(Hypertension. 2001;37:1444.)
© 2001 American Heart Association, Inc.
Scientific Contributions |
ETA Receptor Antagonist Prevents Blood Pressure Elevation and Vascular Remodeling in Aldosterone-Infused Rats
From the Clinical Research Institute of Montreal, University of Montreal (J.B.P., E.L.S.), Montreal, Quebec, Canada; and Samsung Cheil Hospital, Sungkyunkwan University School of Medicine (J.B.P.), Seoul, Korea.
Correspondence to Ernesto L. Schiffrin, MD, PhD, FRCPC, Clinical Research Institute of Montreal, 110 Pine Ave W, Montreal, Quebec, Canada H2W 1R7. E-mail schiffe{at}ircm.qc.ca
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract—Increased endothelin-1 may be associated with elevation of blood pressure (BP) and promotion of vascular hypertrophy, especially in salt-sensitive hypertension. Mineralocorticoid hypertension has been associated with activation of the endothelin system. We evaluated whether in aldosterone-infused rats the selective endothelin type A receptor-antagonist BMS 182874 prevents BP elevation and vascular hypertrophy. Rats were infused with aldosterone (0.75 µg/h) subcutaneously via a mini-osmotic pump and were offered 1% NaCl in the drinking water±BMS 182874 (40 mg/kg in food) for 6 weeks. Systolic BP was monitored by the tail-cuff method, and vascular changes of mesenteric arteries were evaluated using a pressurized myograph. Aldosterone-infusion significantly increased BP to 151±7 mm Hg compared with controls (108±4 mm Hg, P<0.01). BMS 182874 normalized BP (117±4 mm Hg). Media cross-sectional area of aorta was significantly increased by aldosterone infusion (P<0.05), and BMS treatment normalized it (P<0.001). Aldosterone infusion increased media width and media-to-lumen ratio of mesenteric resistance arteries (17.6±0.4 µm and 7.5±0.4%) compared with controls (14.2±0.5 µm, P<0.01, and 5.9±0.1%, P<0.05). BMS 182874 normalized media and media-to-lumen ratio (15.1±0.6 µm and 5.7±0.1%, both P<0.01). In conclusion, the endothelin type A receptor antagonist attenuated BP elevation and prevented vascular remodeling or hypertrophy of aorta and mesenteric resistance arteries in aldosterone-infused rats. These results suggest a role for endothelin-1 in BP elevation and structural alterations of large and small vessels in aldosterone and salt-induced hypertension.
Key Words: hypertension, sodium-dependent • endothelin • blood vessels • aorta • arteries • hypertrophy
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Endothelin-1 (ET-1) gene expression is enhanced in blood vessels in deoxycorticosterone (DOCA)-salt hypertension.1 2 3 This mineralocorticoid and salt-dependent model of hypertension exhibits a severe degree of vascular hypertrophy and responds to endothelin antagonists with blood pressure (BP)–lowering and regression of hypertrophic remodeling of small arteries.4 5 It has accordingly been proposed that ET-1, which has hypertrophic and mitogenic properties,6 7 could play a role in the severe vascular hypertrophy present in salt-sensitive hypertensive rats,4 5 in addition to its vasoconstrictor action and hypertensive effects. Vascular aldosterone may contribute to the pathophysiology of hypertension.8 A relationship between endothelin and aldosterone has been demonstrated in patients with primary aldosteronism.9 In the recently concluded Randomized Aldactone Evaluation Study (RALES),10 blockade of aldosterone improved cardiac mortality in heart failure patients, which could be mediated in part via blunting of ET-1 effects.11
We tested the hypothesis that the expression of the ET-1 gene in blood vessels of aldosterone-infused hypertensive rats would be enhanced and would result in exaggerated vascular hypertrophy as we previously showed in DOCA-salt hypertension.2 3 4 5 We also proposed that the endothelin type A (ETA)-selective endothelin antagonist BMS 182874 would prevent BP elevation and vascular hypertrophy or remodeling in large and small arteries in this model.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Animal Experiments
The study was conducted according to recommendations of the Animal Care Committee of the Clinical Research Institute of Montreal and the Canadian Council of Animal Care. Male Sprague-Dawley rats (Charles River, St. Constant, Québec, Canada) that weighed 200 g were studied. Rats, under anesthesia with 50 mg/kg ketamine and 5 mg/kg xylazine given intramuscularly, had a model 2002 mini-osmotic pump (Alza Corporation), which infused 0.5 µL/h for 2 weeks, implanted subcutaneously. The mini-osmotic pumps were replaced every 2 weeks, with the rats under anesthesia. The mini-osmotic pumps infused subcutaneously 0.75 µg/h d-aldosterone (Sigma Chemical Co) dissolved in 0.9% saline or the vehicle. All rats were offered 1% saline to drink. BMS 182874 (obtained from Dr James Powell, Bristol-Myers Squibb, Princeton, NJ) was offered in the drinking water (40 mg · kg-1 · d-1) throughout the experiment to one half of the aldosterone-infused rats. Systolic BP was measured weekly by the tail-cuff method and recorded on a model 7 polygraph fitted with a 7-P8 preamplifier and PCPB photoelectric pulse sensor (Grass Instruments Co). The average of 3 pressure readings was obtained. Rats were killed by decapitation at the end of the experiment, and half the thoracic aorta was fixed in Bouin solution and the rest was frozen in liquid nitrogen.
