Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 2001;38:332-336

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shi, Q.
Right arrow Articles by Sigmund, C. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shi, Q.
Right arrow Articles by Sigmund, C. D.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Related Collections
Right arrow Gene expression
Right arrow Gene regulation
Right arrow Hypertension - basic studies

(Hypertension. 2001;38:332.)
© 2001 American Heart Association, Inc.


Scientific Contributions

NF-Y Antagonizes Renin Enhancer Function by Blocking Stimulatory Transcription Factors

Qi Shi; Kenneth W. Gross; Curt D. Sigmund

Departments of Internal Medicine and Physiology and Biophysics, University of Iowa, College of Medicine (Q.S., C.D.S.), Iowa City; and Department of Molecular and Cellular Biology, Roswell Park Cancer Institute (K.W.G.), Buffalo, NY.

Correspondence to Curt D. Sigmund, PhD, Chair, Molecular Biology Interdisciplinary Program, Director, Transgenic and Gene Targeting Facility, Department of Internal Medicine and Physiology & Biophysics, 2191 Medical Laboratory, University of Iowa, College of Medicine, Iowa City, IA 52242. E-mail curt-sigmund{at}uiowa.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract— We previously reported that the promoter proximal portion of the mouse renin enhancer contains a binding site for NF-Y (Ea) that overlaps with a positive regulatory element (Eb). In the context of the renin enhancer, NF-Y acts to oppose enhancer activity. We tested the hypothesis that NF-Y acts as a negative regulator by physically blocking the binding of transcription factors to element-b (Eb). Increasing the spacing between the NF-Y binding site (Ea) and Eb by 2, 5, or 10 nucleotides increased activity of the enhancer to the same extent as mutations abolishing NF-Y binding. The increase in transcription caused by increasing the spacing between Ea and Eb was not due to a shift of NF-Y from a negative regulator to a positive regulator because there was no loss of activity when Ea was also mutated. Oligonucleotides containing the normal or increased spacing mutants still allowed the binding of both NF-Y to Ea and transcription factors to Eb. In fact, we present evidence that both NF-Y and the Eb-binding factor(s) can each bind together on the same oligonucleotide containing either a 5- or 10-bp spacing between Ea and Eb. Our data strongly suggest that the mechanism by which NF-Y opposes renin enhancer activity is to sterically block the binding of factors to Eb.


Key Words: transcription • renin-angiotensin system • activator • repressor


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The renin-angiotensin system is an important regulator of arterial pressure and electrolyte homeostasis. The level of renin transcription, processing, and secretion dictates the eventual level of angiotensin II, because the angiotensinogen cleavage step is thought to be rate limiting. Knowledge of the molecular mechanisms defining renin gene regulation remain incomplete but has been aided recently by the identification of an enhancer of transcription located upstream of the mouse renin gene.1 This enhancer (mE) can markedly induce transcription of renin promoter reporter constructs when transfected into As4.1 cells, a renin-expressing tumor cell line isolated from the kidney.2 mE consists of a 242-bp sequence located from -2866 to -2625 in the 5'-flanking region of mouse Ren-1c. A homologous sequence with transcriptional enhancer activity also exists upstream of the human renin gene, although its position is much further from 5' (approximately -12 kb).3,4

Recently, we reported that a 40-bp promoter proximal region of mE (called m40) was required for maximal enhancer activity.3 Structural and functional dissection of m40 revealed that this region harbored 2 cis-acting elements: Ea, a negative regulatory element, and Eb, a positive regulatory element. Both of them specifically interacted with different nuclear proteins derived from As4.1 cells. NF-Y was identified as the Ea-binding factor by electrophoretic mobility supershift assay. NF-Y is a ubiquitous heterotrimeric transcription factor composed of 3 subunits, NF-YA, NF-YB, and NF-YC.5,6 NF-YB and NF-YC first form a heterodimer, and then NF-YA interacts with the dimerized NF-YB/NF-YC to form the functional heterotrimer. The DNA binding and transactivation activity is unique to the heterotrimer.7 The NF-Y binding site is often called a CCAAT box but can function in the inverted orientation.8 The overall consensus sequence is CTGCTCGCATTGGCTTCG (CTCTGAGTGGCTG in Ren-1c), but less conserved core recognition motifs have been identified in other genes.3,8,9

Although NF-Y is a ubiquitous transcriptional activator, it can also function as a transcriptional repressor.913 The negative regulatory activity of NF-Y is generally due to overlap in the binding site between NF-Y and another stimulatory transcription factor. In the insulin gene, the binding sites for NF-Y and CREB overlap, and NF-Y antagonizes the transcriptional induction caused by cAMP.13 In the renin enhancer, Ea, the NF-Y binding site, overlaps with Eb, the binding site for retinoic acid receptor and other unknown transcriptional activator(s).14 We therefore tested the hypothesis that the negative regulatory activity of NF-Y is exerted by sterically blocking the binding of stimulatory factors to Eb.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Plasmids
The luciferase (LUC) reporter vectors 2.6 kLUC, mE2.6 kLUC, and mEµa2.6 kLUC were described previously.3 mE represents the 242-bp mouse Ren enhancer; 2.6 k represents a 2.6-kb 5'-flanking sequence of mouse Ren lacking mE; and mE2.6 k is a 2866-bp sequence with an SphI site separating mE from m2.6 k. Site-directed mutagenesis was performed by use of the GeneEditor in vitro Site-Directed Mutagenesis System (Promega). The sequence of all mutants was confirmed by DNA sequencing and restriction digestion analysis. The 2-base insertion mutant mE(b2a)2.6 kLUC, 5-base insertion mutant mE(b5a)2.6 kLUC, and 10-base insertion mutant mE(b10a)2.6 kLUC were generated with the following oligonucleotides: GTACTCTGACCTCTCTGAGTGGCTGG, GGCTGTACTCTGACCTAGGCTCTGAGTGGCTGG, and CTCTGACCTAGGCGATGCTCTGAGTGGCTG (inserted bases are italicized), respectively. The 2-, 5-, and 10-base insertion mutants in mE(b2 µa)2.6 kLUC, mE(b5 µa)2.6 kLUC, and mE(b10 µa)2.6 kLUC were generated with these oligonucleotides: GGCTGTACTCTGACCTCTCTTCGCTGCTGG, GCTGTACTCTGACCTAGGCTCTTCGCTGCTGG, and CTCTGACCTAGGCGATGCTCTTCGCTGCTG (µa mutation indicated by italics).

Cell Culture and Transient Transfection
Cell culture and transient transfection of As4.1 cells (ATCC CRL2193) were previously described.3 In brief, As4.1 cells were cultured in reduced-serum OptiMEM supplemented with 2% fetal bovine serum, 1 mg/mL Albumax-II (GIBCO-BRL), penicillin (100 U/mL), and streptomycin (100 mg/mL) for 2 days. The cells (2.5x107) were transfected with equal-molar amounts of plasmid DNA by electroporation balancing with pUC19. RSV-LUC was used as a positive control, and 0.1 µg of CMV-ßGal was cotransfected as an internal control. Cells were harvested and assayed for luciferase and ß-galactosidase activity 48 hours later.3,15 Luciferase activity was normalized to ß-galactosidase activity and then calculated as a percentage of RSV promoter activity. All activity assays were performed in duplicate, the average of 2 readings being 1 data point.

Electrophoretic Mobility Shift and Supershift Assay
Preparations of the nuclear extract from As4.1 cells and probes for electrophoretic mobility shift assay (EMSA) were previously described.3 The parent probe sequence is gatcTGTACTCTGACCTCTGAGTGGCTGGTTGTG (top strand shown), where the 5'-GATC overhangs at each end of the annealed double-stranded oligonucleotides were filled with [{alpha}-32P]dATP (NEN) and 3 other cold nucleotides using Klenow DNA polymerase. The mutant probes were generated by inserting CT (b2a), AGGCT (b5a), or AGGCGATGCT (b10a) between the italicized TC. Each binding reaction contained 0.02 pmol labeled probe ({approx}60 000 dpm), 6 µg nuclear extract, 1 µg poly[d(I-C)] (Boehringer Mannheim), and binding buffer with the final concentration of (in mmol/L) Tris-HCl (pH 7.5) 10, EDTA 1, DTT 1, MgCl2 1, and KCl 60, as well as 5% glycerol in a total volume of 20 µL. Cold competitor oligos were preincubated with nuclear extract and binding buffer for 15 minutes on ice before the addition of probes. Binding reactions were incubated with probe on ice for 15 minutes, followed by electrophoresis on 5% nondenaturing polyacrylamide gels. For supershift, the indicated amount of NF-YA or NF-YB antiserum (gift of Dr R. Mantovani, Milan, Italy) was added after the initial incubation of probe, nuclear extract, and binding buffer, and the mixture was left on ice for 30 minutes before electrophoresis.3

Statistical Analysis
All data are presented as mean±SEM. Multiple comparisons were analyzed by 1-way ANOVA with SigmaStat (SPSS Scientific). Single comparisons were performed by use of a t test.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
The purpose of this study was to determine the molecular mechanism by which NF-Y antagonizes mE. On the basis of previous studies of the mechanism of NF-Y–mediated transcriptional repression and the overlap between Ea and Eb in mE, we hypothesized that NF-Y binding to Ea may physically disrupt or prevent the binding of Eb-binding factor(s) to Eb. Our strategy was to alter the spacing between Ea and Eb to remove the overlap with the rationale that if transcriptional repression works via steric hindrance (NF-Y blocking Eb-binding protein to an overlapping site), then removing the overlap between Ea and Eb should relieve transcriptional repression even in the presence of NF-Y.

To test this hypothesis directly, we inserted 2, 5, or 10 nucleotides between Eb and Ea in mE by site-directed mutagenesis using the mE2.6 kLUC plasmid as the backbone (Figure 1). All 3 insertions contained the 3' CT-dinucleotide to ensure that the binding sites for both Eb and Ea remained intact. We then performed transient transfection using renin expressing As4.1 cells. As previously reported, addition of mE to the enhancerless 2.6 k Ren promoter markedly induced transcriptional activity (Figure 2A). 3 Consistent with our hypothesis, all 3 insertions increased promoter activity by {approx}2-fold. The increase in transcription caused by the increased spacing between Ea and Eb was identical to that caused by mutation of Ea (mEµa), which prevents the binding of NF-Y to Ea and therefore would allow the binding of transcriptional activators to Eb.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 1. Sequence of Eb and Ea. A, Schematic representation of the renin gene and constructs used in this study. Location of mE is indicated by the cross-hatched arrowhead. B, DNA sequences of the distal portion of mE. Eb and Ea sites are underlined. Spacing mutations are indicated in lowercase; µa mutations are shown in italics.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 2. Transfection analysis. Luciferase reporter vectors were transiently transfected into As4.1 cells. A, Comparison of transcriptional activity of insertion mutants (cross-hatched bar) to WT (open bars) and mEµa (closed bars) is shown. *P<0.05 vs mE; NS indicates P>0.05 vs mEµa (n=7). B, Comparison of the activity of insertion mutants with intact Ea (open bars) to the activity of insertion mutants with µa (closed bars). *P=0.01; NS indicates P>0.05 (n=7).

Because NF-Y is typically considered a transcriptional activator, it became important to determine whether the increase in transcriptional activity caused by increasing the spacing between Ea and Eb was due to a shift in the mechanism of NF-Y action from a repressor to an activator. To address this issue, we generated the same 3 insertion mutations (2, 5, or 10 nucleotides) in plasmids lacking a functional NF-Y binding site and compared transcriptional activity with plasmids with an intact Ea (Figure 2B). Mutation of Ea did not cause any significant loss of transcriptional activity in any construct tested and in fact caused a significant increase in the b2a mutant. The increase in transcriptional activity caused by mutation of Ea in the b2a construct suggests that the 2-bp insertion may have only incompletely removed the overlap between the 2 sites. This finding is confirmed below by EMSA. However, the fact that mutation of the NF-Y binding site did not result in a loss of transcriptional activity suggests that the increased transcriptional activity observed in the b2a, b5a, and b10a mutants is not due to transcriptional activation by NF-Y.

We previously reported that a double-stranded oligonucleotide mX30 (Figure 3A) that contained Ea and Eb formed 2 major DNA-protein complexes (a and b) with nuclear extracts from As4.1 cells.3 To verify that both NF-Y and Eb-binding protein can still form a complex on the insertion mutants, we individually labeled double-stranded oligonucleotides containing the b2a, b5a, or b10a insertions and tested their binding activity using EMSA. Strong complex-a formation was evident on all 3 insertions (Figure 3B). Although strong complex-b formation was observed on the wild-type (WT) and b2a insertions, we noted a reproducible drop in the intensity of complex-b using b5a and b10a as a probe. Nevertheless, that b2a, b5a, and b10a still effectively bound to complex-a and complex-b is demonstrated by their effectiveness as competitors even when competing against the WT oligonucleotide. Moreover, competition analysis using varying levels of competitor DNAs revealed that there was no observable change in the affinity of NF-Y for Ea in the b2a, b5a, and b10a mutants, because each was equally effective in competing for binding to the WT probe (Figure 4). Significantly, the observation that antiserum against either the A or B subunit of NF-Y supershifted complex-a in all 3 mutants confirmed the interaction between NF-Y and Ea in b2a, b5a, and b10a (Figure 5).



View larger version (92K):
[in this window]
[in a new window]
 
Figure 3. Nuclear protein binding to Ea and Eb. A, Sequence of the mX30 oligonucleotide and insertion variants used for EMSA. Top strand only is shown. Ea is overlined and Eb in underlined. Arrowhead indicates the location of b2a, b5a, and b10 insertions. All oligonucleotides have the same 5' and 3' termini. B, Binding activity of the insertion mutants in EMSA. Labeled probes were incubated with 6 µg of the nuclear extract from As4.1 cells and 2.0 pmol of the indicated cold competitors (Comp; 100-fold molar excess). a indicates complex-a; b, complex-b; WT, WT probe; W, WT competitor; 2, b2a competitor; 5, b5a competitor; 10, b10a competitor; and -, no competitor. Complex-a represents the protein binding to Ea (NF-Y); complex-b, the protein(s) binding to Eb (RXR or an RXR partner).



View larger version (105K):
[in this window]
[in a new window]
 
Figure 4. Affinity of Ea for mutant templates. The affinity for Ea and Eb on the insertion mutations was determined by competition using WT and the indicated insertion mutants. The WT template in Figure 3 was used as a probe and incubated with 6 µg of As4.1 cell nuclear extract. Ramps indicate increasing molar excess (10-, 30-, and 90-fold) of the indicated competitor. a indicates complex-a (NF-Y); b, complex-b; WT, WT competitor; 0, no nuclear extract; and -, no competitors.



View larger version (118K):
[in this window]
[in a new window]
 
Figure 5. NF-Y binds to Ea. Labeled probes (as indicated) were incubated with 6 µg of the nuclear extracts from As4.1 cells for 15 minutes. Antibody against NF-YA subunit (3 µg) or 4 µg antibody against NF-YB subunit was added into the reactions as indicated and incubated for 30 minutes. a indicates complex-a (NF-Y); b, complex-b; s, NF-Y supershift; W, WT probe; 2, b2a probe; 5, b5a probe; and 10, b10a probe.

The increase in transcriptional activity and the EMSA data above suggest that increasing the spacing between Ea and Eb may allow both factors to simultaneously bind to the enhancer. Simultaneous binding could also potentially explain the loss of complex-b on b5a and b10a in Figure 3. To test this hypothesis, we examined whether the insertion mutations could permit simultaneous binding of both complexes (a and b) to 1 probe molecule. In normal EMSA, a limited amount of nuclear proteins and an excess of oligonucleotide probe are used. Under these conditions, it is unlikely that 1 probe molecule will bind 2 proteins unless a strong cooperative interaction exists. To increase the probability of 2 complexes assembling on 1 probe, we raised the amount of nuclear extract from 6 to 15 µg per reaction and reduced the amount of labeled probes from 0.02 to 0.002 pmol per reaction. We anticipated that probes carrying 2 protein complexes would migrate more slowly than probes carrying a single complex and will be visualized as a further retarded band on a nondenaturing gel. Interestingly, a "superretarded" band was evident on b5a and b10a (Figure 6A). That this superretarded complex results from the binding of both NF-Y and Eb-binding protein is suggested by competition analysis. As expected, WT mX30, containing both Ea and Eb, efficiently competes for complex-a, complex-b, and complex-ab. Mutant mX30 µa, which lacks Ea, efficiently competes for complex-b on WT and b2a and competes for complex-ab on b5a and b10a, suggesting that complex-ab does indeed contain the Eb-binding protein. Similarly, mutant mX30 µb, which lacks Eb, competes for complex-a on all 4 oligonucleotides and competes for complex-ab on b5a and b10a, suggesting the presence of NF-Y in complex-ab. This is further supported by the observation that competition with mX30 µb restores the formation of complex-b on b5a and b10a, presumably because excess binding of NF-Y on the mX30 µb competitor prevents the formation of the ab double complex and frees the Eb-binding protein to complex alone with Eb. Antiserum to subunit A of NF-Y causes a supershift of complex-a and prevents the formation of complex-ab without causing any obvious additional supershift product (Figure 6B). Interestingly, under some experimental conditions, NF-Y antiserum prevents complex formation, whereas under other conditions, the antiserum causes a clear and abundant supershift to appear.16,17



View larger version (68K):
[in this window]
[in a new window]
 
Figure 6. Dual complex formation on b5a and b10a. Analysis of double complexes formed on single probes in EMSA. A, Labeled probes (0.002 pmol per lane) as indicated were incubated with 15 µg of the nuclear extracts from As4.1 cells for 15 minutes. Then, 1.0 pmol of the indicated cold competitors (500-fold molar excess) was added and incubated for another 15 minutes. B, Probes were incubated as above and then incubated either with or without NF-YA antiserum. a indicates complex-a; b, complex-b; ab, double complex a+b; as, complex-a supershift; W, WT probe; 2, b2a probe; 5, b5a probe; and 10, b10a probe.

Taken together, these data strongly suggest that NF-Y mediates its antagonistic activity by preventing the binding of Eb-binding protein(s) to Eb. Increasing the spacing did not cause NF-Y to act as a positive factor and did not affect the ability of NF-Y to bind to the modified enhancers. In fact, increasing the spacing by 5 and 10 nucleotides provided an opportunity for both NF-Y and Eb-binding protein to simultaneously bind to mX30.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The ability of the renin gene enhancer to stimulate a 100-fold increase in transcriptional activity of the Ren promoter makes it an important candidate in Ren gene regulation.1 We previously identified 2 transcription factor binding sites that mechanistically oppose each other.3 We hypothesized that the binding of NF-Y to Ea acts as a negative regulator because it blocks the binding of transcription factors to Eb. Changing the spacing between Ea and Eb has the same effect as mutating Ea, suggesting that this hypothesis is correct. These data are supported by the observations that NF-Y can still bind to Ea even when the spacing between Ea and Eb is increased and that mutations of Ea in the b5a and b10a mutants does not inhibit transcription of the Ren promoter.

NF-Y is generally considered a ubiquitous transcriptional activator, although the exact mechanisms through which NF-Y regulates transcription is not totally clear. Sequence surveys have revealed that most stimulatory NF-Y binding sites are located from -80 through -100 in TATA-containing promoters or very close to the transcription start site in TATA-less promoters.8,18 Other studies of NF-Y containing promoters have demonstrated that the positive function of the NF-Y site also depends on other adjacent cis-acting elements.19,20 In mouse Ren, Ea is located far upstream of the promoter (about -2.6 kb) and does not have the previously reported adjacent cis-acting elements that cooperated with positive NF-Y sites in the other genes.

The negative regulatory activity of NF-Y has been reported in several genes.913 Mutation of an NF-Y binding site overlapping with a C/EBP site upstream of the human apolipoprotein A-I promoter increases transcription.9 Overlap of NF-Y and a CRE in the promoter proximal region of the rat insulin I gene attenuates transcriptional stimulation by cAMP.9,13 Although Ea does not match a perfect consensus NF-Y site (It has a single-base substitution in its core recognition motif), the same single-base substitution also exists in human apolipoprotein A-I gene, which is also repressed by NF-Y.9

Under normal conditions, activation of the enhancer may involve a competition between NF-Y and the factors binding to Eb. It is likely that both the amount of NF-Y and Eb-binding protein and their relative binding affinity may be determinants of this competition. EMSA experiments reproducibly suggest that the level of NF-Y exceeds the level of Eb-binding protein under baseline conditions. It is possible that specific conditions exist that change the balance between these proteins and therefore favor binding to Eb. It is known that the level or affinity of NF-Y can be regulated by the redox state of the cell, intracellular calcium concentration, cellular differentiation, and the presence of serum supplementation.16,2123 Exactly what physiological cues regulate the level or affinity of the Eb-binding protein will have to wait for the unequivocal identification of that factor(s) (see below).

It is now becoming clear that the mechanism by which the renin enhancer regulates renin transcription will be quite complicated because, in addition to the elements described above, additional elements upstream of Eb have recently been shown to be required for maximal enhancer activity (Figure 7). One element, termed Ec, which located 10 bp upstream of Eb, is a direct repeat of the Eb TGACCT motif. TGACCT direct repeats have been reported to bind members of the nuclear hormone receptor superfamily of transcription factors.24 We have recently demonstrated that Eb is a half-site for retinoic acid receptor (RAR). Eb and Ec together can bind RAR{alpha} and RXR{alpha} and form a functional RAR element.14 In the studies described herein, Ec was intact and the distance between Ec and Eb remained unaltered. In addition, an element called Ed, which lies further upstream of Ec and Eb, has homology to a CRE and may thus bind members of the CREB/ATF-1 family of transcription factors (T.A. Black, et al, unpublished observation, 2000). It is likely that the interplay between transcription factors binding to these sites may be required because the CREB/ATF-1 and RAR/RXR pathways share a similar coactivator in p300/CBP.25,26 Other yet-unidentified regulatory elements may also be present in the Ren enhancer, and other transcription factors may bind to Ed, Ec, Eb, and Ea. In the end, it is likely that ubiquitous positive and negative regulatory factors will be found to cooperate to regulate expression of renin through the enhancer.



View larger version (8K):
[in this window]
[in a new window]
 
Figure 7. Sequence of the promoter proximal portion of mE. The cis-acting elements in the promoter proximal portion of mE and specific mutations are shown. The locations of Ed, Ec, Eb, and Ea are underlined, and the consensus sequences for their cognate factors are indicated.


*    Acknowledgments
 
Funds in support of this work were obtained from the NIH (HL-48058, HL-61446, and HL-55006 to C.D.S. and HL-48459 to K.W.G.). We acknowledge the outstanding technical assistance of Deborah Davis and Xiaoji Zhang. DNA sequencing was performed at the University of Iowa DNA Core Facility.

Received January 29, 2001; first decision February 21, 2001; accepted February 23, 2001.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Petrovic N, Black TA, Fabian JR, Kane CM, Jones CA, Loudon JA, Abonia JP, Sigmund CD, Gross KW. Role of proximal promoter elements in regulation of renin gene transcription. J Biol Chem. . 1996; 271: 22499–22505.[Abstract/Free Full Text]

2. Sigmund CD, Okuyama K, Ingelfinger J, Jones CA, Mullins JJ, Kim U, Kane-Haas C, Wu C, Kenney L, Rustum Y, Dzau V, Gross KV. Isolation and characterization of renin expressing cell lines from transgenic mice containing a renin promoter viral oncogene fusion construct. J Biol Chem. . 1990; 265: 19916–19922.[Abstract/Free Full Text]

3. Shi Q, Black TA, Gross KW, Sigmund CD. Species-specific differences in positive, and negative regulatory elements in the renin gene enhancer. Circ Res. . 1999; 85: 479–488.[Abstract/Free Full Text]

4. Yan Y, Jones CA, Sigmund CD, Gross KW, Catanzaro DF. Conserved enhancer elements in human and mouse renin genes have different transcriptional effects in As4.1 cells. Circ Res. . 1997; 81: 558–566.[Abstract/Free Full Text]

5. Bellorini M, Lee DK, Dantonel JC, Zemzoumi K, Roeder RG, Tora L, Mantovani R. CCAAT binding NF-Y-TBP interactions: NF-YB and NF-YC require short domains adjacent to their histone fold motifs for association with TBP basic residues. Nucleic Acids Res. . 1997; 25: 2174–2181.[Abstract/Free Full Text]

6. Maity SN, de Crombrugghe B. Role of the CCAAT-binding protein CBF/NF-Y in transcription. Trends Biochem Sci. . 1998; 23: 174–178.[Medline] [Order article via Infotrieve]

7. Sinha S, Kim IS, Sohn KY, de Crombrugghe B, Maity SN. Three classes of mutations in the A subunit of the CCAAT-binding factor CBF delineate functional domains involved in the three-step assembly of the CBF-DNA complex. Mol Cell Biol. . 1996; 16: 328–337.[Abstract]

8. Mantovani R. A survey of 178 NF-Y binding CCAAT boxes. Nucleic Acids Res. . 1998; 26: 1135–1143.[Abstract/Free Full Text]

9. Papazafiri P, Ogami K, Ramji DP, Nicosia A, Monaci P, Cladaras C, Zannis VI. Promoter elements and factors involved in hepatic transcription of the human ApoA-I gene positive and negative regulators bind to overlapping sites. J Biol Chem. . 1991; 266: 5790–5797.[Abstract/Free Full Text]

10. Boucher PD, Piechocki MP, Hines RN. Partial characterization of the human CYP1A1 negatively acting transcription factor and mutational analysis of its cognate DNA recognition sequence. Mol Cell Biol. . 1995; 15: 5144–5151.[Abstract]

11. Moriuchi H, Moriuchi M, Cohen JI. The varicella-zoster virus immediate-early 62 promoter contains a negative regulatory element that binds transcriptional factor NF-Y. Virology. . 1995; 214: 256–258.[Medline] [Order article via Infotrieve]

12. Kelly D, Kim SJ, Rizzino A. Transcriptional activation of the type II transforming growth factor-ß receptor gene upon differentiation of embryonal carcinoma cells. J Biol Chem. . 1998; 273: 21115–21124.[Abstract/Free Full Text]

13. Eggers A, Siemann G, Blume R, Knepel W. Gene-specific transcriptional activity of the insulin cAMP-responsive element is conferred by NF-Y in combination with cAMP response element-binding protein. J Biol Chem. . 1998; 273: 18499–18508.[Abstract/Free Full Text]

14. Shi Q, Gross KW, Sigmund CD. Retinoic acid-mediated activation of the mouse renin enhancer. J Biol Chem. . 2001; 276: 3597–3603.[Abstract/Free Full Text]

15. Ying L, Morris BJ, Sigmund CD. Transactivation of the human renin promoter by the cyclic AMP/protein kinase A pathway is mediated by both CREB-dependent and CREB-independent mechanisms in Calu-6 cells. J Biol Chem. . 1997; 272: 2412–2420.[Abstract/Free Full Text]

16. Marziali G, Perrotti E, Ilari R, Testa U, Coccia EM, Battistini A. Transcriptional regulation of the ferritin heavy-chain gene: the activity of the CCAAT binding factor NF-Y is modulated in heme-treated Friend leukemia cells and during monocyte-to-macrophage differentiation. Mol Cell Biol. . 1997; 17: 1387–1395.[Abstract]

17. Lu CC, Yen TS. Activation of the hepatitis B virus S promoter by transcription factor NF-Y via a CCAAT element. Virology. . 1996; 225: 387–394.[Medline] [Order article via Infotrieve]

18. Bucher P. Weight matrix descriptions of four eukaryotic RNA polymerase II promoter elements derived from 502 unrelated promoter sequences. J Mol Biol. . 1990; 212: 563–578.[Medline] [Order article via Infotrieve]

19. Linhoff MW, Wright KL, Ting JP. CCAAT-binding factor NF-Y and RFX are required for in vivo assembly of a nucleoprotein complex that spans 250 base pairs: the invariant chain promoter as a model. Mol Cell Biol. . 1997; 17: 4589–4596.[Abstract]

20. Jackson SM, Ericsson J, Mantovani R, Edwards PA. Synergistic activation of transcription by nuclear factor Y and sterol regulatory element binding protein. J Lipid Res. . 1998; 39: 767–776.[Abstract/Free Full Text]

21. Nakshatri H, Bhat-Nakshatri P, Currie RA. Subunit association and DNA binding activity of the heterotrimeric transcription factor NF-Y is regulated by cellular redox. J Biol Chem. . 1996; 271: 28784–28791.[Abstract/Free Full Text]

22. Chang ZF, Liu CJ. Human thymidine kinase CCAAT-binding protein is NF-Y, whose A subunit expression is serum-dependent in human IMR-90 diploid fibroblasts. J Biol Chem. . 1994; 269: 17893–17898.[Abstract/Free Full Text]

23. Roy B, Lee AS. Transduction of calcium stress through interaction of the human transcription factor CBF with the proximal CCAAT regulatory element of the grp78/BiP promoter. Mol Cell Biol. . 1995; 15: 2263–2274.[Abstract]

24. Glass CK. Differential recognition of target genes by nuclear receptor monomers, dimers, and heterodimers. Endocr Rev. . 1994; 15: 391–407.[Abstract/Free Full Text]

25. Glass CK, Rose DW, Rosenfeld MG. Nuclear receptor coactivators. Current Opinion in Cell Biology. . 1997; 9: 222–232.[Medline] [Order article via Infotrieve]

26. De Cesare D, Fimia GM, Sassone-Corsi P. Signaling routes to CREM and CREB: plasticity in transcriptional activation. Trends Biochem Sci. . 1999; 24: 281–285.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
X. Zhou, E. T. Weatherford, X. Liu, E. Born, H. L. Keen, and C. D. Sigmund
Dysregulated human renin expression in transgenic mice carrying truncated genomic constructs: evidence supporting the presence of insulators at the renin locus
Am J Physiol Renal Physiol, September 1, 2008; 295(3): F642 - F653.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
X. Zhou and C. D. Sigmund
Chorionic enhancer is dispensable for regulated expression of the human renin gene
Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2008; 294(2): R279 - R287.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Yuan, W. Pan, J. Kong, W. Zheng, F. L. Szeto, K. E. Wong, R. Cohen, A. Klopot, Z. Zhang, and Y. C. Li
1,25-Dihydroxyvitamin D3 Suppresses Renin Gene Transcription by Blocking the Activity of the Cyclic AMP Response Element in the Renin Gene Promoter
J. Biol. Chem., October 12, 2007; 282(41): 29821 - 29830.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
R. Mrowka, A. Steege, C. Kaps, H. Herzel, B. J. Thiele, P. B. Persson, and N. Bluthgen
Dissecting the action of an evolutionary conserved non-coding region on renin promoter activity
Nucleic Acids Res., August 1, 2007; 35(15): 5120 - 5129.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. A. Itani, X. Liu, J. H. Pratt, and C. D. Sigmund
Functional Characterization of Polymorphisms in the Kidney Enhancer of the Human Renin Gene
Endocrinology, March 1, 2007; 148(3): 1424 - 1430.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
X. Liu, Q. Shi, and C. D. Sigmund
Interleukin-1{beta} Attenuates Renin Gene Expression Via a Mitogen-Activated Protein Kinase Kinase-Extracellular Signal-Regulated Kinase and Signal Transducer and Activator of Transcription 3-Dependent Mechanism in As4.1 Cells
Endocrinology, December 1, 2006; 147(12): 6011 - 6018.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Zhoux, D. R. Davis, and C. D. Sigmund
The Human Renin Kidney Enhancer Is Required to Maintain Base-line Renin Expression but Is Dispensable for Tissue-specific, Cell-specific, and Regulated Expression
J. Biol. Chem., November 17, 2006; 281(46): 35296 - 35304.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. T. Todorov, S. Volkl, J. Friedrich, L. A. Kunz-Schughart, T. Hehlgans, L. Vermeulen, G. Haegeman, M. L. Schmitz, and A. Kurtz
Role of CREB1 and NF{kappa}B-p65 in the Down-regulation of Renin Gene Expression by Tumor Necrosis Factor {alpha}
J. Biol. Chem., July 1, 2005; 280(26): 24356 - 24362.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
L. Pan, Y. Wang, C. A. Jones, S. T. Glenn, H. Baumann, and K. W. Gross
Enhancer-dependent inhibition of mouse renin transcription by inflammatory cytokines
Am J Physiol Renal Physiol, January 1, 2005; 288(1): F117 - F124.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
L. Pan and K. W. Gross
Transcriptional Regulation of Renin: An Update
Hypertension, January 1, 2005; 45(1): 3 - 8.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
L. Pan, C. A. Jones, S. T. Glenn, and K. W. Gross
Identification of a novel region in the proximal promoter of the mouse renin gene critical for expression
Am J Physiol Renal Physiol, June 1, 2004; 286(6): F1107 - F1115.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
R. Nistala, X. Zhang, and C. D. Sigmund
Differential expression of the closely linked KISS1, REN, and FLJ10761 genes in transgenic mice
Physiol Genomics, March 12, 2004; 17(1): 4 - 10.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
P. B Persson
Renin: origin, secretion and synthesis
J. Physiol., November 1, 2003; 552(3): 667 - 671.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
X. Liu, X. Huang, and C. D. Sigmund
Identification of a Nuclear Orphan Receptor (Ear2) as a Negative Regulator of Renin Gene Transcription
Circ. Res., May 16, 2003; 92(9): 1033 - 1040.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
R. Mrowka, K. Steinhage, A. Patzak, and P. B. Persson
An evolutionary approach for identifying potential transcription factor binding sites: the renin gene as an example
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2003; 284(4): R1147 - R1150.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
P. M. Gowri, J. H. Yu, A. Shaufl, M. A. Sperling, and R. K. Menon
Recruitment of a Repressosome Complex at the Growth Hormone Receptor Promoter and Its Potential Role in Diabetic Nephropathy
Mol. Cell. Biol., February 1, 2003; 23(3): 815 - 825.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shi, Q.
Right arrow Articles by Sigmund, C. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shi, Q.
Right arrow Articles by Sigmund, C. D.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Related Collections
Right arrow Gene expression
Right arrow Gene regulation
Right arrow Hypertension - basic studies