor. However, blocking the AT₁ receptor suppressed gene expression for aldosterone synthase compared with all other groups. The expression values (arbitrary units) for dTGR, SPIRO, VAL, and SD rats were 12.5±5.5, 14.1±4.3, 0.5±0.2, and 8.0±3.4.

The vehicle-treated dTGR rats developed progressive inflammatory changes in the heart. Immunohistochemical analysis was made for the monocyte/macrophage marker ED-1 (Figure 1D). SPIRO treatment reduced the number of ED-1–positive cells by 34% (P<0.01). VAL treatment reduced the cells by 58% (P<0.0001) compared with vehicle-treated dTGR rats, which was a greater reduction than observed in SPIRO-treated dTGR rats (P<0.05). Interleukin (IL)-6 protein expression was upregulated in vehicle-treated dTGR rats. This upregulation was suppressed by VAL and SPIRO treatment (Figure 2C).

View larger version (96K): [in this window] [in a new window]   Figure 2. Matrix and cytokine protein immunohistochemistry of left ventricle from vehicle-treated dTGR rats, SPIRO-treated dTGR rats, VAL-treated dTGR rats, and SD rats. Collagen I (A), fibronectin (B), and IL-6 (C) were increased in dTGR rats and markedly decreased with both drug treatments.

SPIRO treatment reduced extracellular matrix production. The hearts were stained for collagen I, fibronectin, and laminin. Collagen I (Figure 2A) and fibronectin (Figure 2B) were most prominently deposited around blood vessels, in the vascular adventitia, and focally around fibrotic areas of scarring. Fibronectin was also deposited in the neointima of remodeling vessels. Laminin was localized primarily between the cardiomyocytes (data not shown). All these interstitial deposits were substantially reduced in the SPIRO and VAL treatment groups.

To characterize the role of different growth factors in chronic ischemic remodeling, we analyzed mRNA expression of the growth factors bFGF, PDGF-B, and TGF-ß₁ in the left ventricle. The bFGF expression was significantly increased in vehicle-treated dTGR rats compared with SD rats (Figure 3A). VAL and SPIRO both decreased bFGF expression. Block of the AT₁ receptor lowered bFGF gene expression to control levels; SPIRO reduced these levels by 75%. In contrast, PDGF-B (Figure 3B) and TGF-ß₁ (Figure 3C) expression levels were only modestly, not significantly, increased. Immunohistochemistry for bFGF localized the protein to the neointima and media of arterial blood vessels, as well as to infiltrated cells perivascular and between cardiomyocytes (Figure 3D).

View larger version (93K): [in this window] [in a new window]   Figure 3. Quantitative RT-PCR for bFGF (A), PDGF-B (B), and TGFß1 (C) from the left ventricle. SPIRO and VAL treatment reduced bFGF mRNA. TGFß1 and PDGF-B were little influenced in this model. Immunohistochemistry for bFGF (D) showed that both SPIRO and VAL treatments reduced bFGF expression.

Further characterization of the DNA binding activity and transcription factor gene expression was performed. DNA binding activities for both NF-B (Figure 4A) and AP-1 (Figure 4B) in response to SPIRO treatment were decreased, although activity was more pronounced for AP-1. Correspondingly, c-fos mRNA expression was upregulated in vehicle-treated dTGR rats compared with VAL- and SPIRO-treated animals. Binding specificity was demonstrated through competition of excess unlabeled oligonucleotides containing the B site from the MHC enhancer (H2K) or the AP-1 site (Figure 4C).

View larger version (49K): [in this window] [in a new window]   Figure 4. EMSA for NF-B (A) and AP-1 (B) as well as quantitative RT-PCR for c-fos (C) from left ventricle. Both SPIRO and VAL reduced transcription factor activation. SPIRO was more effective in blocking AP-1, whereas VAL was more effective in blocking NF-B. Binding specificity was demonstrated by competition of excess unlabeled oligonucleotides containing the B site from the MHC enhancer (H2K) or the AP-1 site.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
SPIRO reduced cardiac hypertrophy, inflammation, and matrix production independent of blood pressure and improved survival in dTGR rats compared with controls. Cardiac DNA-binding activities for AP-1 and NF-B were lowered. Blocking the mineralocorticoid receptor resulted in effects similar to blocking the AT₁ receptor. dTGR rats had plasma aldosterone values >10-fold higher than those of SD rats. The adrenal gland was the likely source of the circulating aldosterone; degradation may also have been impaired because of hepatic malfunction. Both SPIRO and VAL lowered the values to normal levels. However, we do not believe that circulating aldosterone is the major mediator of injury nor a mirror of the degree of renin-angiotensin-aldosterone system tissue activation in this model. Silvestre et al¹³ showed the control of plasma and cardiac aldosterone levels to be regulated independently and showed a 17-fold higher aldosterone concentration in myocardium than in plasma of rodents. We did not measure myocardial aldosterone concentrations. However, in the hearts of our dTGR rats, aldosterone synthase mRNA was upregulated, consistent with local production. SPIRO had no measurable effect on the gene expression of the enzyme. Instead, we observed a marked decrease in aldosterone synthase mRNA in VAL-treated dTGR rats. SPIRO-treated rats had lower aldosterone levels than dTGR rats. We believe that this effect was probably related to organ protection. SPIRO-treated animals had normal renal function and no hepatic damage.