Study of Small Arteries
Superior mesenteric arteries were taken from the part
of the mesenteric vascular bed that feeds the jejunum 8- to 10-cm
distal to the pylorus and placed in cold
physiological salt solution (PSS) of the following
composition: NaCl 120 mmol/L, NaHCO3
25 mmol/L, KCl 4.7 mmol/L,
KH2PO4 1.2 mmol/L,
MgSO4 1.2 mmol/L,
CaCl2 2.5 mmol/L, EDTA 0.026 mmol/L,
and glucose 5.5 mmol/L. A third-order branch of the mesenteric
arterial tree (
2 mm in length) was carefully
dissected 1 mm from the intestine and cleaned of all adherent
connective tissue under a dissecting microscope. The
arterial segments were mounted in a pressure myograph
chamber, as previously
described,12 and slipped
onto 2-glass microcannulae. The axial length of the
arterial segment was adjusted by carefully positioning the
cannula until vascular walls were parallel without any stretch.
Intraluminal pressure was set to 45 mm Hg with a servocontrolled
pump. Vessels were then equilibrated for 1 hour with PSS that was
bubbled with 95% air (21% O2) and 5%
CO2 to give a pH of 7.4 to 7.45 and heated to
37°C.
Endothelium-dependent and -independent relaxation was assessed by measuring the dilatory response of small arteries precontracted with norepinephrine (5x10-5 mol/L) to cumulative doses of acetylcholine (10-7 to 10-5 mol/L) and sodium nitroprusside (10-7 to 10-4 mol/L). Contractions to cumulative doses of ET-1 (10-11 to 10-7 mol/L) were also obtained. Thereafter, mesenteric resistance arteries were deactivated with Ca2+-free PSS that contained 10 mmol/L EGTA for 30 minutes to eliminate tone. Lumen and media dimensions were measured with the intraluminal pressure maintained at 45 mm Hg.
Study of Aorta
The aorta fixed in Bouin solution was processed for
paraffin embedding in an automated system (SHANDON Citadel tissue
processor). Serial sections (5-µm thick) of aorta were obtained.
Tissue sections were dewaxed with ethanol and stained with Sirius red
F3BA (0.5% in saturated aqueous picric acid) (Aldrich Chemical
Company Inc). The media cross-sectional area (CSA) of aorta
(magnification, x10) was analyzed with an image
analysis system (Northern Eclipse 5.0, EMPIX Imaging Inc). A
single investigator blinded to the experimental groups performed the
analysis.
Analysis of PreproET-1 mRNA From
Aorta
Expression of the ET-1 gene in aorta was studied by
reverse transcription–polymerase chain reaction (RT-PCR). Total RNA
was extracted from frozen aorta as previously
described.13 RT was
performed in a 30-µL volume that contained 1 µg of RNA, 1.5 µL of
10 mmol/L dNTP, 6 µL of BRL 53 buffer, 0.6 µL of
oligo-(dT)12–18 primer (0.5 mg/mL), 1.5 µL of 200 U/mL M-MLV reverse
transcriptase (GIBCO-BRL), 0.9 µL of rRNasin (RNase
inhibitor, 40 U/mL), and 3 µL of dithiothreitol (0.1
mol/L) for 1 hour at 37°C. The reaction was stopped by heating at
95°C for 5 minutes. Five microliters of the resulting cDNA mixture
was amplified using specific primers. For amplification of the ET-1
gene cDNA, sense TTTTTTCCCTCCTCTTCTTC and antisense
CCTCCAACCTTCTTATTTTTC primers were used. For glyceraldehyde phosphate
dehydrogenase (GAPDH), sense TATGATGACATCAAGAAGGTGG and
antisense ATGTCGTTGTCCCACCAC primers were used. PCR was conducted with
an initial denaturing interval (95°C, 5 minutes) and then 30 sequence
cycles; for preproET-1, 94°C (45 seconds), 47.5°C (30 seconds), and
72°C (1 minute); and for GAPDH, 94°C (45 seconds), 55°C (30
seconds), and 72°C (1.5 minutes). Amplification products were
electrophoresed in 1.5% agarose gel that contained ethidium bromide
(0.5 mg/mL). Bands that corresponded to RT-PCR products were
visualized by UV light and digitized using AlphaImager software. Band
intensity was quantified using ImageQuant (version 3.3, Molecular
Dynamics) software. Under the conditions in which it was performed,
RT-PCR allowed semiquantitative evaluation of preproET-1 and GAPDH mRNA
with 0.1 µg of total RNA
(Figure 1).
|
Measurement of Immunoreactive ET-1 in
Plasma
Plasma ET-1 was measured by radioimmunoassay after
extraction by passage through a C18 Sep-Pak cartridge as previously
described.14
Data Analysis
Data are presented as mean±SEM. Statistical
analysis was performed using ANOVA for repeated measures.
Differences between means were analyzed for "simple main
effects" using a post hoc Student-Newman-Keuls test.
P<0.05 was considered
significant.
The remodeling index (the percent difference between
internal diameters of hypertensive and normotensive vessels not
attributable to growth) was calculated as
follows15 :
100[(Di)n-(Di)remodel]/[(Di)n-(Di)h],
in which (Di)n and
(Di)h are the internal
diameters of normotensive and hypertensive vessels, respectively, and
(Di)remodel is the
remodeled internal diameter.
(Di)remodel=[(De)h2-4CSAn/
]1/2,
in which (De)h is the
external diameter of hypertensive vessels and
CSAn is the media CSA of normotensive vessels.
The growth index was calculated as
(CSAh-CSAn)/CSAn,
in which CSAn and CSAh
are the CSAs of normotensive and hypertensive vessels,
respectively.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Body Weight, BP, Serum Potassium, and Plasma Endothelin
Body weight of aldosterone-infused hypertensive rats was slightly but not significantly lower than that of normotensive control rats (Table). Systolic BP of aldosterone-infused hypertensive rats was mildly but significantly elevated relative to that of normotensive control rats after 2 weeks of treatment and remained elevated thereafter (Figure 2). Treatment with the selective ETA receptor–antagonist BMS 182874 resulted in prevention of the development of hypertension in aldosterone-infused rats. Serum potassium was reduced in the aldosterone-infused rats and was normalized by BMS 182874 treatment. Plasma levels of immunoreactive endothelin showed no difference between the 3 groups.
|
|
Effects of ETA
Receptor–Antagonist BMS 182874 on Structure and Function
of Mesenteric Arteries
Aldosterone infusion resulted in an
increased media width and media-to-lumen ratio (17.6±0.4 µm and
7.5±0.4%) compared with controls (14.2±0.5 µm,
P<0.01, and 5.9±0.1%,
P<0.05, respectively). BMS
182874 normalized media width and media-to-lumen ratio in
aldosterone-infused rats (15.1±0.6 µm and 5.7±0.1%,
both P<0.01). Media CSA was
significantly increased from 11720±1006 to 14383±1091
µm2 in aldosterone-infused
rats (P<0.05) and tended to
decrease under BMS 182874 (13721±1339
µm2 )
(Figure 3). Lumen diameter did not differ in the 3 groups.
The remodeling index was -15% and the growth index was 23%, which
indicated that the structural change was what has been denominated
hypertrophic remodeling.16
Vasodilatory responses to acetylcholine or to a maximal dose
(10-4 mol/L) of sodium nitroprusside and
vasoconstrictor responses to increasing concentrations of ET-1 (not
shown) were similar to controls in aldosterone-infused rats
without or with BMS 182874 treatment.
|
Effects of ETA
Receptor–Antagonist BMS 182874 on Aorta
Aldosterone infusion significantly
increased aortic media CSA
(6.0±0.3x05
µm2) compared with controls
(5.3±0.2x05
µm2,
P<0.05). BMS 182874 treatment
normalized the cross-section of aorta from
aldosterone-infused rats
(4.6±0.2x105
µm2,
P<0.001, versus
aldosterone-infused rats;
Figure 4).
|
PreproET-1 Gene Expression in Aorta
Figure 5 shows results of RT-PCR analysis of RNA
extracted from aorta. Although preproET-1 mRNA was significantly
(P<0.05) increased 2.4-fold in
aldosterone-infused hypertensive rats, BMS 182874 treatment
did not change ET-1 gene expression.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
ET-1 has been proposed to play an important role in vascular hypertrophy in mineralocorticoid hypertension, such as in the DOCA-salt hypertensive rat4 5 , as well as in genetic salt-sensitive Dahl rats17 and in angiotensin II–induced hypertension in rats,18 independent of the effect of BP elevation. In this study, we attempted to answer questions whether aldosterone infusion into normotensive rats would increase BP, expression of tissue ET-1 in blood vessels, and hypertrophy or remodeling of large and small arteries. If enhanced ET-1 gene expression is induced, will the altered vascular structure or high BP be prevented with an ETA receptor–antagonist treatment? Our results demonstrate that in salt-loaded rats, aldosterone increases vascular ET-1 mRNA levels, which in turn mediate a major part of ET-1–stimulated vascular growth and hypertension in vivo. The blockade of the endothelin system at the level of ETA receptors prevented the development of hypertension and vascular hypertrophy in this experimental model. Interestingly, endothelin receptor antagonism also prevented the hypokalemia of the aldosterone-infused rats.
The salt-loaded rat infused with aldosterone is a model that has in the past been used to investigate cardiac fibrosis.19 We previously demonstrated that in DOCA-salt hypertensive rats, which have an important ET-1–dependent component,1 there is abundant interstitial and perivascular fibrosis of the heart,20 similar to that found in the salt-loaded rat infused with aldosterone.18 For this reason, we have investigated the salt-loaded aldosterone-infused rat in search of an endothelin-dependent component. Indeed, 6-week administration of aldosterone resulted in hypertrophic remodeling of small mesenteric arteries and aorta. There are no previous in vitro studies demonstrating that aldosterone stimulates ET-1 mRNA expression in endothelial or smooth muscle cells. This study demonstrates, for the first time, that aldosterone is able in vivo to increase vascular ET-1 tissue concentrations in comparison to salt-loaded control rats. Plasma levels of the peptide did not increase in the aldosterone-infused rat. The discrepancy between tissue and plasma ET-1 concentrations in our model is not dissimilar from the difference between the markedly elevated ET-1 tissue levels in small mesenteric arteries but not plasma levels after 2-week administration of angiotensin II.18 In the DOCA-salt hypertensive rat, tissue levels of ET-1 message or peptide are significantly increased, but plasma levels of immunoreactive endothelin will be found elevated in some but not in other series of experiments.1 These results support the hypothesis that ET-1 is a paracrine-autocrine, locally acting system, in which the peptide is secreted mainly abluminally.21 Small changes in plasma concentrations of immunoreactive endothelin, which were found but that did not achieve statistical significance, may relate to displacement of the peptide from the receptor in tissues to the circulation.
The function of small blood vessels was not altered in aldosterone-infused rats. Vasodilation in response to acetylcholine was not impaired, and vasoconstriction to ET-1 was unchanged in vessels from aldosterone-infused rats. Treatment with the ETA antagonist did not influence the function of mesenteric arteries in these rats. This finding is different from isolated aortic or mesenteric rings from DOCA-salt22 or from salt-sensitive Dahl rats, in which markedly reduced endothelium-dependent relaxations to acetylcholine and attenuated constriction to ET-1 could be demonstrated.17 The reason for these disparate results is not clear. A possible explanation may relate to the magnitude of BP elevation in aldosterone-infused rats (systolic BP, 150±7 mm Hg) compared with the more severe elevation of BP found in DOCA-salt or Dahl-salt sensitive rats (systolic BP, 190±4 mm Hg). Functional alterations in small vessels may be a later manifestation compared with BP elevation or structural changes. The structural alterations of mesenteric arteries from SHR23 and subcutaneous resistance arteries from mild hypertensive patients occurred much earlier and were more prevalent than endothelial dysfunction. Small artery remodeling may precede most clinically relevant manifestations of target organ damage.24 Functional changes may be more prominent in more severe forms of hypertension than in milder forms of hypertension, experimental or human. Recently, a study in humans has suggested that blockade of mineralocorticoid receptors with spironolactone could improve endothelium-dependent relaxation, possibly by improving bioavailability of nitric oxide through reduction in vascular wall oxidative stress.25 This could imply that aldosterone may be able to affect ET-1 production by reducing nitric oxide bioavailability, because nitric oxide may inhibit ET-1 generation.
It is difficult to differentiate between the structural consequences of BP reduction and the direct influence of endothelin blockade on vascular structure independent of BP reduction. In the present experiments, this differentiation cannot be made. Hemodynamic parameters have an impact on vascular structure.26 However, other studies using endothelin receptor antagonists have been able to demonstrate pressure-independent effects of ET-1 on vascular hypertrophy.4 18 Hence, stimulation of vascular endothelin production represents a pressure-independent mechanism of vascular hypertrophy in aldosterone-infused rats.
The mechanism of increase of ET-1 production in aldosterone-infused hypertensive rats remains unclear. Vasopressin, the levels and effects of which were shown in the past to be enhanced in DOCA-salt hypertension,27 28 may play a role in stimulation of ET-1 expression.13 29 Mineralocorticoids may potentiate effects of vasopressin on ET-1 expression in blood vessels and heart, or alternatively, mineralocorticoids may stimulate directly or indirectly vasopressin, which in turn may stimulate ET-1 expression. This remains undefined. Mineralocorticoid receptors have been found in endothelial and vascular smooth muscle cells in the aorta and pulmonary artery of rabbit.30 In myocyte and endothelial cells of the heart, the presence of mineralocorticoid receptors was also detected. This finding supports the possibility of direct aldosterone actions in the heart and blood vessels.31 At the level of resistance artery, a direct action of aldosterone has been proposed.32 Rizzoni et al33 reported vascular remodeling (increased media-to-lumen ratio and narrowed lumen) in resistance arteries from gluteal subcutaneous tissue taken from patients with primary aldosteronism. The present study is the first to suggest that effects previously attributed to direct actions of aldosterone may in fact be mediated by ET-1. Interestingly, in other models of hypertension, such as the transgenic (mREN2)27 rat in which a secondary form of aldosteronism occurs in response to angiotensin II stimulation of the adrenal, recent studies have demonstrated that endothelin antagonism with the same ETA antagonist used in the present study did not induce regression of cardiovascular remodeling.34 Several explanations are possible, but one could be that elevation of aldosterone in that model is not sufficient within the time limits of the experimental paradigm to stimulate ET-1 production. A similar finding has been reported in the 2-kidney, 1-clip Goldblatt hypertensive rat, another angiotensin II–dependent hypertensive model with secondary aldosteronism in which there is neither vascular overexpression of preproET-135 nor response of vascular remodeling to an endothelin receptor antagonist.36 Of interest in this regard is the normalization of serum potassium in the aldosterone-treated rats by the endothelin receptor antagonist, the mechanism for which remains to be investigated but may involve an effect of renal ET-1 in the distal tubule of the kidney, in which ET-1 has been shown to influence natriuresis.37
In conclusion, in salt-loaded, aldosterone-infused hypertensive rats, large and small artery hypertrophy and hypertension associated with increased vascular ET-1 mRNA were observed. These changes were abrogated if rats were treated with ETA receptor antagonism. This suggests that vascular hypertrophy and the increase in BP induced by aldosterone in vivo are mediated at least in part by increased production of endogenous ET-1, which activates ETA receptors that contribute to the observed changes in the cardiovascular system. The blockade of the endothelin system may therefore exert beneficial effects on both large and small arteries in conditions in which aldosterone blockade has been demonstrated to be efficacious.
|
Acknowledgments |
|---|
This work was supported by grant 37917 and a group grant from the Medical Research Council of Canada and the Canadian Institutes of Health Research to the Multidisciplinary Research Group on Hypertension. The authors are grateful to Suzanne Diebold for excellent technical assistance.
Received September 25, 2000; first decision October 18, 2000; accepted December 1, 2000.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Schiffrin EL. Role of endothelin-1 in hypertension. Hypertension. 1999;34(pt 2):876–881.
2.
Larivière R,
Thibault G, Schiffrin EL. Increased endothelin-1 content in blood
vessels of deoxycorticosterone acetate-salt hypertensive but not in
spontaneously hypertensive rats.
Hypertension. 1993;21:294–300.
3.
Schiffrin EL,
Larivière R, Li JS, Sventek P, Touyz RM. Deoxycorticosterone
acetate plus salt induces overexpression of vascular endothelin-1 and
severe vascular hypertrophy in spontaneously hypertensive
rats. Hypertension. 1995;25:769–773.
4.
Li JS,
Larivière R, Schiffrin EL. Effect of a nonselective endothelin
antagonist on vascular remodeling in deoxycorticosterone
acetate-salt hypertensive rats: evidence for a role of endothelin in
vascular hypertrophy.
Hypertension. 1994;24:183–188.
5. Schiffrin EL, Larivière R, Li JS, Sventek P. Enhanced expression of the endothelin-1 gene in blood vessels of DOCA-salt hypertensive rats: correlation with vascular structure. J Vasc Res. 1996;33:235–248.[Medline] [Order article via Infotrieve]
6. Hirata Y, Takagi Y, Fukuda Y, Marumo F. Endothelin is a potent mitogen for rat vascular smooth muscle cells. Atherosclerosis. 1989;78:225–228.[Medline] [Order article via Infotrieve]
7.
Bobik A, Grooms A,
Millar JA, Mitchell A, Grinpukel S. Growth factor activity of
endothelin on vascular smooth muscle.
Am J Physiol. 1990;258:C408–C415.
8.
Takeda Y, Miyamori
I, Inaba S, Furukawa K, Hatakeyama H, Yoneda T, Mabuchi H, Takeda R.
Vascular aldosterone in genetically hypertensive rats.
Hypertension. 1997;29:45–48.
9.
Rossi G-P, Belloni
AS, Albertin G, Zanin L, Biasolo MA, Nussdorfer GG, Palu G, Pessina AC.
Endothelin-1 and its receptors A and B in human
aldosterone-producing adenomas.
Hypertension. 1995;25:842–847.
10.
Pitt B, Zannad F,
Remme WJ, Cody R, Castaigne A, Perez A, Palensky J, Wittes J. The
effect of spironolactone on morbidity and mortality in patients with
severe heart failure: Randomized Aldactone Evaluation Study
Investigators. N Engl J
Med. 1999;341:709–717.
11.
Sutsch G, Kiowski
W, Yan XW, Hunziker P, Christen S, Strobel W, Kim JH, Rickenbacher P,
Bertel O. Short-term oral endothelin-receptor antagonist
therapy in conventionally treated patients with symptomatic
severe chronic heart failure.
Circulation. 1998;98:2262–2268.
12.
Schiffrin EL,
Park JB, Intengan HD, Touyz RM. Correction of arterial
structure and endothelial dysfunction in human
essential hypertension by the angiotensin receptor
antagonist losartan.
Circulation. 2000;101:1653–1659.
13. Intengan HD, Park J-B, Schiffrin EL. Blood pressure, resistance artery structure and mechanics in DOCA-salt–treated vasopressin-deficient Brattleboro rats: role of endothelin. Hypertension. 1999;34(pt 2):907–913.
14. Schiffrin EL, Thibault G. Plasma endothelin in human essential hypertension. Am J Hypertens. 1991;4:303–308.[Medline] [Order article via Infotrieve]
15.
Heagerty AM,
Aalkjaer C, Bund SJ, Korsgaard N, Mulvany MJ. Small artery structure in
hypertension: dual processes of remodeling and growth.
Hypertension. 1993;21:391–397.
16. Mulvany MJ, Baumbach GL, Aalkjaer C, Heagerty AM, Korsgaard N, Schiffrin EL, Heistad DD. Vascular remodeling. Hypertension. 1996;28:505–506. Letter.
17.
Barton M,
d’Uscio LV, Shaw S, Meyer P, Moreau P, Luscher TF. ET(A) receptor
blockade prevents increased tissue endothelin-1, vascular
hypertrophy, and endothelial dysfunction in
salt-sensitive hypertension.
Hypertension. 1998;31:499–504.
18.
Moreau P,
d’Uscio LV, Shaw S, Takase H, Barton M, Luscher TF.
Angiotensin II increases tissue endothelin and induces
vascular hypertrophy: reversal by ET(A)-receptor
antagonist.
Circulation. 1997;96:1593–1597.
19. Brilla CG, Matsubara LS, Weber KT. Anti-aldosterone treatment and the prevention of myocardial fibrosis in primary and secondary hyperaldosteronism. J Mol Cell Cardiol. 1993;25:563–575.[Medline] [Order article via Infotrieve]
20.
Ammarguellat F,
Larouche I, Schiffrin EL. Myocardial fibrosis in DOCA-salt hypertensive
rats: effect of endothelin ETA receptor
antagonism. Circulation. 2001;103:319–324.
21.
Wagner OF, Christ
G, Wojta J, VierhapperH, Parzer S, Nowotny PJ, Schneider B, Waldhäusl
W, Binder BR. Polar secretion of endothelin-1 by cultured
endothelial cells. J
Biol Chem. 1992;267:16066–16068.
22. Nguyen PV, Parent A, Deng LY, Flückiger JP, Thibault G, Schiffrin EL. Endothelin vascular receptors and responses in deoxycorticosterone acetate-salt hypertensive rats. Hypertension. 1992;19(suppl II):II-98–II-104.
23. Rizzoni D, Castellano M, Porteri E, Bettoni G, Muiesan ML, Agabiti-Rosei E. Vascular structural and functional alterations before and after the development of hypertension in SHR. Am J Hypertens. 1994;7:193–200.[Medline] [Order article via Infotrieve]
24. Park JB, Schiffrin EL. Small artery remodeling is the first manifestation of target organ damage in mild essential hypertension. Hypertension. 2000;36:684. Abstract.
25.
Farquharson CA,
Struthers AD. Spironolactone increases nitric oxide bioactivity,
improves endothelial vasodilator dysfunction, and
suppresses vascular angiotensin I/angiotensin
II conversion in patients with chronic heart failure.
Circulation. 2000;101:594–597.
26. Heistad DD, Baumbach GL. Cerebral vascular changes during chronic hypertension: good guys and bad guys. J Hypertens. 1992;10(suppl 7):S71–S75.
27.
Crofton JT, Share
L, Shade RE, Lee-Kwon WJ, Manning M, Sawyer WH. The importance of
vasopressin in the development and maintenance of DOCA-salt
hypertension in the rat.
Hypertension. 1979;1:31–38.
28. Larivière R, St-Louis J, Schiffrin EL. Vascular binding sites and biological activity of vasopressin in DOCA-salt hypertensive rats. J Hypertens. 1988;6:211–217.[Medline] [Order article via Infotrieve]
29.
Intengan HD, He
G, Schiffrin EL. Effect of V1 vasopressin antagonism on small artery
structure and vascular expression of preproendothelin-1 in DOCA-salt
hypertensive rats.
Hypertension. 1998;32:770–777.
30.
Lombes M, Oblin
ME, Gasc JM, Baulieu EE, Farman N, Bonvalet JP. Immunohistochemical and
biochemical evidence for a cardiovascular
mineralocorticoid receptor. Circ
Res. 1992;71:503–510 .
31.
Hatakeyama H,
Miyamori I, Fujita T, Takeda Y, Takeda R, Yamamoto H. Vascular
aldosterone: biosynthesis and a link to
angiotensin II-induced hypertrophy of vascular
smooth muscle cells. J Biol
Chem. 1994;269:24316–24320.
32.
Rocha R, Chander
PN, Khanna K, Zuckerman A, Stier CT Jr. Mineralocorticoid blockade
reduces vascular injury in stroke-prone hypertensive rats.
Hypertension. 1998;31:451–458.
33.
Rizzoni D,
Porteri E, Castellano M, Bettoni G, Muiesan ML, Muiesan P, Giulini SM,
Agabiti-Rosei E. Vascular hypertrophy and remodeling in
secondary hypertension.
Hypertension. 1996;28:785–790.
34.
Rossi GP,
Sacchetto A, Rizzoni D, Bova S, Porteri E, Mazzocchi G, Belloni AS,
Bahcelioglu M, Nussdorfer GG, Pessina AC. Blockade of
angiotensin II type 1 receptor and not of endothelin
receptor prevents hypertension and cardiovascular
disease in transgenic (mREN2)27 rats via adrenocortical
steroid-independent mechanisms.
Arterioscler Thromb Vasc Biol. 2000;20:949–956.
35. Sventek P, Turgeon A, Garcia R, Schiffrin EL. Vascular and cardiac overexpression of endothelin-1 gene in one-kidney one clip Goldblatt hypertensive rats but only in the late phase of two-kidney one clip Goldblatt hypertension. J Hypertens. 1996;14:57–64.[Medline] [Order article via Infotrieve]
36. Li JS, Knafo L, Turgeon A, Garcia R, Schiffrin EL. Effect of endothelin antagonism on blood pressure and vascular structure in renovascular hypertensive rats. Am J Physiol. 1996;40:H88–H93.
37.
Hoffman A, Abassi
ZA, Brodsky S, Ramadan R, Winaver J. Mechanisms of big
endothelin-1–induced diuresis and natriuresis: role of ET(B)
receptors. Hypertension. 2000;35:732–739.
This article has been cited by other articles:
 |
|
 |
|
  D. W. Anggrahini, N. Emoto, K. Nakayama, B. Widyantoro, S. Adiarto, N. Iwasa, H. Nonaka, Y. Rikitake, Y. Y. Kisanuki, M. Yanagisawa, et al. Vascular endothelial cell-derived endothelin-1 mediates vascular inflammation and neointima formation following blood flow cessation Cardiovasc Res, April 1, 2009; 82(1): 143 - 151. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Grossmann, A. W. Krug, R. Freudinger, S. Mildenberger, K. Voelker, and M. Gekle Aldosterone-induced EGFR expression: interaction between the human mineralocorticoid receptor and the human EGFR promoter Am J Physiol Endocrinol Metab, June 1, 2007; 292(6): E1790 - E1800. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Wong, F. E. Brennan, M. J. Young, P. J. Fuller, and T. J. Cole A Direct Effect of Aldosterone on Endothelin-1 Gene Expression in Vivo Endocrinology, April 1, 2007; 148(4): 1511 - 1517. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Nielsen, T.-H. Kwon, J. Frokiaer, M. A. Knepper, and S. Nielsen Maintained ENaC trafficking in aldosterone-infused rats during mineralocorticoid and glucocorticoid receptor blockade Am J Physiol Renal Physiol, January 1, 2007; 292(1): F382 - F394. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. R. Chade, J. D. Krier, S. C. Textor, A. Lerman, and L. O. Lerman Endothelin-A Receptor Blockade Improves Renal Microvascular Architecture and Function in Experimental Hypercholesterolemia J. Am. Soc. Nephrol., December 1, 2006; 17(12): 3394 - 3403. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Buss, J. Backs, M. M. Kreusser, S. E. Hardt, C. Maser-Gluth, H. A. Katus, and M. Haass Spironolactone Preserves Cardiac Norepinephrine Reuptake in Salt-Sensitive Dahl Rats Endocrinology, May 1, 2006; 147(5): 2526 - 2534. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. L. Schiffrin Effects of Aldosterone on the Vasculature Hypertension, March 1, 2006; 47(3): 312 - 318. [Full Text] [PDF]
|
|
|
|
|
|
