(Hypertension. 2001;37:787.)
© 2001 American Heart Association, Inc.
Scientific Contributions |
B Activation in Angiotensin IIInduced Cardiac Injury
From the Franz Volhard Clinic and Max Delbrück Center, Medical Faculty of the Charité, Humboldt University of Berlin, and Department of Medicine-Nephrology, Hoffmann La Roche Inc, Basel, Schwitzerland; and Hannover Medical School, University of Hannover, Germany.
Correspondence to Dr Friedrich C. Luft, Franz Volhard Clinic, Wiltberg Str 50, 13125 Berlin, Germany. E-mail luft{at}fvk-berlin.de
| Abstract |
|---|
|
|
|---|
B. We used immunohistochemistry,
electrophoretic mobility shift assays, and TaqMan RT-PCR. Untreated
dTGR developed hypertension, cardiac hypertrophy,
vasculopathy, and fibrosis with a 50% mortality rates at 7 weeks.
SPIRO and VAL prevented death and reversed cardiac
hypertrophy, while only VAL normalized blood pressure. Both
drugs prevented vasculopathy. bFGF was markedly upregulated in dTGR,
whereas platelet-derived growth factor-B and transforming growth
factor-ß1 were little changed. VAL and SPIRO
suppressed this upregulation. Both AP-1 and NF-
B were
activated in dTGR compared with controls. VAL and SPIRO reduced
both transcription factors and reduced bFGF, collagen I, fibronectin,
and laminin in the interstitium. These findings show that
aldosterone promotes hypertrophy, cardiac
remodeling, and fibrosis, independent of blood pressure. The effects
involve AP-1, NF-
B, and bFGF. Mineralocorticoid receptor blockade
downregulates these effectors and reduces angiotensin
IIinduced cardiac damage.
Key Words: angiotensin nuclear factors receptors, mineralocorticoid spironolactone
| Introduction |
|---|
|
|
|---|
| Methods |
|---|
|
|
|---|
B and AP-1 were
performed according to a protocol described
earlier.12 Briefly, 10 µg
total heart homogenates was incubated in binding reaction
medium [0.66 µg poly(dI/dC), 1 µg BSA, 1 mmol/L DTT, 20
mmol/L HEPES, pH 8.4, 60 mmol/L KCl, and 8% Ficoll] with 0.5 ng
of 32P-dATP end-labeled
oligonucleotide, containing the NF-
Bbinding
site from the MHC enhancer (H2K:
5'-gatcCAGGGCTGGGGATTCCCCATCTCCACAGG)or containing the consensus
sequence for AP-1 (Santa Cruz) (5'-GAT CGA ACT GAC CGC CCG CCG CCC
GT-3'). In competition assays, 50 ng unlabeled H2K or AP-1
oligonucleotides was used. Nuclear extracts were
supershifted with antibodies against the NF-
B subunits p50 and p65
and the AP-1 subunits c-fos and
c-jun, respectively (all
antibodies from Santa Cruz). For RT-PCR, RNA was isolated according to
the TRIZOL protocol (Gibco Life Technology). Primers were synthesized
(BioTez) for the following sequences: GAPDH,
c-fos, basic fibroblast growth
factor (bFGF), platelet-derived growth factor (PDGF)-B,
TGF-ß1, and aldosterone synthase.
Real-time quantitative RT-PCR was performed with the TaqMan system (PE
Biosystems). Forty cycles of PCR were performed according to the
EZ-RT-PCR TaqMan kit protocol instructions with Mangan
concentrations of 3 µmol/L for GAPDH; 4 µmol/L for PDGF-B,
TGF-ß1, and bFGF; and 2 mmol/L for
aldosterone synthase. The sequences were GAPDH-F,
AAGCTGGTCATCAATGGGAAAC; GAPDH-R, ACCCCATTTGATGTTAGCGG; GAPDH-P,
CATCACCATCTTCCAGGAGCGCGCGAT; bFGF-F, GGAGTTGTGTCCATCAAGGGA; bFGF-R,
AGCAGCCGTCCATCTTCCT; bFGF-P, TGTGTGCGAACCGGTACCTGGCT;
TGF-ß1-F, TCCCAAACGTCGAGGTGAC;
TGF-ß1-R, CCATGAGGAGCAGGAAGGG;
TGF-ß1-P: TGGGCACCATCCATGACATGAACC; PDGF-F,
TCAGAA-GCGGGCTACTATACCAT; PDGF-R, TTGAATGAGAGCTGGACCTGG;
PDGF-P, CGGGCCTTCCATGCGGACG; AldSyn-F, TGTGAGCTGAAGGGAGGAGG; AldSyn-R,
GGTCTTGCCAGCCACACAT; AldSyn-P, TGGCAATGGCTCTCAGGGTGACAG;
c-fos-F, CCATGATGTTCTCGGGTTTCA;
c-fos-R,
GCGCTACTGCAGC-GGG; and
c-fos-P:
CGCGGACTACGAGGCGTCATCC. Each sample was tested twice. For quantification, the target sequence was normalized in relation to the GAPDH gene. Data are mean±SEM. ANOVA and the Scheffé test were used to test statistically significant differences in mean values.
| Results |
|---|
|
|
|---|
|
Plasma aldosterone levels were markedly elevated in untreated dTGR rats; the mean value was 15±5 nmol/L compared with 0.7±0.2 nmol/L in the control group. In the treated groups, plasma aldosterone was significantly reduced. The VAL and SPIRO groups had values of 1.6±0.2 and 2.1±1.0 nmol/L, respectively (Figure 1C). No difference in the mRNA expression of aldosterone synthase, the key enzyme for aldosterone production, was detected after blocking the aldosterone receptor. However, blocking the AT1 receptor suppressed gene expression for aldosterone synthase compared with all other groups. The expression values (arbitrary units) for dTGR, SPIRO, VAL, and SD rats were 12.5±5.5, 14.1±4.3, 0.5±0.2, and 8.0±3.4.
The vehicle-treated dTGR rats developed progressive inflammatory changes in the heart. Immunohistochemical analysis was made for the monocyte/macrophage marker ED-1 (Figure 1D). SPIRO treatment reduced the number of ED-1positive cells by 34% (P<0.01). VAL treatment reduced the cells by 58% (P<0.0001) compared with vehicle-treated dTGR rats, which was a greater reduction than observed in SPIRO-treated dTGR rats (P<0.05). Interleukin (IL)-6 protein expression was upregulated in vehicle-treated dTGR rats. This upregulation was suppressed by VAL and SPIRO treatment (Figure 2C).
|
SPIRO treatment reduced extracellular matrix production. The hearts were stained for collagen I, fibronectin, and laminin. Collagen I (Figure 2A) and fibronectin (Figure 2B) were most prominently deposited around blood vessels, in the vascular adventitia, and focally around fibrotic areas of scarring. Fibronectin was also deposited in the neointima of remodeling vessels. Laminin was localized primarily between the cardiomyocytes (data not shown). All these interstitial deposits were substantially reduced in the SPIRO and VAL treatment groups.
To characterize the role of different growth factors in chronic ischemic remodeling, we analyzed mRNA expression of the growth factors bFGF, PDGF-B, and TGF-ß1 in the left ventricle. The bFGF expression was significantly increased in vehicle-treated dTGR rats compared with SD rats (Figure 3A). VAL and SPIRO both decreased bFGF expression. Block of the AT1 receptor lowered bFGF gene expression to control levels; SPIRO reduced these levels by 75%. In contrast, PDGF-B (Figure 3B) and TGF-ß1 (Figure 3C) expression levels were only modestly, not significantly, increased. Immunohistochemistry for bFGF localized the protein to the neointima and media of arterial blood vessels, as well as to infiltrated cells perivascular and between cardiomyocytes (Figure 3D).
|
Further characterization of the DNA binding activity
and transcription factor gene expression was performed. DNA binding
activities for both NF-
B
(Figure 4A) and AP-1
(Figure 4B) in response to SPIRO treatment were decreased,
although activity was more pronounced for AP-1. Correspondingly,
c-fos mRNA expression was
upregulated in vehicle-treated dTGR rats compared with VAL- and
SPIRO-treated animals. Binding specificity was demonstrated through
competition of excess unlabeled oligonucleotides
containing the
B site from the MHC enhancer (H2K) or the AP-1 site
(Figure 4C).
|
| Discussion |
|---|
|
|
|---|
B were lowered.
Blocking the mineralocorticoid receptor resulted in effects similar to
blocking the AT1 receptor. dTGR rats had plasma
aldosterone values >10-fold higher than those of SD rats.
The adrenal gland was the likely source of the circulating
aldosterone; degradation may also have been impaired
because of hepatic malfunction. Both SPIRO and VAL lowered the values
to normal levels. However, we do not believe that circulating
aldosterone is the major mediator of injury nor a mirror of
the degree of renin-angiotensin-aldosterone
system tissue activation in this model. Silvestre et
al13 showed the control of
plasma and cardiac aldosterone levels to be regulated
independently and showed a 17-fold higher aldosterone
concentration in myocardium than in plasma of rodents. We
did not measure myocardial aldosterone concentrations.
However, in the hearts of our dTGR rats, aldosterone
synthase mRNA was upregulated, consistent with local
production. SPIRO had no measurable effect on the gene
expression of the enzyme. Instead, we observed a marked decrease in
aldosterone synthase mRNA in VAL-treated dTGR rats.
SPIRO-treated rats had lower aldosterone levels than dTGR
rats. We believe that this effect was probably related to organ
protection. SPIRO-treated animals had normal renal function and no
hepatic damage. Silvestre et al3 found that after myocardial infarction, rats showed aldosterone synthase upregulation, aldosterone production, and collagen deposition. In their model, aldosterone synthase upregulation was abolished by AT1 receptor blockade, whereas both mineralocorticoid receptor and AT1 receptor blockade ameliorated fibrosis. Their findings, as well as our own, are consistent with earlier observations that aldosterone is largely responsible for cardiac matrix protein production via a direct effect on the mineralocorticoid receptor.14 Robert et al9 and Sun and Weber15 recently showed that the cardiac AT1 receptor was upregulated in DOCA-salt rats, an effect blocked by SPIRO treatment. We have observed a trend, although not significant, for AT1 receptor downregulation in SPIRO-treated dTGR rats (data not shown). Thus, we do not believe that a downregulation of AT1 receptor expression was the main mechanism of mediating SPIRO-related effects.
The effects of Ang II and aldosterone on cardiovascular remodeling are not the same. Campbell et al7 found less cardiac inflammation and necrosis in a high aldosterone model compared with Ang II infusion, suggesting different mechanisms. Rocha et al16 observed ACE inhibitormediated protection from fibrotic end-organ damage in salt-fed stroke-prone spontaneously hypertensive rats. Concomitant aldosterone infusion reversed this protective effect blood pressure independently. These results indicate a direct and distinct profibrotic effect of aldosterone. Benetos et al17 investigated ACE inhibition and SPIRO treatment in spontaneously hypertensive rats. SPIRO primarily prevented collagen accumulation and, similar to our findings, did so independent of blood pressure reduction. A modest nonsignificant blood pressure reduction occurred that may have had some effect. However, such a reduction cannot account for the effects that we observed. Further evidence for a mineralocorticoid receptormediated role comes from the mineralocorticoid-resistant Wistar-Furth rat.18 When subjected to 5/6 nephrectomy, these rats exhibited far less sclerosis than did Wistar rats. Together, these results underscore the role of the mineralocorticoid receptor in mediation of end-organ damage.
We focused on both AP-1 and NF-
B in our model. We
speculate that AP-1 is activated via the
mitogen-activated protein kinase/ERK cascade that we found to
be activated in dTGR rats in an earlier
study.19 NF-
B, on the
other hand, is probably activated by the Ang IIdependent
generation of reactive oxygen
species.11 Tharaux et
al20 recently showed that
the Ang IIrelated effect on the collagen I gene was mediated via AP-1
and not NF-
B. Their results suggest that these transcription factors
are regulated by independent mechanisms. We observed earlier that Ang
II activates both transcription factor pathways in this model
via the AT1 receptor. New is our observation
that the mineralocorticoid receptor has an effect on the activation of
both transcription factors. However, AP-1 activity was markedly
reduced, whereas NF-
B activity was only moderately affected by SPIRO
compared with VAL treatment. The effect on NF-
B is in line with the
fact that VAL reduced inflammatory response more effectively than did
SPIRO. Our comments are based on comparisons of in vitro and in vivo
experiments. Such experiments may not invariably lead to the same
results. We believe that our in vivo studies may be more
germane.
bFGF, with a 40-fold higher gene expression in untreated dTGR rats compared with controls, may be important to the inflammation we observed. IL-6 production is markedly increased in dTGR rats (data not shown), which may be related to induction by bFGF.21 In cardiac myocytes, bFGF is a ligand for FGF-R2 and induces tyrosine phosphorylation and mitogen-activated protein kinase activation.22 Mice that lack the bFGF gene exhibit thrombocytosis, decreased blood pressure, and decreased vascular smooth muscle cell tone.23 Such mice also develop less aortic hypertrophy after aortic banding and had a reduced cardiomyocyte cross-sectional area compared with wild-type mice, suggesting a mediator role for bFGF.24 Fibroblasts and infiltrating inflammatory cells can both produce bFGF. Klauber et al25 demonstrated that SPIRO treatment inhibited angiogenesis in vivo through the suppression of bFGF, indicating a mineralocorticoid receptormediated effect.
PDGF-B and TGFb1 signaling is
involved in remodeling after ischemic injury. PDGF-B binds to
PDGF-B receptor tyrosine kinase. The consensus sequences in the PDGF-B
promoter contain AP-1 and NF-
B regulatory
elements.26 Ang II induces
PDGF-B in vascular smooth
muscle.27 In vivo ligand and
receptor are localized in the vascular neointima during
vascular repair, which may explain the modestly increased PDGF-B
expression we observed during the disease process in our
model.28
TGFß1 signaling is involved in remodeling
after myocardial
ischemia.29 We were
surprised to find no significant differences in the
TGFß1 gene or protein expression pattern in
our model. However, we did not characterize negative regulating
effector molecules, such as decorin, which may have affected
TGFß1 signaling in the hearts of our dTGR
rats. Our model exhibited increased collagen, laminin, and fibronectin
in the interstitium and perivascular areas. Both SPIRO and VAL were
effective in minimizing fibrosis and production of
extracellular matrix. The genes for these extracellular matrix proteins
possess both AP-1 and NF-
Bbinding
sites.30 31 32
In summary, we demonstrated an important role for
aldosterone in mediation of Ang IIinduced cardiac damage.
Mineralocorticoid receptor blockade with SPIRO ameliorated death,
cardiac hypertrophy, inflammation, and extracellular matrix
production. Inhibition of AP-1 was more pronounced than effects
on NF-
B activation, which corresponded to more prominent effects on
matrix deposition and less prominent effects on inflammation. These
findings suggest mechanisms by which mineralocorticoid receptor
blockade may improve clinical outcomes. Future studies must address how
mineralocorticoid receptor signaling functions in vascular cells and
which proteins are involved in early and late aldosterone
response.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received October 25, 2000; first decision December 4, 2000; accepted December 14, 2000.
| References |
|---|
|
|
|---|
2. Swedberg K, Eneroth P, Kjekshus J, Snapinn S. Effects of enalapril and neuroendocrine activation on prognosis in severe congestive heart failure (follow-up of the CONSENSUS trial). CONSENSUS Trial Study Group. Am J Cardiol. 1990;66:40D44D.[Medline] [Order article via Infotrieve]
3.