Silvestre et al³ found that after myocardial infarction, rats showed aldosterone synthase upregulation, aldosterone production, and collagen deposition. In their model, aldosterone synthase upregulation was abolished by AT₁ receptor blockade, whereas both mineralocorticoid receptor and AT₁ receptor blockade ameliorated fibrosis. Their findings, as well as our own, are consistent with earlier observations that aldosterone is largely responsible for cardiac matrix protein production via a direct effect on the mineralocorticoid receptor.¹⁴ Robert et al⁹ and Sun and Weber¹⁵ recently showed that the cardiac AT₁ receptor was upregulated in DOCA-salt rats, an effect blocked by SPIRO treatment. We have observed a trend, although not significant, for AT₁ receptor downregulation in SPIRO-treated dTGR rats (data not shown). Thus, we do not believe that a downregulation of AT₁ receptor expression was the main mechanism of mediating SPIRO-related effects.

The effects of Ang II and aldosterone on cardiovascular remodeling are not the same. Campbell et al⁷ found less cardiac inflammation and necrosis in a high aldosterone model compared with Ang II infusion, suggesting different mechanisms. Rocha et al¹⁶ observed ACE inhibitor–mediated protection from fibrotic end-organ damage in salt-fed stroke-prone spontaneously hypertensive rats. Concomitant aldosterone infusion reversed this protective effect blood pressure independently. These results indicate a direct and distinct profibrotic effect of aldosterone. Benetos et al¹⁷ investigated ACE inhibition and SPIRO treatment in spontaneously hypertensive rats. SPIRO primarily prevented collagen accumulation and, similar to our findings, did so independent of blood pressure reduction. A modest nonsignificant blood pressure reduction occurred that may have had some effect. However, such a reduction cannot account for the effects that we observed. Further evidence for a mineralocorticoid receptor–mediated role comes from the mineralocorticoid-resistant Wistar-Furth rat.¹⁸ When subjected to 5/6 nephrectomy, these rats exhibited far less sclerosis than did Wistar rats. Together, these results underscore the role of the mineralocorticoid receptor in mediation of end-organ damage.

We focused on both AP-1 and NF-B in our model. We speculate that AP-1 is activated via the mitogen-activated protein kinase/ERK cascade that we found to be activated in dTGR rats in an earlier study.¹⁹ NF-B, on the other hand, is probably activated by the Ang II–dependent generation of reactive oxygen species.¹¹ Tharaux et al²⁰ recently showed that the Ang II–related effect on the collagen I gene was mediated via AP-1 and not NF-B. Their results suggest that these transcription factors are regulated by independent mechanisms. We observed earlier that Ang II activates both transcription factor pathways in this model via the AT₁ receptor. New is our observation that the mineralocorticoid receptor has an effect on the activation of both transcription factors. However, AP-1 activity was markedly reduced, whereas NF-B activity was only moderately affected by SPIRO compared with VAL treatment. The effect on NF-B is in line with the fact that VAL reduced inflammatory response more effectively than did SPIRO. Our comments are based on comparisons of in vitro and in vivo experiments. Such experiments may not invariably lead to the same results. We believe that our in vivo studies may be more germane.

bFGF, with a 40-fold higher gene expression in untreated dTGR rats compared with controls, may be important to the inflammation we observed. IL-6 production is markedly increased in dTGR rats (data not shown), which may be related to induction by bFGF.²¹ In cardiac myocytes, bFGF is a ligand for FGF-R2 and induces tyrosine phosphorylation and mitogen-activated protein kinase activation.²² Mice that lack the bFGF gene exhibit thrombocytosis, decreased blood pressure, and decreased vascular smooth muscle cell tone.²³ Such mice also develop less aortic hypertrophy after aortic banding and had a reduced cardiomyocyte cross-sectional area compared with wild-type mice, suggesting a mediator role for bFGF.²⁴ Fibroblasts and infiltrating inflammatory cells can both produce bFGF. Klauber et al²⁵ demonstrated that SPIRO treatment inhibited angiogenesis in vivo through the suppression of bFGF, indicating a mineralocorticoid receptor–mediated effect.

PDGF-B and TGFb₁ signaling is involved in remodeling after ischemic injury. PDGF-B binds to PDGF-B receptor tyrosine kinase. The consensus sequences in the PDGF-B promoter contain AP-1 and NF-B regulatory elements.²⁶ Ang II induces PDGF-B in vascular smooth muscle.²⁷ In vivo ligand and receptor are localized in the vascular neointima during vascular repair, which may explain the modestly increased PDGF-B expression we observed during the disease process in our model.²⁸ TGFß₁ signaling is involved in remodeling after myocardial ischemia.²⁹ We were surprised to find no significant differences in the TGFß₁ gene or protein expression pattern in our model. However, we did not characterize negative regulating effector molecules, such as decorin, which may have affected TGFß₁ signaling in the hearts of our dTGR rats. Our model exhibited increased collagen, laminin, and fibronectin in the interstitium and perivascular areas. Both SPIRO and VAL were effective in minimizing fibrosis and production of extracellular matrix. The genes for these extracellular matrix proteins possess both AP-1– and NF-B–binding sites.^{30 31 32}

In summary, we demonstrated an important role for aldosterone in mediation of Ang II–induced cardiac damage. Mineralocorticoid receptor blockade with SPIRO ameliorated death, cardiac hypertrophy, inflammation, and extracellular matrix production. Inhibition of AP-1 was more pronounced than effects on NF-B activation, which corresponded to more prominent effects on matrix deposition and less prominent effects on inflammation. These findings suggest mechanisms by which mineralocorticoid receptor blockade may improve clinical outcomes. Future studies must address how mineralocorticoid receptor signaling functions in vascular cells and which proteins are involved in early and late aldosterone response.

	Acknowledgments

 
This work was supported by grants-in-aid from CAMMRAR, Hoffmann La Roche (Basel, Switzerland), Klinisch-Pharmakologischer Verbund (Berlin-Brandenburg, Germany), and Bundesministerium für Bildung und Forschung (Bonn, Germany). Karin Dressler, Mathilde Schmidt, and Christel Lipka provided expert technical assistance.

	Footnotes

 
¹ These authors contributed equally to this work.

Received October 25, 2000; first decision December 4, 2000; accepted December 14, 2000.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Pitt B, Zannad F, Remme WJ, Cody R, Castaigne A, Perez A, Palensky J, Wittes J. The effect of spironolactone on morbidity and mortality in patients with severe heart failure. Randomized Aldactone Evaluation Study Investigators. N Engl J Med. 1999;341:709–717.[Abstract/Free Full Text]

2. Swedberg K, Eneroth P, Kjekshus J, Snapinn S. Effects of enalapril and neuroendocrine activation on prognosis in severe congestive heart failure (follow-up of the CONSENSUS trial). CONSENSUS Trial Study Group. Am J Cardiol. 1990;66:40D–44D.[Medline] [Order article via Infotrieve]

3. Silvestre JS, Heymes C, Oubenaissa A, Robert V, Aupetit-Faisant B, Carayon A, Swynghedauw B, Delcayre C. Activation of cardiac aldosterone production in rat myocardial infarction: effect of angiotensin II receptor blockade and role in cardiac fibrosis. Circulation. 1999;99:2694–2701.[Abstract/Free Full Text]

4. Delcayre C, Silvestre JS, Garnier A, Oubenaissa A, Cailmail S, Tatara E, Swynghedauw B, Robert V. Cardiac aldosterone production and ventricular remodeling. Kidney Int. 2000;57:1346–1351.[Medline] [Order article via Infotrieve]

5. Ikeda U, Hyman R, Smith TW, Medford RM. Aldosterone-mediated regulation of Na⁺,K⁺-ATPase gene expression in adult and neonatal rat cardiocytes. J Biol Chem. 1991;266:12058–12066.[Abstract/Free Full Text]

6. Brilla CG, Pick R, Tan LB, Janicki JS, Weber KT. Remodeling of the rat right and left ventricles in experimental hypertension. Circ Res. 1990;67:1355–1364.[Abstract/Free Full Text]

7. Campbell SE, Janicki JS, Weber KT. Temporal differences in fibroblast proliferation and phenotype expression in response to chronic administration of angiotensin II or aldosterone. J Mol Cell Cardiol. 1995;27:1545–1560.[Medline] [Order article via Infotrieve]

8. Verrey F, Pearce D, Pfeiffer R, Spindler B, Mastroberardino L, Summa V, Zecevic M. Pleiotropic action of aldosterone in epithelia mediated by transcription and post-transcription mechanisms. Kidney Int. 2000;57:1277–1282.[Medline] [Order article via Infotrieve]

9. Robert V, Heymes C, Silvestre JS, Sabri A, Swynghedauw B, Delcayre C. Angiotensin AT₁ receptor subtype as a cardiac target of aldosterone: role in aldosterone-salt-induced fibrosis. Hypertension. 1999;33:981–986.[Abstract/Free Full Text]

10. Luft FC, Mervaala E, Muller DN, Gross V, Schmidt F, Park JK, Schmitz C, Lippoldt A, Breu V, Dechend R, Dragun D, Schneider W, Ganten D, Haller H. Hypertension-induced end-organ damage: a new transgenic approach to an old problem. Hypertension. 1999;33:212–218.[Abstract/Free Full Text]

