Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 2001;38:86-89

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Correction (v38,pe26)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iwai, N.
Right arrow Articles by Ogata, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iwai, N.
Right arrow Articles by Ogata, J.
Related Collections
Right arrow Clinical genetics
Right arrow Genetics of cardiovascular disease

(Hypertension. 2001;38:86.)
© 2001 American Heart Association, Inc.


Scientific Contributions

Association of Sodium Channel {gamma}-Subunit Promoter Variant With Blood Pressure

Naoharu Iwai; Shunroku Baba; Toshifumi Mannami; Tomohiro Katsuya; Jitsuo Higaki; Toshio Ogihara; Jun Ogata

From the Research Institute (N.I.), the Department of Hypertension and Nephrology (N.I.), the Department of Preventive Medicine (S.B., T.M., J.O.), National Cardiovascular Center, and the Department of Geriatric Medicine (T.K., J.H., T.O.), Osaka University School of Medicine, Suita, Osaka, Japan.

Correspondence to Naoharu Iwai, MD, Research Institute, National Cardiovascular Center, 5-7-1 Fujishirodai, Suita-city, Osaka 565-8565, Japan. E-mail niwai{at}res.ncvc.go.jp


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract— The SCNN1G gene, located on human chromosome 16p12, encodes the {gamma} subunit of the amiloride-sensitive epithelial sodium channel, and mutations in SCNN1G can result in Liddle’s syndrome or pseudohypoaldosteronism type I. We identified sequence variations in the promoter region of SCNN1G and examined the association between this polymorphism and blood pressure in a large cohort (n=4075) representing the general population in Japan. We found T(-1290)C, T(-501)G, G(-173)A, and G(-104)T polymorphisms in the promoter region of SCNN1G and confirmed the existence of T387C and T474C polymorphisms in exon 3 and the C1947G polymorphism in exon 13. Because the genotypes of the T(-1290)C, T(-501)G, G(-104)T, and T474C polymorphisms were in tight linkage disequilibrium, we selected the T474C and G(-173)A polymorphisms for an association study. The G(-173)A polymorphism of SCNN1G had a significant effect on systolic pressure (P=0.0050) and pulse pressure (P=0.0050). The AA genotype was associated with an 11 mm Hg drop in systolic pressure and an 8 mm Hg drop in pulse pressure and with a higher prevalence of hypotension (P=0.0195). A transient transfection assay using MDCK cells and human renal epithelial cells indicated that the promoter activity of the G(-173) allele was higher than that of the A(-173) allele. Although the effects of the A(-173) allele were recessive and although the AA genotype was found in just 0.7% of our study population, we observed that this variation of human SCNN1G had significant effects on blood pressure.


Key Words: genetics • hypertension, essential • polymorphism


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The SCNN1G gene, located on human chromosome 16p12, encodes the {gamma}-subunit of the amiloride-sensitive epithelial sodium channel, and mutations in SCNN1G can result in Liddle’s syndrome1,2 or pseudohypoaldosteronism type I.3,4 Several researchers have studied the role of the human chromosome 16p12 locus in human essential hypertension and have reported conflicting results.59 For example, on the basis of a case-control study, Persu and colleagues5,6 concluded that SCNN1B and SCNN1G did not play important roles in essential hypertension. On the other hand, Wong et al9 found significant linkage between systolic blood pressure and markers at chromosome 16p12 on the basis of an identity-by-descent sibling-pair analysis. This discrepancy may be due to the study design, inasmuch as a small-scale association study has relatively weak statistical power.10

In the present study, we screened for sequence variations in the promoter region of SCNN1G and evaluated the significance of polymorphisms in essential hypertension by using a large cohort (4075 subjects) that was representative of the general Japanese population.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Subjects
The selection criteria and design of the Suita study have been described previously.11 The sample consisted of 14 200 men and women age 30 to 79 years stratified by gender and 10-year age groups, selected randomly from the municipal population registry. They were all invited by letter to attend regular cycles (every 2 years) of follow-up examinations. DNA from leukocytes was collected from participants who visited the National Cardiovascular Center between May 1996 and February 1998. All of the participants were Japanese, and only those who gave their written informed consent for genetic analyses of the amiloride-sensitive sodium channel genes were included in the present study. In the present study, of the 4104 DNA samples available, the genotypes of 4075 samples could be determined.

The characteristics of the subjects analyzed in the present study are summarized in Table 1. Blood pressure was measured in the subjects after at least 10 minutes of rest in a sitting position. Systolic and diastolic blood pressure values were the means of 2 physician-obtained measurements (recorded >3 minutes apart).


View this table:
[in this window]
[in a new window]
 
Table 1. Characteristics of the Study Population

Hypertension was defined as systolic blood pressure >=140 mm Hg or diastolic blood pressure >=90 mm Hg or the current use of antihypertensive medication. Hypotension was defined as systolic blood pressure <100 mm Hg.

DNA Studies
Genomic DNA samples from 12 subjects with hypertension and 8 subjects without hypertension were used as templates in polymerase chain reaction (PCR). The exon regions of SCNN1G were amplified by using the primers according to Persu et al.6 The promoter region was amplified by using the following primers according to the GenBank database (accession No. U48937): sense, GGCTGTGTC-TCTATGGTCCCTCCC (nucleotides 1559 to 1582); antisense, GTCCAAGGCTCGTGCGGGTGCGCTGC (nucleotides 3018 to 2993).

The PCR product was gel-purified and directly sequenced by using automated protocols for the fluorescent detection of dideoxy termination products with a model ABI 310 genetic analyzer (PE Applied Biosystems). The polymorphisms were genotyped by using the TaqMan system. Ten nanograms of sample DNA was amplified by PCR according to the manufacturer’s recommendations (PE Applied Biosystems). PCR primers and probes are shown in Table 2. The transcription initiation sites of SCNN1G mRNA were determined by 5' rapid amplification of cDNA ends, and the major initiation site was numbered +1.


View this table:
[in this window]
[in a new window]
 
Table 2. Primers and Probes for Genotype Determination

Reporter Assay
To explore the regulatory effects of G(-173)A and G(-104)T polymorphisms in the promoter region of SCNN1G, we constructed the SCNN1G gene promoter/luciferase fusion gene. The promoter region was amplified with the following primers: sense, CCTGCTGCCTACAGCCGGACGCTGGTG (nucleotides 2501 to 2527); antisense,GTCCAAGGCTCGTGCGGGTGCGCTGC(nucleotides 3018 to 2993).

The region covered by these primers was between -437 and +81. The polymorphisms in this region were G(-173)A and G(-104)T. The haplotypes determined were G/G, G/T, A/G, and A/T. The PCR products were purified, blunt-ended, and ligated to the SmaI-cut luciferase reporter vector pGL2-Basic (Promega), which does not contain any promoter sequence or enhancer. The sequences of the recombinant genes with different alleles were confirmed.

Transfection with the SCNN1G gene promoter/luciferase fusion gene was performed with LipofectAmine Plus Reagent (GIBCO BRL) according to the manufacturer’s recommendations. DNA-LipofectAmine complex was contacted with cells in Opti-MEM medium (GIBCO BRL) without serum, and the transfection medium was replaced with culture medium 3 hours later. MDCK cells were cultured in {alpha}-MEM/10% FBS. Human renal epithelial (HRE) cells were cultured according to the manufacturer’s recommendation (BioWhittaker). The HRE cell was positive for pancytokeratin, and the expression of SCNN1G mRNA was confirmed with reverse transcriptase-PCR (data not shown). PRL-CMV vector (Promega), in which Renilla luciferase is under the control of the cytomegalovirus (CMV) promoter, was included in the transfection mixture as an internal standard. Cells were harvested 30 hours after transfection. Photinus and Renilla luciferase activities were measured by use of a kit (PG-DUAL-SP, Toyo Ink Co) according to the recommendations of the manufacturer. Photinus luciferase activity, which indicated the promoter activity of the SCNN1G gene, was divided by Renilla luciferase activity and expressed as relative luciferase units (percentage).

Statistical Analysis
Values are expressed as mean±SE. All statistical analyses were performed by using the JMP statistical software package (SAS Institute Inc). Multiple linear regression and multiple logistic analyses were performed with other covariates (gender, age, body mass index, waist/hip ratio, and alcohol consumption). Differences in numerical data among the groups were analyzed by 1-way/2-way ANOVA. Differences in frequency among the groups were tested by a contingency table analysis.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Detection of Genetic Variants
We found T(-1290)C, T(-501)G, G(-173)A, and G(-104)T polymorphisms in the promoter region of SCNN1G and confirmed the existence of T474C and T387C polymorphisms10 in exon 3 and the C1947G polymorphism in exon 13.7 Moreover, we found 4 polymorphisms in SCNN1G ( Table 3 ). The allele of T(-1290) completely corresponded with the alleles of T(-501) and G(-104) in the 20 subjects sequenced. The allele T474 completely corresponded with the allele T387 in the 20 subjects sequenced. The A164G polymorphism was in tight linkage disequilibrium with exon 3 polymorphisms. The T allele of the T(-1290)C polymorphism was in tight linkage disequilibrium with that of the T474C polymorphism (P<0.0001) However, the T allele of the T474C polymorphism showed a tendency to be in linkage disequilibrium with the G(-173) allele of the G(-173)A polymorphism of SCNN1G (P=0.066). The G216 allele in intron 10 completely corresponded to the C1947 allele in the 20 subjects sequenced. The genotype frequencies of G(-173)A and T474C polymorphisms were consistent with Hardy-Weinberg equilibrium.


View this table:
[in this window]
[in a new window]
 
Table 3. Polymorphisms in SCNN1G

Association Study
Because the genotypes of the T(-1290)C, T(-501)G, G(-104)T, and T474C polymorphisms were in tight linkage disequilibrium, we selected the T474C and G(-173)A polymorphisms for an association study. The C1947G polymorphism in exon 13 was not studied because our preliminary study yielded no association of this polymorphism with blood pressure. Table 4 shows blood pressure levels according to each genotype of these 2 polymorphisms. Although the T474C polymorphism had no significant effects on blood pressure, the G(-173)A polymorphism significantly affected both systolic pressure (P=0.02) and pulse pressure (P=0.02). The AA genotype was associated with a lower systolic pressure and a lower pulse pressure. These effects on systolic pressure (P=0.005) and pulse pressure (P=0.005) became much more significant after adjusting for age, sex, waist/hip ratio, alcohol consumption, and body mass index. Multiple logistic analyses in which age, gender, body mass index, waist/hip ratio, alcohol consumption, and the genotype of the G(-173)A polymorphism of SCNN1G (GG+GA=0, AA=1) were included as independent variables indicated that the AA genotype was associated with a lower prevalence of hypertension (P=0.050). On the other hand, multiple logistic analyses in which age, body mass index, and the genotype of the G(-173)A polymorphism of SCNN1G (GG+GA=0, AA=1) were included as independent variables indicated that the AA genotype was associated with a higher prevalence of hypotension (P=0.0195).


View this table:
[in this window]
[in a new window]
 
Table 4. Blood Pressure Levels According to Genotypes

Functional Significance of the G(-173)A Polymorphism
Because the G(-173)A polymorphism was associated with blood pressure status, we next examined the functional significance of the G(-173)A polymorphism in vitro by using 2 cell lines, MDCK and HRE cells (Figure). In both types of cells, 2-way ANOVA indicated that the G(-173)A but not the G(-104)T polymorphism affected promoter activity. No significant interaction between the genotypes was observed. The allele G(-173) had {approx}2.5-fold and {approx}1.6-fold higher promoter activity than the allele A(-173) in MDCK and HRE cells, respectively.



View larger version (23K):
[in this window]
[in a new window]
 
Assessment of promoter activity. To explore the regulatory effects of G(-173)A and G(-104)T polymorphisms in the promoter region of SCNN1G, we constructed the SCNN1G gene promoter/luciferase fusion gene. Transient transfection with the SCNN1G gene promoter/luciferase fusion gene was performed in MDCK cells (n=6) and HRE cells (n=6). Photinus luciferase activity, which indicated the promoter activity of the SCNN1G gene, was divided by Renilla luciferase activity and expressed as relative luciferase units. The promoter activity of the G(-173) allele was 2.6 and 1.7 times higher than that of the A(-173) allele in MDCK and HRE cells, respectively.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
In the present study, we found previously unidentified sequence variations in the promoter region of SCNN1G on chromosome 16p12. We then evaluated the significance of these polymorphisms in blood pressure regulation by using a large cohort consisting of {approx}4000 subjects. The AA genotype of SCNN1G was found to be associated with lower systolic and pulse pressures and a higher prevalence of hypotension.

Reporter analyses on promoter activity suggest that the AA genotype of SCNN1G is associated with lower promoter activity in vivo. A lower expression of SCNN1G subunit might lead to lower sodium reabsorption in the kidney. Several mutations in the {gamma} subunit have been reported to lead to autosomal recessive pseudohypoaldosteronism type I.3,4 It is likely that the clinical characteristics of subjects with the AA genotype may resemble those of subjects with pseudohypoaldosteronism type I. This awaits further investigation. The recessive effects of the A(-173) allele may indicate an existence of a threshold expression level of the {gamma}-subunit for normal channel activity.

The promoter activity assessed in vitro may not necessarily indicate the activity in vivo, inasmuch as our promoter-luciferase construct covered only up to -421 from the initiation site, although this region has been reported to have almost full activity.12 The promoter region of this gene has been studied in detail, and a polypurine-polypyrimidine tract containing internal mirror repeats and a negative regulatory element has been identified.12,13 It is possible that the A(-173) allele may not be enough to reduce the expression level of the SCNN1G subunit to the threshold for channel dysfunction. Combination with other unidentified variations tightly linked with the G(-173)A polymorphism might further decrease the promoter activity or expression level. We sequenced only the 1.3-kb promoter region and exon regions. More thorough sequence screening covering the entire SCNN1G gene, including further upstream and intronic sequences, might be required to determine the mechanism of the observed association between the AA genotype and hypotension.

Persu et al6 screened the entire coding sequence of SCNN1G and concluded that this subunit is unlikely to be frequently involved in essential hypertension. Several researchers have assessed the significance of SCNN1G in human essential hypertension,79,14 and all but 1 study9 have concluded that it is unlikely that SCNN1G plays a significant role in the pathogenesis of human essential hypertension. In the present study population, although the T474C polymorphism had no significant effects on blood pressure, which is consistent with the study of Persu et al, the promoter variant G(-173)A was associated with low blood pressure. Because the degree of agreement between the T474C and G(-173)A polymorphisms is low (P=0.066) despite the short distance between the 2 loci, the significance of the G(-173)A polymorphism cannot be conjectured from the T474C data. Because Persu et al did not examine promoter region polymorphisms, our present results may not necessarily be inconsistent with their findings. It would be worthwhile to assess the significance of the G(-173)A polymorphism in white populations. Moreover, the present study suggests that dense single-nucleotide polymorphism mapping will be necessary to accurately assess the significance of the gene with association studies.15


*    Acknowledgments
 
This study was supported by Grant-in-Aid from the Ministry of Education, Culture, Sports, Science and Technology. The Department of Preventive Medicine, National Cardiovascular Center, was mainly responsible for sample and data collection in the Suita study. The Research Institute, National Cardiovascular Center, was mainly responsible for SCNN1G analysis and for preparing the initial draft of the article. The Department of Geriatric Medicine, Osaka University School of Medicine, was mainly responsible for preparing and storing DNA. All of the investigators contributed to writing the article.

Received October 5, 2000; first decision November 15, 2000; accepted January 5, 2001.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Shimkets RA, Warnock DG, Bostis CM, Nelson-Williams C, Hansson JH, Schambelan M, Gill JR Jr, Ulick S, Milora RV, Findling JW, Candssa CM, Rossier BC, Lifton RP. Liddle’s syndrome: heritable human hypertension caused by mutations in the beta subunit of the epithelial sodium channel. Cell. 1994; 79: 407–414.[Medline] [Order article via Infotrieve]

2. Hansson JH, Nelson-Williams C, Suzuki H, Schild L, Shimkets RA, Lu Y, Canessa CM, Iwasaki T, Rossier BC, Lifton RP. Hypertension caused by a truncated epithelial sodium channel gamma subunit: genetic heterogeneity of Liddle’s syndrome. Nat Genet. 1995; 11: 76–82.[Medline] [Order article via Infotrieve]

3. Chang SS, Grunder S, Hanukoglu A, Rosler A, Mathew PM, Hanukoglu I, Schild L, Lu Y, Shimkets RA, Nelson-Williams C, Rossier BC, Lifton RP. Mutations in subunits of the epithelial sodium channel cause salt wasting with hyperkalaemic acidosis, pseudohypoaldosteronism type 1. Nat Genet. 1996; 12: 248–253.[Medline] [Order article via Infotrieve]

4. Strautnieks SS, Thompson RJ, Gardiner RM, Chung E. A novel splice-site mutation in the gamma subunit of the epithelial sodium channel gene in three pseudohypoaldosteronism type 1 families. Nat Genet. 1996; 13: 248–250.[Medline] [Order article via Infotrieve]

5. Persu A, Barby P, Bassilana F, Houot AM, Mengual R, Lazdunski M, Corvol P, Jeunemaitre X. Genetic analysis of the beta subunit of the epithelial Na+ channel in essential hypertension. Hypertension. 1998; 32: 129–137.[Abstract/Free Full Text]

6. Persu A, Coscoy S, Houot AM, Corvol P, Barbry P, Jeunemaitre X. Polymorphism of the gamma subunit of the epithelial Na+ channel in essential hypertension. J Hypertens. 1999; 17: 639–645.[Medline] [Order article via Infotrieve]

7. Melander O, Prho M, Fagerudd J, Bengtsson K, Groop PH, Mattiasson I, Groop L, Hulthen UL. Mutations and variants of the epithelial sodium channel gene in Liddle’s syndrome and primary hypertension. Hypertension. 1998; 31: 1118–1124.[Abstract/Free Full Text]

8. Poch E, Gonzalez D, de la Sierra A, Giner V, Bragulat E, Botey A, Coca A, Rivera F. Genetic variation of the {gamma} subunit of the epithelial sodium channel and essential hypertension: relationship with salt sensitivity. Am J Hypertens. 2000; 13: 648–653.[Medline] [Order article via Infotrieve]

9. Wong ZYH, Stebbing M, Ellis JA, Lamantia A, Harrap SB. Genetic linkage of beta and gamma subunit of epithelial sodium channel to systolic blood pressure. Lancet. 1999; 353: 1222–1225.[Medline] [Order article via Infotrieve]

10. Risch N, Merikangas K. The future of genetic studies of complex human diseases. Science. 1996; 273: 1516–1517.[Abstract/Free Full Text]

11. Mannami T, Konishi M, Baba S, Nishi N, Terao A. Prevalence of asymptomatic carotid atherosclerotic lesions detected by high-resolution ultrasonography and its relation to cardiovascular risk factors in the general population of a Japanese city: the Suita study. Stroke. 1997; 28: 518–525.[Abstract/Free Full Text]

12. Auerbach SD, Loftus RW, Itani OA, Thomas CP. Human amiloride-sensitive epithelial sodium channel {gamma} subunit promoter: functional analysis and identification of a polypurine-polypyrimidine tract with the potential for triplex DNA formation. Biochem J. 2000; 347: 105–114.

13. Thomas CP, Doggett NA, Fisher R, Stokes JB. Genomic organization and the 5' flanking sequence of the {gamma} subunit of the human amiloride-sensitive epithelial sodium channel. J Biol Chem. 1996; 271: 26062–26066.[Abstract/Free Full Text]

14. Fodinger M, Hirsch MM, Schedler D, Herkner H, Bur A, Laggner AN, Horl WH, Sunder-Plassmann G. Mutations in the carboxy terminus of the beta and gamma subunits of the epithelial sodium channel are not present in patients with hypertensive crisis. Eur J Clin Invest. 1998; 28: 707–711.[Medline] [Order article via Infotrieve]

15. Kruglyak L. Prospects for whole-genome linkage disequilibrium mapping of common disease genes. Nat Genet. 1999; 22: 139–144.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
HypertensionHome page
C. J. Busst, K. J. Scurrah, J. A. Ellis, and S. B. Harrap
Selective Genotyping Reveals Association Between the Epithelial Sodium Channel {gamma}-Subunit and Systolic Blood Pressure
Hypertension, October 1, 2007; 50(4): 672 - 678.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
P. Meneton, X. Jeunemaitre, H. E. de Wardener, and G. A. Macgregor
Links Between Dietary Salt Intake, Renal Salt Handling, Blood Pressure, and Cardiovascular Diseases
Physiol Rev, April 1, 2005; 85(2): 679 - 715.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
O. Bonny and B. C. Rossier
Disturbances of Na/K Balance: Pseudohypoaldosteronism Revisited
J. Am. Soc. Nephrol., September 1, 2002; 13(9): 2399 - 2414.
[Full Text] [PDF]


Home page
CirculationHome page
N. Iwai, T. Katsuya, T. Mannami, J. Higaki, T. Ogihara, K. Kokame, J. Ogata, and S. Baba
Association Between SAH, an Acyl-CoA Synthetase Gene, and Hypertriglyceridemia, Obesity, and Hypertension
Circulation, January 1, 2002; 105(1): 41 - 47.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Correction (v38,pe26)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iwai, N.
Right arrow Articles by Ogata, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iwai, N.
Right arrow Articles by Ogata, J.
Related Collections
Right arrow Clinical genetics
Right arrow Genetics of cardiovascular disease