C. L. Laffer, R. J. Bolterman, J. C. Romero, and F. Elijovich Effect of Salt on Isoprostanes in Salt-Sensitive Essential Hypertension Hypertension, March 1, 2006; 47(3): 434 - 440. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Fraccarollo, P. Galuppo, I. Schmidt, G. Ertl, and J. Bauersachs Additive amelioration of left ventricular remodeling and molecular alterations by combined aldosterone and angiotensin receptor blockade after myocardial infarction Cardiovasc Res, July 1, 2005; 67(1): 97 - 105. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. J. Zieman, V. Melenovsky, and D. A. Kass Mechanisms, Pathophysiology, and Therapy of Arterial Stiffness Arterioscler Thromb Vasc Biol, May 1, 2005; 25(5): 932 - 943. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. M. Pollock Endothelin, Angiotensin, and Oxidative Stress in Hypertension Hypertension, April 1, 2005; 45(4): 477 - 480. [Full Text] [PDF]
|
|
|
|
 |
|
 E. L. Schiffrin and R. M. Touyz Calcium, Magnesium, and Oxidative Stress in Hyperaldosteronism Circulation, February 22, 2005; 111(7): 830 - 831. [Full Text] [PDF]
|
|
|
|
|
|
E. L. Schiffrin The Many Targets of Aldosterone Hypertension, May 1, 2004; 43(5): 938 - 940. [Full Text] [PDF]
|
|
|
|
 |
|
 A. Ergul, V. Portik-Dobos, A. D. Giulumian, M. M. Molero, and L. C. Fuchs Stress upregulates arterial matrix metalloproteinase expression and activity via endothelin A receptor activation Am J Physiol Heart Circ Physiol, November 1, 2003; 285(5): H2225 - H2232. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. E. Callera, R. M. Touyz, S. A. Teixeira, M. N. Muscara, M. H. C. Carvalho, Z. B. Fortes, D. Nigro, E. L. Schiffrin, and R. C. Tostes ETA Receptor Blockade Decreases Vascular Superoxide Generation in DOCA-Salt Hypertension Hypertension, October 1, 2003; 42(4): 811 - 817. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Pitt, C. T Stier Jr, and S. Rajagopalan Mineralocorticoid receptor blockade: new insights into the mechanism of action in patients with cardiovascular disease Journal of Renin-Angiotensin-Aldosterone System, September 1, 2003; 4(3): 164 - 168. [Abstract] [PDF]
|
|
|
|
|
|
Q. Pu, M. F. Neves, A. Virdis, R. M. Touyz, and E. L. Schiffrin Endothelin Antagonism on Aldosterone-Induced Oxidative Stress and Vascular Remodeling Hypertension, July 1, 2003; 42(1): 49 - 55. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. T. Yu Progression of Chronic Renal Failure Arch Intern Med, June 23, 2003; 163(12): 1417 - 1429. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. M. Engler, M. B. Engler, D. M. Pierson, L. B. Molteni, and A. Molteni Effects of Docosahexaenoic Acid on Vascular Pathology and Reactivity in Hypertension Experimental Biology and Medicine, March 1, 2003; 228(3): 299 - 307. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. N. Muller, A. Mullally, R. Dechend, J.-K. Park, A. Fiebeler, B. Pilz, B.-M. Loffler, D. Blum-Kaelin, S. Masur, H. Dehmlow, et al. Endothelin-Converting Enzyme Inhibition Ameliorates Angiotensin II-Induced Cardiac Damage Hypertension, December 1, 2002; 40(6): 840 - 846. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Lacolley, C. Labat, A. Pujol, C. Delcayre, A. Benetos, and M. Safar Increased Carotid Wall Elastic Modulus and Fibronectin in Aldosterone-Salt-Treated Rats: Effects of Eplerenone Circulation, November 26, 2002; 106(22): 2848 - 2853. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Virdis, M. F. Neves, F. Amiri, E. Viel, R. M. Touyz, and E. L. Schiffrin Spironolactone Improves Angiotensin-Induced Vascular Changes and Oxidative Stress Hypertension, October 1, 2002; 40(4): 504 - 510. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Z. Ammarguellat, P. O. Gannon, F. Amiri, and E. L. Schiffrin Fibrosis, Matrix Metalloproteinases, and Inflammation in the Heart of DOCA-Salt Hypertensive Rats: Role of ETA Receptors Hypertension, February 1, 2002; 39(2): 679 - 684. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. D. Intengan and E. L. Schiffrin Vascular Remodeling in Hypertension: Roles of Apoptosis, Inflammation, and Fibrosis Hypertension, September 1, 2001; 38(3): 581 - 587. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||