11. Muller DN, Dechend R, Mervaala EM, Park JK, Schmidt F, Fiebeler A, Theuer J, Breu V, Ganten D, Haller H, Luft FC. NF-B inhibition ameliorates angiotensin II–induced inflammatory damage in rats. Hypertension. 2000;35:193–201.[Abstract/Free Full Text]

12. Muller DN, Mervaala EM, Dechend R, Fiebeler A, Park JK, Schmidt F, Theuer J, Breu V, Mackman N, Luther T, Schneider W, Gulba D, Ganten D, Haller H, Luft FC. Angiotensin II (AT₁) receptor blockade reduces vascular tissue factor in angiotensin II-induced cardiac vasculopathy. Am J Pathol. 2000;157:111–122.[Abstract/Free Full Text]

13. Silvestre JS, Robert V, Heymes C, Aupetit-Faisant B, Mouas C, Moalic JM, Swynghedauw B, Delcayre C. Myocardial production of aldosterone and corticosterone in the rat: physiological regulation. J Biol Chem. 1998;273:4883–4891.[Abstract/Free Full Text]

14. Brilla CG, Rupp H, Funck R, Maisch B. The renin-angiotensin-aldosterone system and myocardial collagen matrix remodelling in congestive heart failure. Eur Heart J. 1995;16(suppl O):107–109.

15. Sun Y, Weber KT. Angiotensin II and aldosterone receptor binding in rat heart and kidney: response to chronic angiotensin II or aldosterone administration. J Lab Clin Med. 1993;122:404–411.[Medline] [Order article via Infotrieve]

16. Rocha R, Chander PN, Zuckerman A, Stier CT Jr. Role of aldosterone in renal vascular injury in stroke-prone hypertensive rats. Hypertension. 1999;33:232–237.[Abstract/Free Full Text]

17. Benetos A, Lacolley P, Safar ME. Prevention of aortic fibrosis by spironolactone in spontaneously hypertensive rats. Arterioscler Thromb Vasc Biol. 1997;17:1152–1156.[Abstract/Free Full Text]

18. Fitzgibbon WR, Greene EL, Grewal JS, Hutchison FN, Self SE, Latten SY, Ullian ME. Resistance to remnant nephropathy in the Wistar-Furth rat. J Am Soc Nephrol. 1999;10:814–821.[Abstract/Free Full Text]

19. Park JK, Muller DN, Mervaala EM, Dechend R, Fiebeler A, Schmidt F, Bieringer M, Schafer O, Lindschau C, Schneider W, Ganten D, Luft FC, Haller H. Cerivastatin prevents angiotensin II-induced renal injury independent of blood pressure- and cholesterol-lowering effects. Kidney Int. 2000;58:1420–1430.[Medline] [Order article via Infotrieve]

20. Tharaux PL, Chatziantoniou C, Fakhouri F, Dussaule JC. Angiotensin II activates collagen I gene through a mechanism involving the MAP/ER kinase pathway. Hypertension. 2000;36:330–336.[Abstract/Free Full Text]

21. Kozawa O, Suzuki A, Uematsu T. Basic fibroblast growth factor induces interleukin-6 synthesis in osteoblasts: autoregulation by protein kinase C. Cell Signal. 1997;9:463–468.[Medline] [Order article via Infotrieve]

22. Bogoyevitch MA, Glennon PE, Andersson MB, Clerk A, Lazou A, Marshall CJ, Parker PJ, Sugden PH. Endothelin-1 and fibroblast growth factors stimulate the mitogen- activated protein kinase signaling cascade in cardiac myocytes: the potential role of the cascade in the integration of two signaling pathways leading to myocyte hypertrophy. J Biol Chem. 1994;269:1110–1119.[Abstract/Free Full Text]

23. Zhou M, Sutliff RL, Paul RJ, Lorenz JN, Hoying JB, Haudenschild CC, Yin M, Coffin JD, Kong L, Kranias EG, Luo W, Boivin GP, Duffy JJ, Pawlowski SA, Doetschman T. Fibroblast growth factor 2 control of vascular tone. Nat Med. 1998;4:201–207.[Medline] [Order article via Infotrieve]

24. Schultz JE, Witt SA, Nieman ML, Reiser PJ, Engle SJ, Zhou M, Pawlowski SA, Lorenz JN, Kimball TR, Doetschman T. Fibroblast growth factor-2 mediates pressure-induced hypertrophic response. J Clin Invest. 1999;104:709–719.[Medline] [Order article via Infotrieve]

25. Klauber N, Browne F, Anand-Apte B, D’Amato RJ. New activity of spironolactone: inhibition of angiogenesis in vitro and in vivo. Circulation. 1996;94:2566–2571.[Abstract/Free Full Text]

26. Khachigian LM, Resnick N, Gimbrone MA Jr, Collins T. Nuclear factor-kappa B interacts functionally with the platelet-derived growth factor B-chain shear-stress response element in vascular endothelial cells exposed to fluid shear stress. J Clin Invest. 1995;96:1169–1175.

27. Deguchi J, Makuuchi M, Nakaoka T, Collins T, Takuwa Y. Angiotensin II stimulates platelet-derived growth factor-B chain expression in newborn rat vascular smooth muscle cells and neointimal cells through Ras, extracellular signal-regulated protein kinase, and c-Jun N-terminal protein kinase mechanisms. Circ Res. 1999;85:565–574.[Abstract/Free Full Text]

28. Majesky MW, Reidy MA, Bowen-Pope DF, Hart CE, Wilcox JN, Schwartz SM. PDGF ligand and receptor gene expression during repair of arterial injury. J Cell Biol. 1990;111:2149–2158.[Abstract/Free Full Text]

29. Hao J, Ju H, Zhao S, Junaid A, Scammell-La Fleur T, Dixon IM. Elevation of expression of Smads 2, 3, and 4, decorin and TGF-beta in the chronic phase of myocardial infarct scar healing. J Mol Cell Cardiol. 1999;31:667–678.[Medline] [Order article via Infotrieve]

30. Matsui T. Differential activation of the murine laminin B1 gene promoter by RAR alpha, ROR alpha, and AP-1. Biochem Biophys Res Commun. 1996;220:405–410.[Medline] [Order article via Infotrieve]

31. Tamura K, Nyui N, Tamura N, Fujita T, Kihara M, Toya Y, Takasaki I, Takagi N, Ishii M, Oda K, Horiuchi M, Umemura S. Mechanism of angiotensin II-mediated regulation of fibronectin gene in rat vascular smooth muscle cells. J Biol Chem. 1998;273:26487–26496.[Abstract/Free Full Text]

32. Chung KY, Agarwal A, Uitto J, Mauviel A. An AP-1 binding sequence is essential for regulation of the human alpha2(I) collagen (COL1A2) promoter activity by transforming growth factor-beta. J Biol Chem. 1996;271:3272–3278.[Abstract/Free Full Text]

This article has been cited by other articles:

				E. Ritz and A. Tomaschitz Aldosterone, a vasculotoxic agent--novel functions for an old hormone Nephrol. Dial. Transplant., May 27, 2009; (2009) gfp206v1. [Full Text] [PDF]

				J. M. Luther, Z. Wang, J. Ma, N. Makhanova, H.-S. Kim, and N. J. Brown Endogenous Aldosterone Contributes to Acute Angiotensin II-Stimulated Plasminogen Activator Inhibitor-1 and Preproendothelin-1 Expression in Heart But Not Aorta Endocrinology, May 1, 2009; 150(5): 2229 - 2236. [Abstract] [Full Text] [PDF]

				D. Ai, W. Pang, N. Li, M. Xu, P. D. Jones, J. Yang, Y. Zhang, N. Chiamvimonvat, J. Y.-J. Shyy, B. D. Hammock, et al. Soluble epoxide hydrolase plays an essential role in angiotensin II-induced cardiac hypertrophy PNAS, January 13, 2009; 106(2): 564 - 569. [Abstract] [Full Text] [PDF]

				A. Di Zhang, A. N. D. Cat, C. Soukaseum, B. Escoubet, A. Cherfa, S. Messaoudi, C. Delcayre, J.-L. Samuel, and F. Jaisser Cross-Talk Between Mineralocorticoid and Angiotensin II Signaling for Cardiac Remodeling Hypertension, December 1, 2008; 52(6): 1060 - 1067. [Abstract] [Full Text] [PDF]

				M. Caprio, B. G. Newfell, A. la Sala, W. Baur, A. Fabbri, G. Rosano, M. E. Mendelsohn, and I. Z. Jaffe Functional Mineralocorticoid Receptors in Human Vascular Endothelial Cells Regulate Intercellular Adhesion Molecule-1 Expression and Promote Leukocyte Adhesion Circ. Res., June 6, 2008; 102(11): 1359 - 1367. [Abstract] [Full Text] [PDF]

				G. A. Molnar, C. Lindschau, G. Dubrovska, P. R. Mertens, T. Kirsch, M. Quinkler, M. Gollasch, S. Wresche, F. C. Luft, D. N. Muller, et al. Glucocorticoid-Related Signaling Effects in Vascular Smooth Muscle Cells Hypertension, May 1, 2008; 51(5): 1372 - 1378. [Abstract] [Full Text] [PDF]

				J. M. C. Connell, S. M. MacKenzie, E. M. Freel, R. Fraser, and E. Davies A Lifetime of Aldosterone Excess: Long-Term Consequences of Altered Regulation of Aldosterone Production for Cardiovascular Function Endocr. Rev., April 1, 2008; 29(2): 133 - 154. [Abstract] [Full Text] [PDF]

				C. Grossmann, R. Freudinger, S. Mildenberger, B. Husse, and M. Gekle EF Domains Are Sufficient for Nongenomic Mineralocorticoid Receptor Actions J. Biol. Chem., March 14, 2008; 283(11): 7109 - 7116. [Abstract] [Full Text] [PDF]

				E. L. Schiffrin New Twist to the Role of the Renin-Angiotensin System in Heart Failure: Aldosterone Upregulates Renin-Angiotensin System Components in the Brain Hypertension, March 1, 2008; 51(3): 622 - 623. [Full Text] [PDF]

				C. F.H. Mueller and G. Nickenig Angiotensin II: One Driving Force Behind Atherogenesis Hypertension, February 1, 2008; 51(2): 175 - 176. [Full Text] [PDF]

				N. J. Brown Aldosterone and Vascular Inflammation Hypertension, February 1, 2008; 51(2): 161 - 167. [Full Text] [PDF]

				C. Savoia, R. M. Touyz, F. Amiri, and E. L. Schiffrin Selective Mineralocorticoid Receptor Blocker Eplerenone Reduces Resistance Artery Stiffness in Hypertensive Patients Hypertension, February 1, 2008; 51(2): 432 - 439. [Abstract] [Full Text] [PDF]

				S. A. Cooper, A. Whaley-Connell, J. Habibi, Y. Wei, G. Lastra, C. Manrique, S. Stas, and J. R. Sowers Renin-angiotensin-aldosterone system and oxidative stress in cardiovascular insulin resistance Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2009 - H2023. [Abstract] [Full Text] [PDF]

				N. K. LeBrasseur, T.-A. S. Duhaney, D. S. De Silva, L. Cui, P. C. Ip, L. Joseph, and F. Sam Effects of Fenofibrate on Cardiac Remodeling in Aldosterone-Induced Hypertension Hypertension, September 1, 2007; 50(3): 489 - 496. [Abstract] [Full Text] [PDF]

				S. Stas, A. Whaley-Connell, J. Habibi, L. Appesh, M. R. Hayden, P. R. Karuparthi, M. Qazi, E. M. Morris, S. A. Cooper, C. D. Link, et al. Mineralocorticoid Receptor Blockade Attenuates Chronic Overexpression of the Renin-Angiotensin-Aldosterone System Stimulation of Reduced Nicotinamide Adenine Dinucleotide Phosphate Oxidase and Cardiac Remodeling Endocrinology, August 1, 2007; 148(8): 3773 - 3780. [Abstract] [Full Text] [PDF]

				J. M. Mejia-Vilet, V. Ramirez, C. Cruz, N. Uribe, G. Gamba, and N. A. Bobadilla Renal ischemia-reperfusion injury is prevented by the mineralocorticoid receptor blocker spironolactone Am J Physiol Renal Physiol, July 1, 2007; 293(1): F78 - F86. [Abstract] [Full Text] [PDF]

				J. Perez-Rojas, J. A. Blanco, C. Cruz, J. Trujillo, V. S. Vaidya, N. Uribe, J. V. Bonventre, G. Gamba, and N. A. Bobadilla Mineralocorticoid receptor blockade confers renoprotection in preexisting chronic cyclosporine nephrotoxicity Am J Physiol Renal Physiol, January 1, 2007; 292(1): F131 - F139. [Abstract] [Full Text] [PDF]

				J. M. Luther, J. V. Gainer, L. J. Murphey, C. Yu, D. E. Vaughan, J. D. Morrow, and N. J. Brown Angiotensin II Induces Interleukin-6 in Humans Through a Mineralocorticoid Receptor-Dependent Mechanism Hypertension, December 1, 2006; 48(6): 1050 - 1057. [Abstract] [Full Text] [PDF]

				J. Chen and J. L. Mehta Angiotensin II-mediated oxidative stress and procollagen-1 expression in cardiac fibroblasts: blockade by pravastatin and pioglitazone Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1738 - H1745. [Abstract] [Full Text] [PDF]

				S. Johar, A. C. Cave, A. Narayanapanicker, D. J. Grieve, and A. M. Shah Aldosterone mediates angiotensin II-induced interstitial cardiac fibrosis via a Nox2-containing NADPH oxidase FASEB J, July 1, 2006; 20(9): 1546 - 1548. [Abstract] [Full Text] [PDF]

				S.-Y. Han, C.-H. Kim, H.-S. Kim, Y.-H. Jee, H.-K. Song, M.-H. Lee, K.-H. Han, H.-K. Kim, Y.-S. Kang, J.-Y. Han, et al. Spironolactone Prevents Diabetic Nephropathy through an Anti-Inflammatory Mechanism in Type 2 Diabetic Rats J. Am. Soc. Nephrol., May 1, 2006; 17(5): 1362 - 1372. [Abstract] [Full Text] [PDF]

				N. Kobayashi, K. Yoshida, S. Nakano, T. Ohno, T. Honda, Y. Tsubokou, and H. Matsuoka Cardioprotective Mechanisms of Eplerenone on Cardiac Performance and Remodeling in Failing Rat Hearts Hypertension, April 1, 2006; 47(4): 671 - 679. [Abstract] [Full Text] [PDF]

				E. L. Schiffrin Effects of Aldosterone on the Vasculature Hypertension, March 1, 2006; 47(3): 312 - 318. [Full Text] [PDF]

				D. Susic, J. Varagic, J. Ahn, L. C. Matavelli, and E. D. Frohlich Beneficial Cardiovascular Actions of Eplerenone in the Spontaneously Hypertensive Rat Journal of Cardiovascular Pharmacology and Therapeutics, July 1, 2005; 10(3): 197 - 203. [Abstract] [PDF]

				D. Schneiders, J. Heger, P. Best, H. Michael Piper, and G. Taimor SMAD proteins are involved in apoptosis induction in ventricular cardiomyocytes Cardiovasc Res, July 1, 2005; 67(1): 87 - 96. [Abstract] [Full Text] [PDF]

				A. Fiebeler, J. Nussberger, E. Shagdarsuren, S. Rong, G. Hilfenhaus, N. Al-Saadi, R. Dechend, M. Wellner, S. Meiners, C. Maser-Gluth, et al. Aldosterone Synthase Inhibitor Ameliorates Angiotensin II-Induced Organ Damage Circulation, June 14, 2005; 111(23): 3087 - 3094. [Abstract] [Full Text] [PDF]

				M. Gonzalez, L. Lobos, F. Castillo, L. Galleguillos, N. C. Lopez, and L. Michea High-Salt Diet Inhibits Expression of Angiotensin Type 2 Receptor in Resistance Arteries Hypertension, May 1, 2005; 45(5): 853 - 859. [Abstract] [Full Text] [PDF]

				B. C. Blaxall, J. M. Miano, and B. C. Berk Angiotensin II: A Devious Activator of Mineralocorticoid Receptor-Dependent Gene Expression Circ. Res., April 1, 2005; 96(6): 610 - 611. [Full Text] [PDF]

				J. Lebowitz, R. S. Edinger, B. An, C. J. Perry, S. Onate, T. R. Kleyman, and J. P. Johnson I{kappa}B Kinase-{beta} (IKK{beta}) Modulation of Epithelial Sodium Channel Activity J. Biol. Chem., October 1, 2004; 279(40): 41985 - 41990. [Abstract] [Full Text] [PDF]

				E. Kardami, Z.-S. Jiang, S. K Jimenez, C. J Hirst, F. Sheikh, P. Zahradka, and P. A Cattini Fibroblast growth factor 2 isoforms and cardiac hypertrophy Cardiovasc Res, August 15, 2004; 63(3): 458 - 466. [Abstract] [Full Text] [PDF]

				I. Mazak, A. Fiebeler, D. N. Muller, J.-K. Park, E. Shagdarsuren, C. Lindschau, R. Dechend, C. Viedt, B. Pilz, H. Haller, et al. Aldosterone Potentiates Angiotensin II-Induced Signaling in Vascular Smooth Muscle Cells Circulation, June 8, 2004; 109(22): 2792 - 2800. [Abstract] [Full Text] [PDF]

				C. Grossmann, R. Freudinger, S. Mildenberger, A. W. Krug, and M. Gekle Evidence for epidermal growth factor receptor as negative-feedback control in aldosterone-induced Na+ reabsorption Am J Physiol Renal Physiol, June 1, 2004; 286(6): F1226 - F1231. [Abstract] [Full Text] [PDF]

				K. T. Weber From Inflammation to Fibrosis: A Stiff Stretch of Highway Hypertension, April 1, 2004; 43(4): 716 - 719. [Full Text] [PDF]

				N. Tsybouleva, L. Zhang, S. Chen, R. Patel, S. Lutucuta, S. Nemoto, G. DeFreitas, M. Entman, B. A. Carabello, R. Roberts, et al. Aldosterone, Through Novel Signaling Proteins, Is a Fundamental Molecular Bridge Between the Genetic Defect and the Cardiac Phenotype of Hypertrophic Cardiomyopathy Circulation, March 16, 2004; 109(10): 1284 - 1291. [Abstract] [Full Text] [PDF]

				F. K Shieh, E. Kotlyar, and F. Sam Aldosterone and cardiovascular remodelling: focus on myocardial failure Journal of Renin-Angiotensin-Aldosterone System, March 1, 2004; 5(1): 3 - 13. [Abstract] [PDF]

				A. D Struthers and T. M MacDonald Review of aldosterone- and angiotensin II-induced target organ damage and prevention Cardiovasc Res, March 1, 2004; 61(4): 663 - 670. [Abstract] [Full Text] [PDF]

				T.R. Uhrenholt, J. Schjerning, P.B. Hansen, R. Norregaard, B.L. Jensen, G.L. Sorensen, and O. Skott Rapid Inhibition of Vasoconstriction in Renal Afferent Arterioles by Aldosterone Circ. Res., December 12, 2003; 93(12): 1258 - 1266. [Abstract] [Full Text] [PDF]

				D. Fraccarollo, P. Galuppo, S. Hildemann, M. Christ, G. Ertl, and J. Bauersachs Additive improvement of left ventricular remodeling and neurohormonal activation by aldosterone receptor blockade with eplerenone and ACE inhibition in rats with myocardial infarction J. Am. Coll. Cardiol., November 5, 2003; 42(9): 1666 - 1673. [Abstract] [Full Text] [PDF]

				A. W. Krug, C. Grossmann, C. Schuster, R. Freudinger, S. Mildenberger, M. V. Govindan, and M. Gekle Aldosterone Stimulates Epidermal Growth Factor Receptor Expression J. Biol. Chem., October 31, 2003; 278(44): 43060 - 43066. [Abstract] [Full Text] [PDF]

				K. T Weber, Yao Sun, L. A Wodi, A. Munir, E. Jahangir, R. A Ahokas, I. C Gerling, A. E Postlethwaite, and K. J Warrington Toward a broader understanding of aldosterone in congestive heart failure Journal of Renin-Angiotensin-Aldosterone System, September 1, 2003; 4(3): 155 - 163. [Abstract] [PDF]

				M. Young and J. Funder Mineralocorticoid Action and Sodium-Hydrogen Exchange: Studies in Experimental Cardiac Fibrosis Endocrinology, September 1, 2003; 144(9): 3848 - 3851. [Abstract] [Full Text] [PDF]

				P. N. Chander, R. Rocha, J. Ranaudo, G. Singh, A. Zuckerman, and C. T. Stier Jr. Aldosterone Plays a Pivotal Role in the Pathogenesis of Thrombotic Microangiopathy in SHRSP J. Am. Soc. Nephrol., August 1, 2003; 14(8): 1990 - 1997. [Abstract] [Full Text] [PDF]

				T.-Y. Chun, L. J. Bloem, and J. H. Pratt Aldosterone Inhibits Inducible Nitric Oxide Synthase in Neonatal Rat Cardiomyocytes Endocrinology, May 1, 2003; 144(5): 1712 - 1717. [Abstract] [Full Text] [PDF]

				R. Rocha, C. L. Martin-Berger, P. Yang, R. Scherrer, J. Delyani, and E. McMahon Selective Aldosterone Blockade Prevents Angiotensin II/Salt-Induced Vascular Inflammation in the Rat Heart Endocrinology, December 1, 2002; 143(12): 4828 - 4836. [Abstract] [Full Text] [PDF]

				D. N. Muller, A. Mullally, R. Dechend, J.-K. Park, A. Fiebeler, B. Pilz, B.-M. Loffler, D. Blum-Kaelin, S. Masur, H. Dehmlow, et al. Endothelin-Converting Enzyme Inhibition Ameliorates Angiotensin II-Induced Cardiac Damage Hypertension, December 1, 2002; 40(6): 840 - 846. [Abstract] [Full Text] [PDF]

				A. Virdis, M. F. Neves, F. Amiri, E. Viel, R. M. Touyz, and E. L. Schiffrin Spironolactone Improves Angiotensin-Induced Vascular Changes and Oxidative Stress Hypertension, October 1, 2002; 40(4): 504 - 510. [Abstract] [Full Text] [PDF]

				E. Kaergel, D. N. Muller, H. Honeck, J. Theuer, E. Shagdarsuren, A. Mullally, F. C. Luft, and W.-H. Schunck P450-Dependent Arachidonic Acid Metabolism and Angiotensin II-Induced Renal Damage Hypertension, September 1, 2002; 40(3): 273 - 279. [Abstract] [Full Text] [PDF]

				A. Goette, U. Lendeckel, and H. U Klein Signal transduction systems and atrial fibrillation Cardiovasc Res, May 1, 2002; 54(2): 247 - 258. [Abstract] [Full Text] [PDF]

				Y. Takeda, T. Yoneda, M. Demura, M. Usukura, and H. Mabuchi Calcineurin Inhibition Attenuates Mineralocorticoid-Induced Cardiac Hypertrophy Circulation, February 12, 2002; 105(6): 677 - 679. [Abstract] [Full Text] [PDF]

				G. Foldes, M. Suo, I. Szokodi, Z. Lako-Futo, R. deChatel, O. Vuolteenaho, P. Huttunen, H. Ruskoaho, and M. Toth Factors Derived from Adrenals Are Required for Activation of Cardiac Gene Expression in Angiotensin II-Induced Hypertension Endocrinology, October 1, 2001; 142(10): 4256 - 4263. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Fiebeler, A. Articles by Luft, F. C. Search for Related Content PubMed PubMed Citation Articles by Fiebeler, A. Articles by Luft, F. C. Related Collections Remodeling ACE/Angiotension receptors Hypertrophy Myocardial cardiomyopathy disease Oxidant stress