Silvestre JS,
Heymes C, Oubenaissa A, Robert V, Aupetit-Faisant B, Carayon A,
Swynghedauw B, Delcayre C. Activation of cardiac
aldosterone production in rat myocardial
infarction: effect of angiotensin II receptor blockade and
role in cardiac fibrosis.
Circulation. 1999;99:26942701.
4. Delcayre C, Silvestre JS, Garnier A, Oubenaissa A, Cailmail S, Tatara E, Swynghedauw B, Robert V. Cardiac aldosterone production and ventricular remodeling. Kidney Int. 2000;57:13461351.[Medline] [Order article via Infotrieve]
5.
Ikeda U, Hyman R,
Smith TW, Medford RM. Aldosterone-mediated regulation of
Na+,K+-ATPase
gene expression in adult and neonatal rat cardiocytes.
J Biol Chem. 1991;266:1205812066.
6.
Brilla CG, Pick R,
Tan LB, Janicki JS, Weber KT. Remodeling of the rat right and left
ventricles in experimental hypertension.
Circ Res. 1990;67:13551364.
7. Campbell SE, Janicki JS, Weber KT. Temporal differences in fibroblast proliferation and phenotype expression in response to chronic administration of angiotensin II or aldosterone. J Mol Cell Cardiol. 1995;27:15451560.[Medline] [Order article via Infotrieve]
8. Verrey F, Pearce D, Pfeiffer R, Spindler B, Mastroberardino L, Summa V, Zecevic M. Pleiotropic action of aldosterone in epithelia mediated by transcription and post-transcription mechanisms. Kidney Int. 2000;57:12771282.[Medline] [Order article via Infotrieve]
9.
Robert V, Heymes C,
Silvestre JS, Sabri A, Swynghedauw B, Delcayre C.
Angiotensin AT1 receptor subtype as
a cardiac target of aldosterone: role in
aldosterone-salt-induced fibrosis.
Hypertension. 1999;33:981986.
10.
Luft FC, Mervaala
E, Muller DN, Gross V, Schmidt F, Park JK, Schmitz C, Lippoldt A, Breu
V, Dechend R, Dragun D, Schneider W, Ganten D, Haller H.
Hypertension-induced end-organ damage: a new transgenic approach to an
old problem. Hypertension. 1999;33:212218.
11.
Muller DN,
Dechend R, Mervaala EM, Park JK, Schmidt F, Fiebeler A, Theuer J, Breu
V, Ganten D, Haller H, Luft FC. NF-
B inhibition ameliorates
angiotensin IIinduced inflammatory damage in rats.
Hypertension. 2000;35:193201.
12.
Muller DN,
Mervaala EM, Dechend R, Fiebeler A, Park JK, Schmidt F, Theuer J, Breu
V, Mackman N, Luther T, Schneider W, Gulba D, Ganten D, Haller H, Luft
FC. Angiotensin II (AT1) receptor
blockade reduces vascular tissue factor in angiotensin
II-induced cardiac vasculopathy. Am J
Pathol. 2000;157:111122.
13.
Silvestre JS,
Robert V, Heymes C, Aupetit-Faisant B, Mouas C, Moalic JM, Swynghedauw
B, Delcayre C. Myocardial production of aldosterone
and corticosterone in the rat: physiological
regulation. J Biol Chem. 1998;273:48834891.
14. Brilla CG, Rupp H, Funck R, Maisch B. The renin-angiotensin-aldosterone system and myocardial collagen matrix remodelling in congestive heart failure. Eur Heart J. 1995;16(suppl O):107109.
15. Sun Y, Weber KT. Angiotensin II and aldosterone receptor binding in rat heart and kidney: response to chronic angiotensin II or aldosterone administration. J Lab Clin Med. 1993;122:404411.[Medline] [Order article via Infotrieve]
16.
Rocha R, Chander
PN, Zuckerman A, Stier CT Jr. Role of aldosterone in renal
vascular injury in stroke-prone hypertensive rats.
Hypertension. 1999;33:232237.
17.
Benetos A,
Lacolley P, Safar ME. Prevention of aortic fibrosis by spironolactone
in spontaneously hypertensive rats.
Arterioscler Thromb Vasc Biol. 1997;17:11521156.
18.
Fitzgibbon WR,
Greene EL, Grewal JS, Hutchison FN, Self SE, Latten SY, Ullian ME.
Resistance to remnant nephropathy in the Wistar-Furth rat.
J Am Soc Nephrol. 1999;10:814821.
19. Park JK, Muller DN, Mervaala EM, Dechend R, Fiebeler A, Schmidt F, Bieringer M, Schafer O, Lindschau C, Schneider W, Ganten D, Luft FC, Haller H. Cerivastatin prevents angiotensin II-induced renal injury independent of blood pressure- and cholesterol-lowering effects. Kidney Int. 2000;58:14201430.[Medline] [Order article via Infotrieve]
20.
Tharaux PL,
Chatziantoniou C, Fakhouri F, Dussaule JC. Angiotensin II
activates collagen I gene through a mechanism involving the
MAP/ER kinase pathway.
Hypertension. 2000;36:330336.
21. Kozawa O, Suzuki A, Uematsu T. Basic fibroblast growth factor induces interleukin-6 synthesis in osteoblasts: autoregulation by protein kinase C. Cell Signal. 1997;9:463468.[Medline] [Order article via Infotrieve]
22.
Bogoyevitch MA,
Glennon PE, Andersson MB, Clerk A, Lazou A, Marshall CJ, Parker PJ,
Sugden PH. Endothelin-1 and fibroblast growth factors stimulate the
mitogen- activated protein kinase signaling cascade in cardiac
myocytes: the potential role of the cascade in the integration of two
signaling pathways leading to myocyte hypertrophy.
J Biol Chem. 1994;269:11101119.
23. Zhou M, Sutliff RL, Paul RJ, Lorenz JN, Hoying JB, Haudenschild CC, Yin M, Coffin JD, Kong L, Kranias EG, Luo W, Boivin GP, Duffy JJ, Pawlowski SA, Doetschman T. Fibroblast growth factor 2 control of vascular tone. Nat Med. 1998;4:201207.[Medline] [Order article via Infotrieve]
24. Schultz JE, Witt SA, Nieman ML, Reiser PJ, Engle SJ, Zhou M, Pawlowski SA, Lorenz JN, Kimball TR, Doetschman T. Fibroblast growth factor-2 mediates pressure-induced hypertrophic response. J Clin Invest. 1999;104:709719.[Medline] [Order article via Infotrieve]
25.
Klauber N, Browne
F, Anand-Apte B, DAmato RJ. New activity of spironolactone:
inhibition of angiogenesis in vitro and in vivo.
Circulation. 1996;94:25662571.
26. Khachigian LM, Resnick N, Gimbrone MA Jr, Collins T. Nuclear factor-kappa B interacts functionally with the platelet-derived growth factor B-chain shear-stress response element in vascular endothelial cells exposed to fluid shear stress. J Clin Invest. 1995;96:11691175.
27.
Deguchi J,
Makuuchi M, Nakaoka T, Collins T, Takuwa Y. Angiotensin II
stimulates platelet-derived growth factor-B chain expression in
newborn rat vascular smooth muscle cells and neointimal
cells through Ras, extracellular signal-regulated protein kinase, and
c-Jun N-terminal protein kinase mechanisms.
Circ Res. 1999;85:565574.
28.
Majesky MW, Reidy
MA, Bowen-Pope DF, Hart CE, Wilcox JN, Schwartz SM. PDGF ligand and
receptor gene expression during repair of arterial injury.
J Cell Biol. 1990;111:21492158.
29. Hao J, Ju H, Zhao S, Junaid A, Scammell-La Fleur T, Dixon IM. Elevation of expression of Smads 2, 3, and 4, decorin and TGF-beta in the chronic phase of myocardial infarct scar healing. J Mol Cell Cardiol. 1999;31:667678.[Medline] [Order article via Infotrieve]
30. Matsui T. Differential activation of the murine laminin B1 gene promoter by RAR alpha, ROR alpha, and AP-1. Biochem Biophys Res Commun. 1996;220:405410.[Medline] [Order article via Infotrieve]
31.
Tamura K, Nyui N,
Tamura N, Fujita T, Kihara M, Toya Y, Takasaki I, Takagi N, Ishii M,
Oda K, Horiuchi M, Umemura S. Mechanism of angiotensin
II-mediated regulation of fibronectin gene in rat vascular smooth
muscle cells. J Biol Chem. 1998;273:2648726496.
32.
Chung KY, Agarwal
A, Uitto J, Mauviel A. An AP-1 binding sequence is essential for
regulation of the human alpha2(I) collagen (COL1A2) promoter activity
by transforming growth factor-beta. J
Biol Chem. 1996;271:32723278.
This article has been cited by other articles:
![]() |
J. Peters, T. Schluter, T. Riegel, B. S. Peters, A. Beineke, U. Maschke, N. Hosten, J. J. Mullins, and R. Rettig Lack of cardiac fibrosis in a new model of high prorenin hyperaldosteronism Am J Physiol Heart Circ Physiol, November 1, 2009; 297(5): H1845 - H1852. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Lemarie, S. M.C. Simeone, A. Nikonova, T. Ebrahimian, M.-E. Deschenes, T. M. Coffman, P. Paradis, and E. L. Schiffrin Aldosterone-Induced Activation of Signaling Pathways Requires Activity of Angiotensin Type 1a Receptors Circ. Res., October 23, 2009; 105(9): 852 - 859. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ritz and A. Tomaschitz Aldosterone, a vasculotoxic agent--novel functions for an old hormone Nephrol. Dial. Transplant., August 1, 2009; 24(8): 2302 - 2305. [Full Text] [PDF] |
||||
![]() |
J.-K. Park, S. Theuer, T. Kirsch, C. Lindschau, U. Klinge, A. Heuser, R. Plehm, M. Todiras, P. Carmeliet, H. Haller, et al. Growth Arrest Specific Protein 6 Participates in DOCA-Induced Target-Organ Damage Hypertension, August 1, 2009; 54(2): 359 - 364. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Luther, Z. Wang, J. Ma, N. Makhanova, H.-S. Kim, and N. J. Brown Endogenous Aldosterone Contributes to Acute Angiotensin II-Stimulated Plasminogen Activator Inhibitor-1 and Preproendothelin-1 Expression in Heart But Not Aorta Endocrinology, May 1, 2009; 150(5): 2229 - 2236. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Ai, W. Pang, N. Li, M. Xu, P. D. Jones, J. Yang, Y. Zhang, N. Chiamvimonvat, J. Y.-J. Shyy, B. D. Hammock, et al. Soluble epoxide hydrolase plays an essential role in angiotensin II-induced cardiac hypertrophy PNAS, January 13, 2009; 106(2): 564 - 569. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Di Zhang, A. N. D. Cat, C. Soukaseum, B. Escoubet, A. Cherfa, S. Messaoudi, C. Delcayre, J.-L. Samuel, and F. Jaisser Cross-Talk Between Mineralocorticoid and Angiotensin II Signaling for Cardiac Remodeling Hypertension, December 1, 2008; 52(6): 1060 - 1067. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Caprio, B. G. Newfell, A. la Sala, W. Baur, A. Fabbri, G. Rosano, M. E. Mendelsohn, and I. Z. Jaffe Functional Mineralocorticoid Receptors in Human Vascular Endothelial Cells Regulate Intercellular Adhesion Molecule-1 Expression and Promote Leukocyte Adhesion Circ. Res., June 6, 2008; 102(11): 1359 - 1367. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Molnar, C. Lindschau, G. Dubrovska, P. R. Mertens, T. Kirsch, M. Quinkler, M. Gollasch, S. Wresche, F. C. Luft, D. N. Muller, et al. Glucocorticoid-Related Signaling Effects in Vascular Smooth Muscle Cells Hypertension, May 1, 2008; 51(5): 1372 - 1378. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. C. Connell, S. M. MacKenzie, E. M. Freel, R. Fraser, and E. Davies A Lifetime of Aldosterone Excess: Long-Term Consequences of Altered Regulation of Aldosterone Production for Cardiovascular Function Endocr. Rev., April 1, 2008; 29(2): 133 - 154. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Grossmann, R. Freudinger, S. Mildenberger, B. Husse, and M. Gekle EF Domains Are Sufficient for Nongenomic Mineralocorticoid Receptor Actions J. Biol. Chem., March 14, 2008; 283(11): 7109 - 7116. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Schiffrin New Twist to the Role of the Renin-Angiotensin System in Heart Failure: Aldosterone Upregulates Renin-Angiotensin System Components in the Brain Hypertension, March 1, 2008; 51(3): 622 - 623. [Full Text] [PDF] |
||||
![]() |
C. F.H. Mueller and G. Nickenig Angiotensin II: One Driving Force Behind Atherogenesis Hypertension, February 1, 2008; 51(2): 175 - 176. [Full Text] [PDF] |
||||
![]() |
N. J. Brown Aldosterone and Vascular Inflammation Hypertension, February 1, 2008; 51(2): 161 - 167. [Full Text] [PDF] |
||||
![]() |
C. Savoia, R. M. Touyz, F. Amiri, and E. L. Schiffrin Selective Mineralocorticoid Receptor Blocker Eplerenone Reduces Resistance Artery Stiffness in Hypertensive Patients Hypertension, February 1, 2008; 51(2): 432 - 439. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Cooper, A. Whaley-Connell, J. Habibi, Y. Wei, G. Lastra, C. Manrique, S. Stas, and J. R. Sowers Renin-angiotensin-aldosterone system and oxidative stress in cardiovascular insulin resistance Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2009 - H2023. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. K. LeBrasseur, T.-A. S. Duhaney, D. S. De Silva, L. Cui, P. C. Ip, L. Joseph, and F. Sam Effects of Fenofibrate on Cardiac Remodeling in Aldosterone-Induced Hypertension Hypertension, September 1, 2007; 50(3): 489 - 496. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Stas, A. Whaley-Connell, J. Habibi, L. Appesh, M. R. Hayden, P. R. Karuparthi, M. Qazi, E. M. Morris, S. A. Cooper, C. D. Link, et al. Mineralocorticoid Receptor Blockade Attenuates Chronic Overexpression of the Renin-Angiotensin-Aldosterone System Stimulation of Reduced Nicotinamide Adenine Dinucleotide Phosphate Oxidase and Cardiac Remodeling Endocrinology, August 1, 2007; 148(8): 3773 - 3780. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Mejia-Vilet, V. Ramirez, C. Cruz, N. Uribe, G. Gamba, and N. A. Bobadilla Renal ischemia-reperfusion injury is prevented by the mineralocorticoid receptor blocker spironolactone Am J Physiol Renal Physiol, July 1, 2007; 293(1): F78 - F86. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Perez-Rojas, J. A. Blanco, C. Cruz, J. Trujillo, V. S. Vaidya, N. Uribe, J. V. Bonventre, G. Gamba, and N. A. Bobadilla Mineralocorticoid receptor blockade confers renoprotection in preexisting chronic cyclosporine nephrotoxicity Am J Physiol Renal Physiol, January 1, 2007; 292(1): F131 - F139. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Luther, J. V. Gainer, L. J. Murphey, C. Yu, D. E. Vaughan, J. D. Morrow, and N. J. Brown Angiotensin II Induces Interleukin-6 in Humans Through a Mineralocorticoid Receptor-Dependent Mechanism Hypertension, December 1, 2006; 48(6): 1050 - 1057. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen and J. L. Mehta Angiotensin II-mediated oxidative stress and procollagen-1 expression in cardiac fibroblasts: blockade by pravastatin and pioglitazone Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1738 - H1745. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Johar, A. C. Cave, A. Narayanapanicker, D. J. Grieve, and A. M. Shah Aldosterone mediates angiotensin II-induced interstitial cardiac fibrosis via a Nox2-containing NADPH oxidase FASEB J, July 1, 2006; 20(9): 1546 - 1548. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-Y. Han, C.-H. Kim, H.-S. Kim, Y.-H. Jee, H.-K. Song, M.-H. Lee, K.-H. Han, H.-K. Kim, Y.-S. Kang, J.-Y. Han, et al. Spironolactone Prevents Diabetic Nephropathy through an Anti-Inflammatory Mechanism in Type 2 Diabetic Rats J. Am. Soc. Nephrol., May 1, 2006; 17(5): 1362 - 1372. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kobayashi, K. Yoshida, S. Nakano, T. Ohno, T. Honda, Y. Tsubokou, and H. Matsuoka Cardioprotective Mechanisms of Eplerenone on Cardiac Performance and Remodeling in Failing Rat Hearts Hypertension, April 1, 2006; 47(4): 671 - 679. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Schiffrin Effects of Aldosterone on the Vasculature Hypertension, March 1, 2006; 47(3): 312 - 318. [Full Text] [PDF] |
||||
![]() |
D. Susic, J. Varagic, J. Ahn, L. C. Matavelli, and E. D. Frohlich Beneficial Cardiovascular Actions of Eplerenone in the Spontaneously Hypertensive Rat Journal of Cardiovascular Pharmacology and Therapeutics, July 1, 2005; 10(3): 197 - 203. [Abstract] [PDF] |
||||
![]() |
D. Schneiders, J. Heger, P. Best, H. Michael Piper, and G. Taimor SMAD proteins are involved in apoptosis induction in ventricular cardiomyocytes Cardiovasc Res, July 1, 2005; 67(1): 87 - 96. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fiebeler, J. Nussberger, E. Shagdarsuren, S. Rong, G. Hilfenhaus, N. Al-Saadi, R. Dechend, M. Wellner, S. Meiners, C. Maser-Gluth, et al. Aldosterone Synthase Inhibitor Ameliorates Angiotensin II-Induced Organ Damage Circulation, June 14, 2005; 111(23): 3087 - 3094. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gonzalez, L. Lobos, F. Castillo, L. Galleguillos, N. C. Lopez, and L. Michea High-Salt Diet Inhibits Expression of Angiotensin Type 2 Receptor in Resistance Arteries Hypertension, May 1, 2005; 45(5): 853 - 859. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Blaxall, J. M. Miano, and B. C. Berk Angiotensin II: A Devious Activator of Mineralocorticoid Receptor-Dependent Gene Expression Circ. Res., April 1, 2005; 96(6): 610 - 611. [Full Text] [PDF] |
||||
![]() |
J. Lebowitz, R. S. Edinger, B. An, C. J. Perry, S. Onate, T. R. Kleyman, and J. P. Johnson I{kappa}B Kinase-{beta} (IKK{beta}) Modulation of Epithelial Sodium Channel Activity J. Biol. Chem., October 1, 2004; 279(40): 41985 - 41990. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Kardami, Z.-S. Jiang, S. K Jimenez, C. J Hirst, F. Sheikh, P. Zahradka, and P. A Cattini Fibroblast growth factor 2 isoforms and cardiac hypertrophy Cardiovasc Res, August 15, 2004; 63(3): 458 - 466. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Mazak, A. Fiebeler, D. N. Muller, J.-K. Park, E. Shagdarsuren, C. Lindschau, R. Dechend, C. Viedt, B. Pilz, H. Haller, et al. Aldosterone Potentiates Angiotensin II-Induced Signaling in Vascular Smooth Muscle Cells Circulation, June 8, 2004; 109(22): 2792 - 2800. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Grossmann, R. Freudinger, S. Mildenberger, A. W. Krug, and M. Gekle Evidence for epidermal growth factor receptor as negative-feedback control in aldosterone-induced Na+ reabsorption Am J Physiol Renal Physiol, June 1, 2004; 286(6): F1226 - F1231. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. T. Weber From Inflammation to Fibrosis: A Stiff Stretch of Highway Hypertension, April 1, 2004; 43(4): 716 - 719. [Full Text] [PDF] |
||||
![]() |
N. Tsybouleva, L. Zhang, S. Chen, R. Patel, S. Lutucuta, S. Nemoto, G. DeFreitas, M. Entman, B. A. Carabello, R. Roberts, et al. Aldosterone, Through Novel Signaling Proteins, Is a Fundamental Molecular Bridge Between the Genetic Defect and the Cardiac Phenotype of Hypertrophic Cardiomyopathy Circulation, March 16, 2004; 109(10): 1284 - 1291. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. K Shieh, E. Kotlyar, and F. Sam Aldosterone and cardiovascular remodelling: focus on myocardial failure Journal of Renin-Angiotensin-Aldosterone System, March 1, 2004; 5(1): 3 - 13. [Abstract] [PDF] |
||||
![]() |
A. D Struthers and T. M MacDonald Review of aldosterone- and angiotensin II-induced target organ damage and prevention Cardiovasc Res, March 1, 2004; 61(4): 663 - 670. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.R. Uhrenholt, J. Schjerning, P.B. Hansen, R. Norregaard, B.L. Jensen, G.L. Sorensen, and O. Skott Rapid Inhibition of Vasoconstriction in Renal Afferent Arterioles by Aldosterone Circ. Res., December 12, 2003; 93(12): 1258 - 1266. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Fraccarollo, P. Galuppo, S. Hildemann, M. Christ, G. Ertl, and J. Bauersachs Additive improvement of left ventricular remodeling and neurohormonal activation by aldosterone receptor blockade with eplerenone and ACE inhibition in rats with myocardial infarction J. Am. Coll. Cardiol., November 5, 2003; 42(9): 1666 - 1673. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. W. Krug, C. Grossmann, C. Schuster, R. Freudinger, S. Mildenberger, M. V. Govindan, and M. Gekle Aldosterone Stimulates Epidermal Growth Factor Receptor Expression J. Biol. Chem., October 31, 2003; 278(44): 43060 - 43066. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. T Weber, Yao Sun, L. A Wodi, A. Munir, E. Jahangir, R. A Ahokas, I. C Gerling, A. E Postlethwaite, and K. J Warrington Toward a broader understanding of aldosterone in congestive heart failure Journal of Renin-Angiotensin-Aldosterone System, September 1, 2003; 4(3): 155 - 163. [Abstract] [PDF] |
||||
![]() |
M. Young and J. Funder Mineralocorticoid Action and Sodium-Hydrogen Exchange: Studies in Experimental Cardiac Fibrosis Endocrinology, September 1, 2003; 144(9): 3848 - 3851. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. N. Chander, R. Rocha, J. Ranaudo, G. Singh, A. Zuckerman, and C. T. Stier Jr. Aldosterone Plays a Pivotal Role in the Pathogenesis of Thrombotic Microangiopathy in SHRSP J. Am. Soc. Nephrol., August 1, 2003; 14(8): 1990 - 1997. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-Y. Chun, L. J. Bloem, and J. H. Pratt Aldosterone Inhibits Inducible Nitric Oxide Synthase in Neonatal Rat Cardiomyocytes Endocrinology, May 1, 2003; 144(5): 1712 - 1717. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Rocha, C. L. Martin-Berger, P. Yang, R. Scherrer, J. Delyani, and E. McMahon Selective Aldosterone Blockade Prevents Angiotensin II/Salt-Induced Vascular Inflammation in the Rat Heart Endocrinology, December 1, 2002; 143(12): 4828 - 4836. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. N. Muller, A. Mullally, R. Dechend, J.-K. Park, A. Fiebeler, B. Pilz, B.-M. Loffler, D. Blum-Kaelin, S. Masur, H. Dehmlow, et al. Endothelin-Converting Enzyme Inhibition Ameliorates Angiotensin II-Induced Cardiac Damage Hypertension, December 1, 2002; 40(6): 840 - 846. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Virdis, M. F. Neves, F. Amiri, E. Viel, R. M. Touyz, and E. L. Schiffrin Spironolactone Improves Angiotensin-Induced Vascular Changes and Oxidative Stress Hypertension, October 1, 2002; 40(4): 504 - 510. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Kaergel, D. N. Muller, H. Honeck, J. Theuer, E. Shagdarsuren, A. Mullally, F. C. Luft, and W.-H. Schunck P450-Dependent Arachidonic Acid Metabolism and Angiotensin II-Induced Renal Damage Hypertension, September 1, 2002; 40(3): 273 - 279. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Goette, U. Lendeckel, and H. U Klein Signal transduction systems and atrial fibrillation Cardiovasc Res, May 1, 2002; 54(2): 247 - 258. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takeda, T. Yoneda, M. Demura, M. Usukura, and H. Mabuchi Calcineurin Inhibition Attenuates Mineralocorticoid-Induced Cardiac Hypertrophy Circulation, February 12, 2002; 105(6): 677 - 679. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Foldes, M. Suo, I. Szokodi, Z. Lako-Futo, R. deChatel, O. Vuolteenaho, P. Huttunen, H. Ruskoaho, and M. Toth Factors Derived from Adrenals Are Required for Activation of Cardiac Gene Expression in Angiotensin II-Induced Hypertension Endocrinology, October 1, 2001; 142(10): 4256 - 4263. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Hypertension Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2001 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |