(Hypertension. 2001;37:1473.)
© 2001 American Heart Association, Inc.
Scientific Contributions |
From the Franz Volhard Clinic and Max Delbrück Center for Molecular Medicine (A.F.M., V.G., R.P., J.A.D.S., M.B., F.C.L.), Medical Faculty of the Charité, Humboldt University of Berlin, Germany; and the National Institute of Biostructures and Biosystems (A.F.M.), Osilo, Italy.
Correspondence to Dr Friedrich C. Luft, Franz Volhard Clinic, Wiltberg Strasse 50, 13122 Berlin, Germany. E-mail luft{at}fvk-berlin.de
| Abstract |
|---|
|
|
|---|
Key Words: bradykinin mice natriuresis kidney sodium, dietary
| Introduction |
|---|
|
|
|---|
| Methods |
|---|
|
|
|---|
The effects of acutely increased renal perfusion pressure (RPP) on pressure-diuresis-natriuresis relationships and on total renal blood flow (RBF) were examined in 5 B2 knockout mice weighing 24±1 g and 10 129Sv/J control mice weighing 27±0.5 g that received standard mouse chow (0.25% sodium) and in 6 B2 knockout mice weighing 24±0.4 g and 6 129Sv/J control mice weighing 28±0.1 g that received 3 to 4 weeks of 4% NaCl mouse chow. We relied on techniques described earlier,17 but without performing the unilateral nephrectomy. After surgery and a 30- to 45-minute equilibration period, mean arterial pressure (MAP) and RBF were recorded continuously, and urine was sampled in two 10- to 30-minute collection periods. RPP was then increased by tying off the mesenteric and celiac arteries and, thereafter, by occluding the aorta below the kidney. Blood pressure and RBF were calculated for each period by averaging all recorded values during that time period. Urinary flow was sampled and determined gravimetrically. Urinary sodium and potassium (date not shown) concentrations were determined by flame photometry (FLM3, Radiometer) or by ion-selective electrode (Konelab Microlyte 3+2). Urinary flow, sodium excretion, and RBF were normalized per gram kidney wet weight.
The effects of changes in RPP on glomerular filtration rate (GFR) and fractional excretion of sodium and of water were examined in 8 B2 knockout mice weighing 25±1 g and 8 129Sv/J control mice weighing 29±1 g that received standard mouse chow and also in 7 B2 knockout mice weighing 28±1 g and 6 129Sv/J mice weighing 31±1 g that received 4% NaCl mouse chow for 3 to 4 weeks. The mice were surgically prepared as described elsewhere.17 GFR was measured by inulin clearance, and for this measurement, an additional catheter (PE-10) was placed into the second jugular vein for infusion of a 1% FITC inulin in 0.9% NaCl solution (Sigma Chemical Co).
For statistical analysis, we relied on the SIGMASTAT program to perform 2-way ANOVA. When differences were found, the t test (Bonferroni) was performed. Significance was accepted at P<0.05. Data are given as mean±SEM.
Genomic DNA isolated from tissues was used to genotype the mice by PCR. The presence of the B2 receptor gene was verified by the amplification of a 360-bp fragment by using the primers IMR434 (TGTCCTCAGCGTGTTCTTCC) and IMR435 (GGTCCTGAACACCAACATGG), and the neomycin resistance gene was detected by a 280-bp product by using the primers IMR013 (CTTGGGTGGAGAGGCTATTC) and IMR014 (AGGTGAGATGACAGGA-GATC).
| Results |
|---|
|
|
|---|
|
|
|
The baroreceptorheart rate reflex sensitivity and the baroreceptor reflex activity were not different between the strains and leveled at 2.68±0.2 ms/mm Hg or 29±5 sequences per 10 000 heart beats, respectively. A high salt diet increased the baroreceptorheart rate reflex sensitivity and activity in all mice, so that these parameters leveled at 4.06±0.4 ms/mm Hg or 34±3 sequences per 10 000 heart beats, respectively.
Figure 4 shows the pressure-diuresis curves (left top panel), pressure-natriuresis curves (left middle panel), and RBF (left bottom panel) in B2 receptor knockout and 129Sv/J control mice fed the usual mouse chow. The curves show similar results in the 2 strains. Figure 4 also shows the fractional excretion of water (right top panel), fractional excretion of sodium (right middle panel), and GFR (right bottom panel) in B2 receptor knockout and 129Sv/J mice. In these experiments, baseline RPP levels were slightly different from the values found in the set of experiments shown in the left panels. These small differences may have resulted from biological variability or additional volume infusions. The pressure-diuresis-natriuresis curves calculated for the mice were not different between the groups and were similar to the above-described results. Figure 5 shows similar data displayed in the same fashion as in Figure 4 during the high salt intake. RBF increased significantly in control mice fed a high salt diet compared with control mice given normal mouse chow. Otherwise, the pressure-diuresis and pressure-natriuresis curves of the 2 strains were not different. Finally, the hematocrits were measured under both conditions of salt intake, showing that the experiments were performed in hydrated mice.
|
|
| Discussion |
|---|
|
|
|---|
Presumably, differences in the control strain could explain in part our results, although our knockout strain failed to show characteristics described earlier.7 Alfie et al6 18 and Rhaleb et al19 used SV129/SvEv and 129/SvEvTac as controls and also found no baseline blood pressure differences. However, in contrast to the present study, blood pressure increased in B2 receptordeficient mice as salt intake was increased in the earlier studies.6 7 18 However, the mice in the studies of Alfie et al6 18 received a much higher salt load over a longer time than did the mice in our study, so that the experimental parameters were quite different from ours and may be responsible for the different results. Either an increased or no change in sensitivity to deoxycorticosterone acetate-salt has been reported for B2 receptordeficient mice.19 20 We found no increases in heart rate or altered baroreceptor control of heart rate in our animals, with or without a high salt diet, as have been described by others.21 22 We did observe an increase in baroreceptor heart rate reflex activity and sensitivity with the higher salt intake. This effect corresponds with data from mice and rats showing that a high salt diet increases the amplitude in the arterial pressure circadian rhythm.14 23 24 Taken together, we have no reason to suspect that early developmental processes determining heart rate in B2 receptordeficient mice are different from those in the other mice. Telemetry allowed us to calculate locomotion and the aortic blood pressure velocity (dP/dt), which is an indirect indicator of stroke volume.25 Only B1 receptor knockout mice exhibited increases in heart rate and locomotion under baseline conditions; otherwise, these parameters were not different between the groups. The differences in heart rate and blood pressure in B2 receptor knockout mice are subtle and protocol dependent. Furthermore, differences in the genetic background of the experimental mice may be important. For instance, in angiotensin II type 2 receptor knockout mice with different genetic backgrounds, either a slightly increased blood pressure14 26 or no change in blood pressure was described.27
The kidney controls the relationship between RPP and sodium and water excretion, a phenomenon termed pressure-natriuresis-diuresis.12 Recently, we showed that pressure-diuresis-natriuresis can be measured in mice.17 28 Intrarenal infusion of bradykinin causes vasodilatation, diuresis, and natriuresis.10 29 Kinins may be part of the mechanism coupling changes in arterial pressure and sodium excretion and, therefore, could contribute to long-term arterial pressure regulation.11 Others, on the other hand, showed that intrarenal kinins are not short-term regulators of electrolyte and water balance and are not necessarily involved in pressure-diuresis and pressure-natriuresis.30 A shifted pressure-natriuresis relationship has been postulated for B2 receptor knockout mice.21 However, in accordance with the telemetric recording of arterial blood pressure, we found that the curves of pressure-natriuresis and pressure-diuresis were not different from control curves at either level of salt intake. Thus, fractional sodium and water excretion, RBF, and GFR also showed similar values in the 2 strains. In agreement with an earlier study using SV129Sv/Ev as control mice,6 RBF was increased when the control mice were fed a high salt diet. This effect was not seen in B2 receptordeficient mice and could therefore be a kinin-dependent effect, as was suggested by Alfie et al.6 In salt-resistant Dahl rats, endogenous bradykinin does not participate in basal blood pressure homeostasis, although it appears to play an important role in blood pressure regulation in Dahl salt-sensitive rats.31 Our B2 receptor knockout mice were not salt sensitive. Therefore, the vasodilatation and sodium- and water-excreting role of bradykinin must have been assumed by other systems regulating sodium and water elimination, as well as blood pressure. Under this assumption, bradykinin participates in the regulation of renal function and blood pressure only when other systems are inhibited.32 In summary, we showed that B2 receptor knockout mice have blood pressure and heart rate values in the range described for other mouse strains. Blood pressure and heart rate were not affected by increasing the dietary salt intake. In accordance with these results, pressure-natriuresis curves, pressure-diuresis curves, RBF, and GFR were not different between B2 receptor knockout and 129Sv/J mice. Increasing dietary salt intake increased RBF in 129Sv/J mice; other renal function parameters were not different between the groups. These data show that differences in the genetic background or an adaptation to the loss of the B2 receptor may have changed the phenotype of bradykinin B2 receptor knockout mice. We do not have reason to believe that our control mice were responsible for our failure to find differences between B2 receptor knockout mice and control mice. We suggest that redundant systems adjusted for the absence of the B2 receptor in our mice. These adjustments were evidently not operative in earlier studies7 20 21 22 and required generations to develop. Elucidating the nature of these adjustments will give important physiological insights and will expand the utility of the gene-disruption technique. One approach will be to perform microarray-assisted gene expression studies in the kidney or other relevant tissues. We are preparing to perform such studies.
| Acknowledgments |
|---|
Received August 8, 2000; first decision September 27, 2000; accepted December 7, 2000.
| References |
|---|
|
|
|---|
2. Bhoola KD, Figueroa CD, Worthy K. Bioregulation of kinins: kallikreins, kininogens, and kininases. Pharmacol Rev. 1992;44:180.[Medline] [Order article via Infotrieve]
3. Hall JM. Bradykinin receptors: pharmacological properties and biological roles. Pharmacol Ther. 1992;56:131190.[Medline] [Order article via Infotrieve]
4.
Margolius HS.
Kallikreins and kinins: some unanswered questions about system
characteristics and roles in human disease.
Hypertension. 1995;26:221229.
5.
Majima M, Yoshida
O, Mihara H, Muto T, Mizogami S, Kuribayashi Y, Katori M, Ohishi S.
High sensitivity to salt in kininogen-deficient Brown Norway Katholiek
rats. Hypertension. 1993;22:705714.
6. Alfie ME, Sigmon DH, Pomposiello SI, Carrettero OA. Effect of high salt intake in mutant mice lacking bradykinin B2 receptors. Hypertension. 1997;29(pt 2):483487.
7.
Madeddu P, Varoni
MV, Palomba D, Emanueli C, Demontis MP, Glorioso N, Dessi-Fulgheri P,
Sarzani R, Anania V. Cardiovascular phenotype
of a mouse strain with disruption of bradykinin
B2-receptor gene.
Circulation. 1997;96:35703578.
8. Wang D, Yoshida H, Song Q, Chao L, Chao J. Enhanced renal function in bradykinin B2 receptor transgenic mice. Am J Physiol. 2000;278:F484F491.
9.
Fenoy FJ, Roman RJ.
Effect of kinin receptor antagonists on renal
hemodynamic and natriuretic responses to
volume expansion. Am J
Physiol. 1992;263:R1136R1140.
10.
Mattson DL,
Cowley AW. Kinin actions on renal papillary blood flow and sodium
excretion. Hypertension. 1993;21:9619965.
11.
Tornel J, Madrid
MI, Garcia-Salom M, Wirth KJ, Fenoy FJ. Role of kinins in the control
of renal papillary blood flow, pressure natriuresis, and
arterial pressure. Circ
Res. 2000;86:589595.
12.
Cowley AW, Roman
RJ. The role of the kidney in hypertension.
JAMA. 1996;275:15811589.
13.
Pesquero JB,
Araujo RC, Heppenstall PA, Stucky CL, Silva JA Jr, Walther T, Oliveira
SM, Pesquero JL, Paiva ACM, Calixto JB, Lewin GR, Bader M. Hypoalgesia
and altered inflammatory responses in mice lacking kinin B1 receptors.
Proc Natl Acad Sci
U S A. 2000;97:81408145.
14. Gross V, Milia AF, Plehm R, Inagami T, Luft FC. Long-term blood pressure telemetry in AT2 receptor disrupted mice. J Hypertens. 2000;18:955961.[Medline] [Order article via Infotrieve]
15. Bertinieri G, Di Rienzo M, Cavallazzi A, Ferrari AU, Pedotti A, Mangia G. A new approach to analysis of arterial baroreceptor. J Hypertens. 1985;3(suppl 3):S79S81.
16. Stauss HM, Gödecke A, Mrowka R, Schrader J, Persson PB. Enhanced blood pressure variability in eNOS knockout mice. J Hypertens. 1999;3:13591363.
17. Gross V, Schunck WH, Honeck H, Milia AF, Kärgel E, Walther T, Bader M, Inagami T, Schneider W, Luft FC. Inhibition of pressure natriuresis in mice lacking the AT2 receptor. Kidney Int. 2000;57:191202.[Medline] [Order article via Infotrieve]
18. Alfie ME, Yang XP, Hess F, Carrettero OA. Salt-sensitive hypertension in bradykinin B2 receptor knockout mice. Biochem Biophys Res Com. 1996;224:625630.[Medline] [Order article via Infotrieve]
19. Rhaleb NE, Peng H, Alfie ME, Shesely EG, Carrettero OA. Effect of ACE inhibitor on DOCA salt and aortic coarctation-induced hypertension in mice: do kinin B2 receptor play a role? Hypertension. 1999;33(pt II):329334.
20.
Emanueli C, Fink
E, Milia AF, Salis MB, Conti M, Demontis MP, Madeddu P. Enhanced blood
pressure sensitivity to deoxycorticosterone in mice with disruption of
bradykinin B2 receptor gene.
Hypertension. 1998;31:12781283.
21. Emanueli C, Madeddu P. Role of the kallikrein-kinin system in the maturation of cardiovascular phenotype. Am J Hypertens. 1999;12:988999.[Medline] [Order article via Infotrieve]
22. Madeddu P, Salis MB, Emanueli C. Altered baroreflex control of heart rate in bradykinin B2 receptor knockout mice. Immunopharmacology. 1999;45:2127.[Medline] [Order article via Infotrieve]
23.
Carlson SH, Wyss
JM. Long-term telemetric recording of arterial
pressure and heart rate in mice fed basal and high NaCl diets.
Hypertension. 2000;35:e1e5.
24.
Calhoun DA,
Zhu ST, Chen YF, Oparil S. Gender and dietary NaCl in spontaneously
hypertensive and Wistar-Kyoto rats.
Hypertension. 1995;26:285289.
25.
Pons M, Schnecko
A, Witte K, Lemmer B, Waterhouse JM, Cambar J. Circadian rhythm in
renal function in hypertensive TGR(mRen-2)27 rats and their
normotensive controls. Am J
Physiol. 1996;271:R1002R1008.
26. Ichiki T, Labosky PA, Shiota C, Okuyama S, Imagawa Y, Fogo A, Nimura F, Ichikawa I, Hogan BL, Inagami T. Effect of blood pressure and exploratory behaviour of mice lacking the angiotensin II type-2 receptor. Nature. 1995;377:748750.[Medline] [Order article via Infotrieve]
27. Hein L, Barsh GS, Pratt RE, Dzau VJ, Kobilka BK. Behavioural and cardiovascular effects of disrupting the angiotensin II type-2 receptor gene in mice. Nature. 1995;377:744747.[Medline] [Order article via Infotrieve]
28. Gross V, Lippoldt A, Luft FC. Pressure diuresis and natriuresis in DOCA-salt mice. Kidney Int. 1997;52:13641368.[Medline] [Order article via Infotrieve]
29. Granger JP, Hall JE. Acute and chronic action of bradykinin on renal function and arterial pressure. Am J Physiol. 1985;248:F87F92.
30.
Strick DM,
Fiksen-Olsen MJ, Carretero OA, Romero JC. Renal kinin antagonism does
not impair pressure-induced natriuresis.
Am J Physiol. 1992;263:F77F82.
31. Benetos A, Bouaziz H, Safar M. Salt Sensitivity and Bradykinin Activity in Rats: Recent Progress on Kinins. Basel, Switzerland: Birkhäuser Verlag; 1992:228234.
32. Waeber B, Niederberger M, Gavras H, Gavras H, Nussberger J, Brunner HR. Hemodynamic effects of a kinin antagonist. J Cardiovasc Pharmacol. 1990;15(suppl 6):S78S82.
This article has been cited by other articles:
![]() |
P. D. Metcalfe, J. A. Leslie, M. T. Campbell, D. R. Meldrum, K. L. Hile, and K. K. Meldrum Testosterone exacerbates obstructive renal injury by stimulating TNF-{alpha} production and increasing proapoptotic and profibrotic signaling Am J Physiol Endocrinol Metab, February 1, 2008; 294(2): E435 - E443. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ifuku, K. Farber, Y. Okuno, Y. Yamakawa, T. Miyamoto, C. Nolte, V. F. Merrino, S. Kita, T. Iwamoto, I. Komuro, et al. Bradykinin-Induced Microglial Migration Mediated by B1-Bradykinin Receptors Depends on Ca2+ Influx via Reverse-Mode Activity of the Na+/Ca2+ Exchanger J. Neurosci., November 28, 2007; 27(48): 13065 - 13073. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cayla, M. Todiras, R. Iliescu, V. V. Saul, V. Gross, B. Pilz, G. Chai, V. F. Merino, J. B. Pesquero, O. C. Baltatu, et al. Mice deficient for both kinin receptors are normotensive and protected from endotoxin-induced hypotension FASEB J, June 1, 2007; 21(8): 1689 - 1698. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. LeFebvre, A. Shintani, T. Gebretsadik, J. R. Petro, L. J. Murphey, and N. J. Brown Bradykinin B2 Receptor Does Not Contribute to Blood Pressure Lowering during AT1 Receptor Blockade J. Pharmacol. Exp. Ther., March 1, 2007; 320(3): 1261 - 1267. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kakoki, N. Takahashi, J. C. Jennette, and O. Smithies Diabetic nephropathy is markedly enhanced in mice lacking the bradykinin B2 receptor PNAS, September 7, 2004; 101(36): 13302 - 13305. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Murphey, W. K. Eccles, G. H. Williams, and N. J. Brown Loss of Sodium Modulation of Plasma Kinins in Human Hypertension J. Pharmacol. Exp. Ther., March 1, 2004; 308(3): 1046 - 1052. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Qi, I. Whitt, A. Mehta, J. Jin, M. Zhao, R. C. Harris, A. B. Fogo, and M. D. Breyer Serial determination of glomerular filtration rate in conscious mice using FITC-inulin clearance Am J Physiol Renal Physiol, March 1, 2004; 286(3): F590 - F596. [Abstract] [Full Text] |
||||
![]() |
P. M. Abadir, R. M. Carey, and H. M. Siragy Angiotensin AT2 Receptors Directly Stimulate Renal Nitric Oxide in Bradykinin B2-Receptor-Null Mice Hypertension, October 1, 2003; 42(4): 600 - 604. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Schanstra, J. Duchene, F. Praddaude, P. Bruneval, I. Tack, J. Chevalier, J.-P. Girolami, and J.-L. Bascands Regulation of Cardiovascular Signaling by Kinins and Products of Similar Converting Enzyme Systems: Decreased renal NO excretion and reduced glomerular tuft area in mice lacking the bradykinin B2 receptor Am J Physiol Heart Circ Physiol, June 1, 2003; 284(6): H1904 - H1908. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. D. Xiao, S. Fuchs, J. M. Cole, K. M. Disher, R. L. Sutliff, and K. E. Bernstein Regulation of Cardiovascular Signaling by Kinins and Products of Similar Converting-Enzyme Systems: Role of bradykinin in angiotensin-converting enzyme knockout mice Am J Physiol Heart Circ Physiol, June 1, 2003; 284(6): H1969 - H1977. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Gross and F. C. Luft Exercising Restraint in Measuring Blood Pressure in Conscious Mice Hypertension, April 1, 2003; 41(4): 879 - 881. [Full Text] [PDF] |
||||
![]() |
F. Trabold, S. Pons, A. A. Hagege, M. Bloch-Faure, F. Alhenc-Gelas, J.-F. Giudicelli, C. Richer-Giudicelli, and P. Meneton Cardiovascular Phenotypes of Kinin B2 Receptor- and Tissue Kallikrein-Deficient Mice Hypertension, July 1, 2002; 40(1): 90 - 95. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. A. Janssen and J. F. M. Smits Autonomic control of blood pressure in mice: basic physiology and effects of genetic modification Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2002; 282(6): R1545 - R1564. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Majima, M. Katori, N.-E. Rhaleb, X.-P. Yang, M. Nanba, E. G. Shesely, O. A. Carretero, P. Madeddu, N.-E. Rhaleb, X.-P. Yang, et al. Effect of Chronic Blockade of the Kallikrein-Kinin System on the Development of Hypertension in Rats * Response * Role of Kinins in Blood Pressure Regulation: Reality or Fiction * Response Hypertension, October 1, 2001; 38 (4): e21 - e23. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Hypertension Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2001 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |