Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 2001;37:1473-1479

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Milia, A. F.
Right arrow Articles by Luft, F. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Milia, A. F.
Right arrow Articles by Luft, F. C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*SODIUM
Related Collections
Right arrow Genetically altered mice
Right arrow Hypertension - basic studies

(Hypertension. 2001;37:1473.)
© 2001 American Heart Association, Inc.


Scientific Contributions

Normal Blood Pressure and Renal Function in Mice Lacking the Bradykinin B2 Receptor

Anna Franca Milia; Volkmar Gross; Ralph Plehm; Jose A. De Silva, Jr; Michael Bader; Friedrich C. Luft

From the Franz Volhard Clinic and Max Delbrück Center for Molecular Medicine (A.F.M., V.G., R.P., J.A.D.S., M.B., F.C.L.), Medical Faculty of the Charité, Humboldt University of Berlin, Germany; and the National Institute of Biostructures and Biosystems (A.F.M.), Osilo, Italy.

Correspondence to Dr Friedrich C. Luft, Franz Volhard Clinic, Wiltberg Strasse 50, 13122 Berlin, Germany. E-mail luft{at}fvk-berlin.de


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—Telemetric blood pressure determinations, heart rate measurements, and pressure-natriuresis-diuresis experiments were used to characterize cardiovascular and renal function in bradykinin B2 receptor knockout mice fed mouse chow containing 0.25% NaCl or mouse chow containing 4% NaCl. In B2 receptor knockout mice fed usual mouse chow, the mean arterial blood pressure leveled between 108±1 and 110±3 mm Hg, and the heart rate leveled between 520±26 and 525±29 bpm, values that were not different from those measured in B1 receptor knockout mice or 129Sv/J control mice. Increasing dietary salt intake did not affect mean arterial blood pressure and heart rate. Accordingly, pressure-natriuresis curves, pressure-diuresis curves, renal blood flow, and glomerular filtration rate were not different between B2 receptor knockout and 129Sv/J mice. Increasing dietary salt intake to 4% increased renal blood flow to levels between 8.41 and 9.50 mL/min per gram kidney wet weight in 129Sv/J mice, whereas in B2 receptor–deficient mice, renal blood flow was not affected and ranged between 6.85 and 7.88 mL/min per gram kidney wet weight. Other renal function parameters were not affected. Absence of B2 receptor function was verified in B2 receptor knockout mice with bradykinin infusion. These data suggest that the absence of B2 receptor function does not necessarily make B2 receptor knockout mice hypertensive or induce salt sensitivity. Presumably, differences in the genetic background or an adaptation to the loss of B2 receptor function may account for these results, in contrast with earlier reports involving B2 receptor knockout mice. We hold the latter possibility to be more likely and to be a fruitful possibility for future research.


Key Words: bradykinin • mice • natriuresis • kidney • sodium, dietary


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The kallikrein-kinin system plays an important role in regulating cardiovascular and renal function. Bradykinin, the major effector of the kallikrein-kinin system, acts through at least 2 receptors. The bradykinin type 2 (B2) receptor is believed to mediate most of the physiological functions, including vasodilatation, the natriuresis-diuresis relationship, and effects on cardiovascular structure.1 2 3 There is evidence that the kallikrein-kinin system is involved in hypertension. Patients with essential hypertension have lower kallikrein levels in their urine, and kininogen-deficient Brown Norway Katholiek rats develop salt-sensitive hypertension.4 5 Mutant mice lacking the B2 receptor also exhibit salt-sensitive hypertension, according to earlier reports.6 7 On the other hand, transgenic mice overexpressing the human B2 receptor are hypotensive. Blocking the B2 receptor with icatibant in these mice restores the blood pressure to normal.8 The importance of the B2 receptor has also been investigated in pharmacological studies. For instance, B2 receptor blockade blunts the natriuretic response to volume expansion.9 The local infusion of bradykinin into the renal medullary interstitium increases sodium and water excretion.10 The pharmacological blockade of the B2 receptor shifts pressure natriuresis and diuresis curves rightward and induces arterial hypertension associated with sodium and volume retention.11 Given the important role of the kidney in blood pressure regulation,12 we investigated the pressure-diuresis-natriuresis mechanism in B2 receptor knockout mice given a usual laboratory diet and at a high salt diet.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
B2 receptor knockout mice, obtained from breeder pairs supplied by the Pharmacology Department, University of Sassari (Sassari, Italy), are described in detail elsewhere.7 The 129Sv/J mice that were used as controls were derived from the Jackson Laboratory (Bar Harbor, Me). All mice were bred in our animal facility. The mice were allowed free access to standard chow (0.25% sodium) and drinking water ad libitum, or they received mouse chow with 4% NaCl by weight (SNIFF Spezialitäten GmbH). We used in our experiments the F4 to F6 generation of the breeder pairs The experimental protocol was approved by the local council on animal care, whose standards correspond to those of the American Physiological Society. All experiments were conducted in mice aged 15 to 17 weeks. Genotypes were verified by polymerase chain reaction (PCR) and pharmacologically by a bolus of bradykinin (30 nmol/100 g body wt) to confirm the absence of the B2 receptor. Telemetry was performed in 3 B2 receptor knockout mice, in 8 control mice, and in 4 B1 receptor knockout mice as an additional control; the latter mice are described elsewhere.13 The body weights averaged 28±1, 34±1, and 32±2 g before surgery in the 3 respective strains. The fewer numbers of B2 receptor mice studied is related to the difficulty of implanting the TA11PA-C20 blood pressure device in mice weighing <30 g. The telemetric techniques we used are described in detail elsewhere.14 The mice were synchronized to a light/dark schedule of 12/12 hours, with lights on at 6:00 AM. All mice were allowed at least 9 days of recovery before any measurements were made. Thereafter, baseline values were continuously recorded for 7 days, and the last 3 days of this period were used for statistical analysis. Then, the mice were given the 4% NaCl diet, and measurements were obtained at weekly intervals for 3 weeks. Once again, the last 3 days of each period were used for statistical analysis. The dietary salt load used is the same as that used when a test was made for salt sensitivity in these mice in an earlier study.7 All values were sampled every 5 minutes for 10 seconds continuously day and night, with a sampling rate of 1000 Hz. Values are shown as 24-hour means. For further evaluation of cardiovascular function, the baroreceptor heart rate reflex was investigated by using spontaneous changes in blood pressure and heart rate during a 2-hour period in which signals were sampled beat by beat. Baroreceptor heart rate reflex sensitivity was calculated by the sequence method. The number of sequences per 10 000 heart beats was used as an index of baroreceptor activity.15 16

The effects of acutely increased renal perfusion pressure (RPP) on pressure-diuresis-natriuresis relationships and on total renal blood flow (RBF) were examined in 5 B2 knockout mice weighing 24±1 g and 10 129Sv/J control mice weighing 27±0.5 g that received standard mouse chow (0.25% sodium) and in 6 B2 knockout mice weighing 24±0.4 g and 6 129Sv/J control mice weighing 28±0.1 g that received 3 to 4 weeks of 4% NaCl mouse chow. We relied on techniques described earlier,17 but without performing the unilateral nephrectomy. After surgery and a 30- to 45-minute equilibration period, mean arterial pressure (MAP) and RBF were recorded continuously, and urine was sampled in two 10- to 30-minute collection periods. RPP was then increased by tying off the mesenteric and celiac arteries and, thereafter, by occluding the aorta below the kidney. Blood pressure and RBF were calculated for each period by averaging all recorded values during that time period. Urinary flow was sampled and determined gravimetrically. Urinary sodium and potassium (date not shown) concentrations were determined by flame photometry (FLM3, Radiometer) or by ion-selective electrode (Konelab Microlyte 3+2). Urinary flow, sodium excretion, and RBF were normalized per gram kidney wet weight.

The effects of changes in RPP on glomerular filtration rate (GFR) and fractional excretion of sodium and of water were examined in 8 B2 knockout mice weighing 25±1 g and 8 129Sv/J control mice weighing 29±1 g that received standard mouse chow and also in 7 B2 knockout mice weighing 28±1 g and 6 129Sv/J mice weighing 31±1 g that received 4% NaCl mouse chow for 3 to 4 weeks. The mice were surgically prepared as described elsewhere.17 GFR was measured by inulin clearance, and for this measurement, an additional catheter (PE-10) was placed into the second jugular vein for infusion of a 1% FITC inulin in 0.9% NaCl solution (Sigma Chemical Co).

For statistical analysis, we relied on the SIGMASTAT program to perform 2-way ANOVA. When differences were found, the t test (Bonferroni) was performed. Significance was accepted at P<0.05. Data are given as mean±SEM.

Genomic DNA isolated from tissues was used to genotype the mice by PCR. The presence of the B2 receptor gene was verified by the amplification of a 360-bp fragment by using the primers IMR434 (TGTCCTCAGCGTGTTCTTCC) and IMR435 (GGTCCTGAACACCAACATGG), and the neomycin resistance gene was detected by a 280-bp product by using the primers IMR013 (CTTGGGTGGAGAGGCTATTC) and IMR014 (AGGTGAGATGACAGGA-GATC).


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Figure 1 shows the genotypic verification in B2 receptor knockout and 129Sv/J control mice. Figure 2 shows the responses to bradykinin infusion in a representative tracing from the 2 strains. Control mice showed a profound decrease in blood pressure and increase in heart rate. The B2 receptor knockout mouse, on the other hand, showed no response. Figure 3 shows 24-hour MAP, heart rate, and aortic pressure dP/dt values for B2 receptor knockout mice that received 0.25% and 4% NaCl food. The small differences between the groups were not significant. Furthermore, systolic and diastolic blood pressure values (not shown) were not different. Interestingly, B2 receptor knockout mice with the lowest heart rates showed the lowest locomotion (1.5±0.3 cpm), whereas the B1 receptor knockout mice with the highest heart rate values also had the highest locomotion (4±0.6 cpm). Increasing the salt content from 0.25% to 4% in the chow over 3 weeks did not influence MAP, systolic and diastolic blood pressures, or the heart rate levels in B2 receptor knockout and 129Sv/J control mice. Aortic pressure dP/dt values were not different between the strains under baseline conditions and during the salt-loading procedures.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 1. Control mice (+/+) exhibited the B2 receptor–specific PCR product (B2) and no PCR product characteristic for the neomycin resistance gene (neo), whereas B2 receptor–deficient mice (-/-) showed the opposite results.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 2. Representative tracing from a control mouse (129Sv/J, top) and a B2 receptor–deficient mice (B2-KO, bottom) when an intravenous bolus of bradykinin (30 nmol/100 g body wt [g Bwt]) was given. In the 129 Sv/J mouse, bradykinin reduced blood pressure and increased heart rate dramatically. In the B2 receptor knockout mouse, neither blood pressure nor heart rate was affected.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 3. MAP (top left panel), heart rate (HR, top right panel), locomotion (LA, bottom left panel), and aortic dP/dt (bottom right panel) in B2 receptor knockout (B2-KO, filled circles), B1 receptor knockout (B1-KO, filled triangles), and 129Sv/J (open circles) mice. With usual chow (0.25% NaCl [normal Na+]) and with 4% NaCl chow (high Na+), blood pressure and heart rate were not different among the strains.

The baroreceptor–heart rate reflex sensitivity and the baroreceptor reflex activity were not different between the strains and leveled at 2.68±0.2 ms/mm Hg or 29±5 sequences per 10 000 heart beats, respectively. A high salt diet increased the baroreceptor–heart rate reflex sensitivity and activity in all mice, so that these parameters leveled at 4.06±0.4 ms/mm Hg or 34±3 sequences per 10 000 heart beats, respectively.

Figure 4 shows the pressure-diuresis curves (left top panel), pressure-natriuresis curves (left middle panel), and RBF (left bottom panel) in B2 receptor knockout and 129Sv/J control mice fed the usual mouse chow. The curves show similar results in the 2 strains. Figure 4 also shows the fractional excretion of water (right top panel), fractional excretion of sodium (right middle panel), and GFR (right bottom panel) in B2 receptor knockout and 129Sv/J mice. In these experiments, baseline RPP levels were slightly different from the values found in the set of experiments shown in the left panels. These small differences may have resulted from biological variability or additional volume infusions. The pressure-diuresis-natriuresis curves calculated for the mice were not different between the groups and were similar to the above-described results. Figure 5 shows similar data displayed in the same fashion as in Figure 4 during the high salt intake. RBF increased significantly in control mice fed a high salt diet compared with control mice given normal mouse chow. Otherwise, the pressure-diuresis and pressure-natriuresis curves of the 2 strains were not different. Finally, the hematocrits were measured under both conditions of salt intake, showing that the experiments were performed in hydrated mice.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 4. Left, Relationship between RPP and urinary flow (top panel), sodium excretion (middle panel), and RBF (bottom panel) in B2 receptor knockout (B2-KO) and control (129Sv/J) mice with usual (0.25% NaCl) mouse chow. Pressure-diuresis and pressure-natriuresis curves and RBF were not different between the groups. Right, Relationship between RPP and fractional water excretion (% H2O excretion, top panel), fractional sodium excretion (% Na excretion, middle panel), and GFR (bottom panel) in B2-KO and control 129Sv/J mice with usual (0.25% NaCl) mouse chow. Curves for fractional sodium and water excretion and GFR were not different between the groups.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 5. Left, Relationship between RPP and urinary flow (top panel), sodium excretion (middle panel), and RBF (bottom panel) in B2 receptor knockout (B2-KO) and control (129Sv/J) mice with high dietary sodium intake (4% NaCl). Pressure-diuresis and pressure-natriuresis curves were not different between the groups. High dietary sodium intake increased RBF only in 129Sv/J mice compared with 129Sv/J mice fed normal mouse chow. Right, Relationship between RPP and fractional water excretion (% H2O excretion, top panel), fractional sodium excretion (% Na excretion, middle panel), and GFR (bottom panel) in B2-KO and 129Sv/J mice with high dietary sodium intake (4% NaCl). Curves for fractional sodium and water excretion and GFR were not different between the groups.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Contrary to what we had expected, we were not able to confirm hypertension in B2 receptor knockout mice compared with control mice. Because blood pressure values were not different, we were also not able to detect any differences in the pressure-diuresis-natriuresis relationships between the 2 strains. We challenged the B2 receptor knockout mice with a high salt intake; however, this maneuver had no effect on blood pressure or pressure-natriuresis relationships. The sole difference we found was an increase in RBF in control mice with salt loading. To avoid any confounding effects, we measured blood pressure, heart rate, and activity continuously with telemetry. We documented the absence of the B2 receptor in our mice both structurally and pharmacologically. These results are in stark contrast to those reported earlier in these same mice.7 We believe that these negative findings are important because they evidently underscore unappreciated physiological adjustments to major deficits that may require generations to develop.

Presumably, differences in the control strain could explain in part our results, although our knockout strain failed to show characteristics described earlier.7 Alfie et al6 18 and Rhaleb et al19 used SV129/SvEv and 129/SvEvTac as controls and also found no baseline blood pressure differences. However, in contrast to the present study, blood pressure increased in B2 receptor–deficient mice as salt intake was increased in the earlier studies.6 7 18 However, the mice in the studies of Alfie et al6 18 received a much higher salt load over a longer time than did the mice in our study, so that the experimental parameters were quite different from ours and may be responsible for the different results. Either an increased or no change in sensitivity to deoxycorticosterone acetate-salt has been reported for B2 receptor–deficient mice.19 20 We found no increases in heart rate or altered baroreceptor control of heart rate in our animals, with or without a high salt diet, as have been described by others.21 22 We did observe an increase in baroreceptor heart rate reflex activity and sensitivity with the higher salt intake. This effect corresponds with data from mice and rats showing that a high salt diet increases the amplitude in the arterial pressure circadian rhythm.14 23 24 Taken together, we have no reason to suspect that early developmental processes determining heart rate in B2 receptor–deficient mice are different from those in the other mice. Telemetry allowed us to calculate locomotion and the aortic blood pressure velocity (dP/dt), which is an indirect indicator of stroke volume.25 Only B1 receptor knockout mice exhibited increases in heart rate and locomotion under baseline conditions; otherwise, these parameters were not different between the groups. The differences in heart rate and blood pressure in B2 receptor knockout mice are subtle and protocol dependent. Furthermore, differences in the genetic background of the experimental mice may be important. For instance, in angiotensin II type 2 receptor knockout mice with different genetic backgrounds, either a slightly increased blood pressure14 26 or no change in blood pressure was described.27

The kidney controls the relationship between RPP and sodium and water excretion, a phenomenon termed pressure-natriuresis-diuresis.12 Recently, we showed that pressure-diuresis-natriuresis can be measured in mice.17 28 Intrarenal infusion of bradykinin causes vasodilatation, diuresis, and natriuresis.10 29 Kinins may be part of the mechanism coupling changes in arterial pressure and sodium excretion and, therefore, could contribute to long-term arterial pressure regulation.11 Others, on the other hand, showed that intrarenal kinins are not short-term regulators of electrolyte and water balance and are not necessarily involved in pressure-diuresis and pressure-natriuresis.30 A shifted pressure-natriuresis relationship has been postulated for B2 receptor knockout mice.21 However, in accordance with the telemetric recording of arterial blood pressure, we found that the curves of pressure-natriuresis and pressure-diuresis were not different from control curves at either level of salt intake. Thus, fractional sodium and water excretion, RBF, and GFR also showed similar values in the 2 strains. In agreement with an earlier study using SV129Sv/Ev as control mice,6 RBF was increased when the control mice were fed a high salt diet. This effect was not seen in B2 receptor–deficient mice and could therefore be a kinin-dependent effect, as was suggested by Alfie et al.6 In salt-resistant Dahl rats, endogenous bradykinin does not participate in basal blood pressure homeostasis, although it appears to play an important role in blood pressure regulation in Dahl salt-sensitive rats.31 Our B2 receptor knockout mice were not salt sensitive. Therefore, the vasodilatation and sodium- and water-excreting role of bradykinin must have been assumed by other systems regulating sodium and water elimination, as well as blood pressure. Under this assumption, bradykinin participates in the regulation of renal function and blood pressure only when other systems are inhibited.32 In summary, we showed that B2 receptor knockout mice have blood pressure and heart rate values in the range described for other mouse strains. Blood pressure and heart rate were not affected by increasing the dietary salt intake. In accordance with these results, pressure-natriuresis curves, pressure-diuresis curves, RBF, and GFR were not different between B2 receptor knockout and 129Sv/J mice. Increasing dietary salt intake increased RBF in 129Sv/J mice; other renal function parameters were not different between the groups. These data show that differences in the genetic background or an adaptation to the loss of the B2 receptor may have changed the phenotype of bradykinin B2 receptor knockout mice. We do not have reason to believe that our control mice were responsible for our failure to find differences between B2 receptor knockout mice and control mice. We suggest that redundant systems adjusted for the absence of the B2 receptor in our mice. These adjustments were evidently not operative in earlier studies7 20 21 22 and required generations to develop. Elucidating the nature of these adjustments will give important physiological insights and will expand the utility of the gene-disruption technique. One approach will be to perform microarray-assisted gene expression studies in the kidney or other relevant tissues. We are preparing to perform such studies.


*    Acknowledgments
 
This study was supported by grants-in-aid to V.G. and F.C.L. from the Deutsche Forschungsgemeinschaft. A.F.M. was supported by a Max Delbrück Center grant. We are grateful to Sabine Grüger for technical assistance. B2 receptor knockout mice were a generous gift from Dr Paolo Madeddu, National Institute of Biostructures and Biosystems, Osilo, Italy, and the Institute of Internal Medicine, University of Sassari, Sassari, Italy.

Received August 8, 2000; first decision September 27, 2000; accepted December 7, 2000.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Taylor JE, DeFeudis FV, Moreau JP. Bradykinin antagonists: therapeutic perspectives. Drug Dev Res. 1989;16:1–11.

2. Bhoola KD, Figueroa CD, Worthy K. Bioregulation of kinins: kallikreins, kininogens, and kininases. Pharmacol Rev. 1992;44:1–80.[Medline] [Order article via Infotrieve]

3. Hall JM. Bradykinin receptors: pharmacological properties and biological roles. Pharmacol Ther. 1992;56:131–190.[Medline] [Order article via Infotrieve]

4. Margolius HS. Kallikreins and kinins: some unanswered questions about system characteristics and roles in human disease. Hypertension. 1995;26:221–229.[Abstract/Free Full Text]

5. Majima M, Yoshida O, Mihara H, Muto T, Mizogami S, Kuribayashi Y, Katori M, Ohishi S. High sensitivity to salt in kininogen-deficient Brown Norway Katholiek rats. Hypertension. 1993;22:705–714.[Abstract/Free Full Text]

6. Alfie ME, Sigmon DH, Pomposiello SI, Carrettero OA. Effect of high salt intake in mutant mice lacking bradykinin B2 receptors. Hypertension. 1997;29(pt 2):483–487.

7. Madeddu P, Varoni MV, Palomba D, Emanueli C, Demontis MP, Glorioso N, Dessi-Fulgheri P, Sarzani R, Anania V. Cardiovascular phenotype of a mouse strain with disruption of bradykinin B2-receptor gene. Circulation. 1997;96:3570–3578.[Abstract/Free Full Text]

8. Wang D, Yoshida H, Song Q, Chao L, Chao J. Enhanced renal function in bradykinin B2 receptor transgenic mice. Am J Physiol. 2000;278:F484–F491.

9. Fenoy FJ, Roman RJ. Effect of kinin receptor antagonists on renal hemodynamic and natriuretic responses to volume expansion. Am J Physiol. 1992;263:R1136–R1140.[Abstract/Free Full Text]

10. Mattson DL, Cowley AW. Kinin actions on renal papillary blood flow and sodium excretion. Hypertension. 1993;21:961–9965.[Abstract/Free Full Text]

11. Tornel J, Madrid MI, Garcia-Salom M, Wirth KJ, Fenoy FJ. Role of kinins in the control of renal papillary blood flow, pressure natriuresis, and arterial pressure. Circ Res. 2000;86:589–595.[Abstract/Free Full Text]

12. Cowley AW, Roman RJ. The role of the kidney in hypertension. JAMA. 1996;275:1581–1589.[Abstract/Free Full Text]

13. Pesquero JB, Araujo RC, Heppenstall PA, Stucky CL, Silva JA Jr, Walther T, Oliveira SM, Pesquero JL, Paiva ACM, Calixto JB, Lewin GR, Bader M. Hypoalgesia and altered inflammatory responses in mice lacking kinin B1 receptors. Proc Natl Acad Sci U S A. 2000;97:8140–8145.[Abstract/Free Full Text]

14. Gross V, Milia AF, Plehm R, Inagami T, Luft FC. Long-term blood pressure telemetry in AT2 receptor disrupted mice. J Hypertens. 2000;18:955–961.[Medline] [Order article via Infotrieve]

15. Bertinieri G, Di Rienzo M, Cavallazzi A, Ferrari AU, Pedotti A, Mangia G. A new approach to analysis of arterial baroreceptor. J Hypertens. 1985;3(suppl 3):S79–S81.

16. Stauss HM, Gödecke A, Mrowka R, Schrader J, Persson PB. Enhanced blood pressure variability in eNOS knockout mice. J Hypertens. 1999;3:1359–1363.

17. Gross V, Schunck WH, Honeck H, Milia AF, Kärgel E, Walther T, Bader M, Inagami T, Schneider W, Luft FC. Inhibition of pressure natriuresis in mice lacking the AT2 receptor. Kidney Int. 2000;57:191–202.[Medline] [Order article via Infotrieve]

18. Alfie ME, Yang XP, Hess F, Carrettero OA. Salt-sensitive hypertension in bradykinin B2 receptor knockout mice. Biochem Biophys Res Com. 1996;224:625–630.[Medline] [Order article via Infotrieve]

19. Rhaleb NE, Peng H, Alfie ME, Shesely EG, Carrettero OA. Effect of ACE inhibitor on DOCA salt and aortic coarctation-induced hypertension in mice: do kinin B2 receptor play a role? Hypertension. 1999;33(pt II):329–334.

20. Emanueli C, Fink E, Milia AF, Salis MB, Conti M, Demontis MP, Madeddu P. Enhanced blood pressure sensitivity to deoxycorticosterone in mice with disruption of bradykinin B2 receptor gene. Hypertension. 1998;31:1278–1283.[Abstract/Free Full Text]

21. Emanueli C, Madeddu P. Role of the kallikrein-kinin system in the maturation of cardiovascular phenotype. Am J Hypertens. 1999;12:988–999.[Medline] [Order article via Infotrieve]

22. Madeddu P, Salis MB, Emanueli C. Altered baroreflex control of heart rate in bradykinin B2 receptor knockout mice. Immunopharmacology. 1999;45:21–27.[Medline] [Order article via Infotrieve]

23. Carlson SH, Wyss JM. Long-term telemetric recording of arterial pressure and heart rate in mice fed basal and high NaCl diets. Hypertension. 2000;35:e1–e5.[Abstract/Free Full Text]

24. Calhoun DA, Zhu ST, Chen YF, Oparil S. Gender and dietary NaCl in spontaneously hypertensive and Wistar-Kyoto rats. Hypertension. 1995;26:285–289.[Abstract/Free Full Text]

25. Pons M, Schnecko A, Witte K, Lemmer B, Waterhouse JM, Cambar J. Circadian rhythm in renal function in hypertensive TGR(mRen-2)27 rats and their normotensive controls. Am J Physiol. 1996;271:R1002–R1008.[Abstract/Free Full Text]

26. Ichiki T, Labosky PA, Shiota C, Okuyama S, Imagawa Y, Fogo A, Nimura F, Ichikawa I, Hogan BL, Inagami T. Effect of blood pressure and exploratory behaviour of mice lacking the angiotensin II type-2 receptor. Nature. 1995;377:748–750.[Medline] [Order article via Infotrieve]

27. Hein L, Barsh GS, Pratt RE, Dzau VJ, Kobilka BK. Behavioural and cardiovascular effects of disrupting the angiotensin II type-2 receptor gene in mice. Nature. 1995;377:744–747.[Medline] [Order article via Infotrieve]

28. Gross V, Lippoldt A, Luft FC. Pressure diuresis and natriuresis in DOCA-salt mice. Kidney Int. 1997;52:1364–1368.[Medline] [Order article via Infotrieve]

29. Granger JP, Hall JE. Acute and chronic action of bradykinin on renal function and arterial pressure. Am J Physiol. 1985;248:F87–F92.

30. Strick DM, Fiksen-Olsen MJ, Carretero OA, Romero JC. Renal kinin antagonism does not impair pressure-induced natriuresis. Am J Physiol. 1992;263:F77–F82.[Abstract/Free Full Text]

31. Benetos A, Bouaziz H, Safar M. Salt Sensitivity and Bradykinin Activity in Rats: Recent Progress on Kinins. Basel, Switzerland: Birkhäuser Verlag; 1992:228–234.

32. Waeber B, Niederberger M, Gavras H, Gavras H, Nussberger J, Brunner HR. Hemodynamic effects of a kinin antagonist. J Cardiovasc Pharmacol. 1990;15(suppl 6):S78–S82.




This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
P. D. Metcalfe, J. A. Leslie, M. T. Campbell, D. R. Meldrum, K. L. Hile, and K. K. Meldrum
Testosterone exacerbates obstructive renal injury by stimulating TNF-{alpha} production and increasing proapoptotic and profibrotic signaling
Am J Physiol Endocrinol Metab, February 1, 2008; 294(2): E435 - E443.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
M. Ifuku, K. Farber, Y. Okuno, Y. Yamakawa, T. Miyamoto, C. Nolte, V. F. Merrino, S. Kita, T. Iwamoto, I. Komuro, et al.
Bradykinin-Induced Microglial Migration Mediated by B1-Bradykinin Receptors Depends on Ca2+ Influx via Reverse-Mode Activity of the Na+/Ca2+ Exchanger
J. Neurosci., November 28, 2007; 27(48): 13065 - 13073.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
C. Cayla, M. Todiras, R. Iliescu, V. V. Saul, V. Gross, B. Pilz, G. Chai, V. F. Merino, J. B. Pesquero, O. C. Baltatu, et al.
Mice deficient for both kinin receptors are normotensive and protected from endotoxin-induced hypotension
FASEB J, June 1, 2007; 21(8): 1689 - 1698.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
J. LeFebvre, A. Shintani, T. Gebretsadik, J. R. Petro, L. J. Murphey, and N. J. Brown
Bradykinin B2 Receptor Does Not Contribute to Blood Pressure Lowering during AT1 Receptor Blockade
J. Pharmacol. Exp. Ther., March 1, 2007; 320(3): 1261 - 1267.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Kakoki, N. Takahashi, J. C. Jennette, and O. Smithies
Diabetic nephropathy is markedly enhanced in mice lacking the bradykinin B2 receptor
PNAS, September 7, 2004; 101(36): 13302 - 13305.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
L. J. Murphey, W. K. Eccles, G. H. Williams, and N. J. Brown
Loss of Sodium Modulation of Plasma Kinins in Human Hypertension
J. Pharmacol. Exp. Ther., March 1, 2004; 308(3): 1046 - 1052.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Z. Qi, I. Whitt, A. Mehta, J. Jin, M. Zhao, R. C. Harris, A. B. Fogo, and M. D. Breyer
Serial determination of glomerular filtration rate in conscious mice using FITC-inulin clearance
Am J Physiol Renal Physiol, March 1, 2004; 286(3): F590 - F596.
[Abstract] [Full Text]


Home page
HypertensionHome page
P. M. Abadir, R. M. Carey, and H. M. Siragy
Angiotensin AT2 Receptors Directly Stimulate Renal Nitric Oxide in Bradykinin B2-Receptor-Null Mice
Hypertension, October 1, 2003; 42(4): 600 - 604.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. P. Schanstra, J. Duchene, F. Praddaude, P. Bruneval, I. Tack, J. Chevalier, J.-P. Girolami, and J.-L. Bascands
Regulation of Cardiovascular Signaling by Kinins and Products of Similar Converting Enzyme Systems: Decreased renal NO excretion and reduced glomerular tuft area in mice lacking the bradykinin B2 receptor
Am J Physiol Heart Circ Physiol, June 1, 2003; 284(6): H1904 - H1908.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
H. D. Xiao, S. Fuchs, J. M. Cole, K. M. Disher, R. L. Sutliff, and K. E. Bernstein
Regulation of Cardiovascular Signaling by Kinins and Products of Similar Converting-Enzyme Systems: Role of bradykinin in angiotensin-converting enzyme knockout mice
Am J Physiol Heart Circ Physiol, June 1, 2003; 284(6): H1969 - H1977.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
V. Gross and F. C. Luft
Exercising Restraint in Measuring Blood Pressure in Conscious Mice
Hypertension, April 1, 2003; 41(4): 879 - 881.
[Full Text] [PDF]


Home page
HypertensionHome page
F. Trabold, S. Pons, A. A. Hagege, M. Bloch-Faure, F. Alhenc-Gelas, J.-F. Giudicelli, C. Richer-Giudicelli, and P. Meneton
Cardiovascular Phenotypes of Kinin B2 Receptor- and Tissue Kallikrein-Deficient Mice
Hypertension, July 1, 2002; 40(1): 90 - 95.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
B. J. A. Janssen and J. F. M. Smits
Autonomic control of blood pressure in mice: basic physiology and effects of genetic modification
Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2002; 282(6): R1545 - R1564.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. Majima, M. Katori, N.-E. Rhaleb, X.-P. Yang, M. Nanba, E. G. Shesely, O. A. Carretero, P. Madeddu, N.-E. Rhaleb, X.-P. Yang, et al.
Effect of Chronic Blockade of the Kallikrein-Kinin System on the Development of Hypertension in Rats * Response * Role of Kinins in Blood Pressure Regulation: Reality or Fiction * Response
Hypertension, October 1, 2001; 38 (4): e21 - e23.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Milia, A. F.
Right arrow Articles by Luft, F. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Milia, A. F.
Right arrow Articles by Luft, F. C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*SODIUM
Related Collections
Right arrow Genetically altered mice
Right arrow Hypertension - basic studies