Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 2001;38:692-696

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by David, F. L.
Right arrow Articles by Tostes, R. C.A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by David, F. L.
Right arrow Articles by Tostes, R. C.A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
*PROGESTERONE
Medline Plus Health Information
*High Blood Pressure
Related Collections
Right arrow Animal models of human disease

(Hypertension. 2001;38:692.)
© 2001 American Heart Association, Inc.


Endocrine Systems

Ovarian Hormones Modulate Endothelin-1 Vascular Reactivity and mRNA Expression in DOCA-Salt Hypertensive Rats

Flavia L. David; Maria Helena C. Carvalho; Ana L.N. Cobra; Dorothy Nigro; Zuleica B. Fortes; Nancy A. Rebouças; Rita C.A. Tostes

Departments of Pharmacology (F.L.D., M.H.C.C., A.L.N.C., D.N., Z.B.F, R.C.A.T.) and Physiology (N.A.R.), Institute of Biomedical Science, University of Sao Paulo, Sao Paulo, SP, Brazil

Correspondence to Rita C.A.Tostes, University of Sao Paulo, Institute of Biomedical Science, Pharmacology Dept, Av. Lineu Prestes, 1524 Sao Paulo, SP 05508-900 Brazil. E-mail rtostes{at}usp.br

Abstract

Abstract— We previously demonstrated a differential activation of the endothelin-1 (ET-1) pathway in male and female deoxycorticosterone (DOCA)-salt hypertensive rats, with the male rats exhibiting marked alterations in vascular and pressor responses to ET-1 and Suc-[Glu,9Ala11,15]-ET-1(8-21) (IRL-1620), an ETB agonist. Mechanisms underlying these gender differences are unclear, and we hypothesized that the ovarian hormones attenuate vascular ETB responses in female DOCA-salt rats. Female Wistar rats were randomized in 3 groups: sham-operated, ovariectomized (OVX), and OVX plus hormone replacement with estradiol (E) or estradiol/progesterone (EP). Two weeks later, rats were uninephrectomized and further randomized in DOCA-salt (subcutaneous injections of desoxycorticosterone and drinking water containing NaCl/KCl) and control normotensive (subcutaneous injections of vehicle and tap water). Blood pressure was evaluated both by direct and standard tail-cuff methods. Responses to IRL-1620 were evaluated in vivo/in situ in the mesenteric microcirculation. mRNA expression of ET-1 and ETA/B receptors was evaluated in mesenteric arteries by reverse transcription–polymerase chain reaction and expressed relative to GAPDH. OVX-DOCA rats developed a more severe form of hypertension than did DOCA rats. Treatment with E or EP restored blood pressure to levels observed in DOCA rats. In the mesentery, IRL-1620 induced vasodilatation in control rats, a mild vasoconstriction in DOCA rats, and marked vasoconstriction in OVX-DOCA rats. Both E and EP decreased IRL-1620–induced vasoconstriction in the DOCA group. In the normotensive group, OVX did not change blood pressure or IRL-1620–induced vasodilation. Removal of the ovaries increased ET-1 mRNA in arteries from DOCA and control rats, although treatment with E or EP reversed these changes. Vascular ETB receptor mRNA levels were greatly enhanced in OVX-DOCA but not OVX-control rats. Hormone replacement with E or EP restored ETB receptor expression in the DOCA group. A greater blood pressure–lowering effect of bosentan (ETA/ETB blocker) was observed in OVX-DOCA rats. The observation that OVX worsens hypertension as well as the altered ETB receptor–mediated responses and the effects of bosentan in female DOCA rats supports our suggestion that the ovarian hormones modulate ET-1/ETB receptor vascular responses/expression in DOCA-salt hypertension.


Key Words: deoxycorticosterone • vasoconstriction • endothelin • estrogen • receptors, endothelin

In deoxycorticosterone (DOCA)-salt hypertension and other experimental models of hypertension, male rats develop an earlier and more severe form of hypertension than do female rats.12 We have recently suggested that differential activation of endothelin-1 (ET-1) pathways, expressed by a functional upregulation of ETB receptors, may play a role in the higher blood pressure (BP) levels observed in male DOCA-salt hypertensive rats.34 We observed that mesenteric arterioles from male but not female DOCA-salt rats display increased ET-1– and ETB–mediated responses and also that male DOCA-salt animals exhibit a marked and greater BP-lowering effect in response to bosentan, a mixed ETA/ETB antagonist, compared with that of female DOCA rats.34

Mechanisms underlying the attenuated alterations in the vascular ET-1 pathway in female DOCA-salt rats are unclear but may be related to the cardioprotective effects of ovarian hormones. Increasing evidence suggests that ovarian hormones suppress or modulate ET-1 production and its effects: (1) 17ß-estradiol attenuates ET-1–induced coronary artery constriction both in vitro5 and in vivo6; (2) plasma ET-1 levels fluctuate during the menstrual cycle7 and are higher in men than in age-matched women8; (3) ET-1 decreases during estrogen replacement therapy, during pregnancy (when estrogen levels are high), and during estrogen administration in transsexual male patients8,9; and (4) in the absence of ovarian hormones, ET-1 mRNA increases, as does the peptide.10,11 Therefore, the aim of the present study was to investigate whether the ovarian hormones modulate ET-1 vascular reactivity and expression in female DOCA-salt rats. We evaluated (1) responses to the ETB agonist Suc-[Glu,9Ala11,15]-ET-1(8-21) (IRL-1620) in vivo/in situ in the mesenteric microcirculation, (2) the vascular mRNA expression of ET-1 and ET receptors, and (3) the BP-lowering effect of bosentan in female normotensive and DOCA-salt rats that were sham-operated, were ovariectomized, or received hormone replacement therapy following the ovariectomy.

Methods

Animals
Female Wistar rats from the Institute of Biomedical Science’s animal facility were used in this study. All animals were fed standard laboratory rat chow, had ad libitum access to both food and water, and were housed individually in a room with a constant temperature (24°C) and a 12-hour/12-hour light/dark cycle. Experimental protocols followed standards and policies of the University of Sao Paulo’s Animal Care and Use Committee.

Surgical Procedures
At 6 weeks of age, rats underwent ovariectomy under chloral hydrate anesthesia (300 mg/kg SC). Briefly, under aseptic conditions, a small incision was performed in the lower abdomen, and both ovaries were removed (OVX rats) or touched with the surgical instruments (sham). On the same day, some of these rats received pellets containing 17ß-estradiol (E; 0.1 mg/pellet; 60-day release; Innovative Research of America) or E plus progesterone (EP; 0.1 mg and 100 mg/pellet, respectively; 60-day release). Two weeks after surgery, these animals were randomized into 6 groups: (1) normotensive (control); (2) OVX normotensive (OVX-control); (3) OVX-control rats treated with E or EP (E-control or EP-control); (4) DOCA-salt rats (DOCA); (5) OVX DOCA-salt (OVX-DOCA); and (6) OVX-DOCA rats that received E or EP pellets (E-DOCA or EP-DOCA). DOCA-salt treatment, measurements of BP, and vascular reactivity, as well as assessment of hormone levels and effectiveness of ovariectomy and hormone replacement therapy, were performed as we previously reported.3,12

Vascular mRNA Expression of ET-1 and ETA/ETB Receptors
Total cellular RNA was isolated from aorta/mesenteric arteries using TRizol reagent (GIBCO BRL, Life Technologies). After DNA digestion, total RNA (20 ng) was used for reverse transcription (RT) in the presence of a RNAase inhibitor, 200 U Moloney murine leukemia virus reverse transcriptase, and 1 µg oligo(dT)12 to 18 primer at 37°C for 60 minutes. The cDNA products were isolated by phenol-chloroform extraction, precipitated by ethanol, and resuspended in 120 uL TE (10 mmol/L Tris-HCl, 1 mmol/L EDTA, pH 7.5). PCR primers were as follows: ET-1, antisense primer CTCGCTCTATGTAAGTCATGG and sense primer GCTCCTGCTCCTCCTTGATG, which should amplify a 471-bp fragment; ETA, antisense primer CTGTGCTGCTCGCCCTTGTA and sense primer GAAGTCGTCCGTGGGCATCA (216-bp fragment); ETB, antisense primer CACGATGAGGACAATGAGAT and sense primer TTACAAGACAGCCAAAGACT (565 bp); and GAPDH, antisense primer CACCACCCTGTTGCTGTA and sense primer TATGATGACATCAAGAAGGTGG (219 bp). GAPDH was used as an internal control for the coamplification. The following conditions were selected for polymerase chain reaction (PCR) in a volume of 50 uL: RT products from 20 ng of RNA, 2.5 U Taq polymerase, 28 cycles of amplification for ET-1, 25 cycles for ETA/ETB receptors, and 20 cycles for GAPDH. After an initial denaturing cycle at 94°C for 5 minutes, the subsequent cycles were as follows: denaturation, 30 seconds at 94°C; annealing, 30 seconds at 55°C (ET-1, ETB) or 60°C (ETA, GAPDH); and extension, 45 seconds at 72°C. PCR products (10 uL per lane) were electrophoresed by 1% agarose gel containing ethidium bromide 0.5 µg/mL. The band intensities were measured using a software (Kodak Digital Science, Eastman Kodak Co), and the signals were expressed relatively to the intensity of the GAPDH amplicon in each coamplified sample.

Drugs
ET-1 and IRL-1620 were purchased from Calbiochem-Novabiochem; DOCA and chloral hydrate were from Sigma Chemical Co. Bosentan was kindly provided by Dr Martine Clozel (Actelion Ltd, Allschwil, Switzerland).

Data Analysis and Statistical Evaluation
Values are expressed as mean±SEM. Statistical evaluation of the data was performed by 2-way ANOVA followed by pair-wise multiple comparison procedures (Tukey Test) (SigmaStat, version 2.0, Jandel Scientific Software). P<0.05 was considered statistically significant.

Results

Ovariectomy accelerated the development and severity of hypertension in DOCA-salt rats (P<0.05). Hormone replacement, both with E or EP, restored BP levels in OVX-DOCA rats to values seen in DOCA rats (P<0.05). No differences were observed between the control, OVX-control and E- or EP-control groups. Systolic BP values are shown in the Table. Ovariectomized rats, both control and DOCA-salt rats, had significantly higher body weights than that of sham-operated rats, and the weight gain was reduced in the groups that received hormone treatment (P<0.05). To control for the efficacy of ovariectomy and hormone replacement, both the uterine weight and hormone plasma levels were evaluated. As can be observed in the Table, uterine body weight and plasma levels of E and EP were significantly reduced in the OVX groups and were restored with the hormone replacement therapy (P<0.05). Because responses in E- and EP-treated rats were similar at all protocols, only responses in the E-groups will be shown.


View this table:
[in this window]
[in a new window]
 
Table 1. Body/Uterine Weight, and Plasma Levels of Estradiol and Progesterone in Control and DOCA-Salt Rats That Underwent Sham-Operation, OVX, and Hormone Replacement With E or EP

IRL-1620 (10-11 to 10-9 mol/L) induced vasodilation in control (initial diameter, 19.3±1.5 µm; after 10-9 mol/L IRL-1620, 20.7±1.6 µm) and OVX-control (initial diameter, 18.9±1.3 µm; after 10-9 mol/L IRL-1620, 20.1±1.8 µm) rats. Treatment with E or EP did not modify IRL-1620–induced responses (initial diameter, 20.6±0.8 µm; after 10-9 mol/L IRL-1620, 21.9±1.2 µm) in the normotensive group. A mild vasoconstrictor response occurred in DOCA rats (initial diameter, 18.9±2.1 µm; after 10-9 mol/L IRL-1620, 18.2±1.6 µm), but a greater and marked vasoconstriction was observed in the OVX-DOCA rats on IRL-1620 stimulation (initial diameter, 18.8±1.8 µm; after 10-9 mol/L IRL-1620, 17.2±1.5 µm; P<0.05) (Figure 1). Treatment with E or EP significantly attenuated IRL-1620–induced vasoconstriction in the hypertensive rats (initial diameter, 20.5±0.9 µm; after 10-9 mol/L IRL-1620, 19.9±1.1 µm; P<0.05). Figure 2 demonstrates results obtained from RT-PCR showing mRNA expression of ET-1 and ETB and ETA receptor genes in mesenteric arteries from sham, OVX, and E-treated control and DOCA-salt rats. Similar results were observed in aortas (not shown). DOCA-salt treatment slightly but significantly increased ET-1 expression in female rats (P<0.05). The OVX increased ET-1 mRNA expression in control and DOCA rats (P<0.05), whereas treatment with E or EP reversed these changes (P<0.05). A trend to increased ETB receptor mRNA expression was observed in the OVX-control group, but only reached statistical significance in the DOCA-OVX group (P<0.05). Treatment with E or EP normalized ETB receptor mRNA expression (P<0.05). No alterations were observed in ETA receptor mRNA expression. To further investigate alterations in the ET-1 pathway, we assessed effects of the mixed ETA/ETB antagonist bosentan on BP (Figure 3). Mean arterial BP was higher in DOCA-salt rats compared with control rats (P<0.05). Bosentan (10 mg/kg IV) slightly but significantly decreased BP in the control groups. The antagonist lowered BP in DOCA-salt hypertensive rats, but the decrease on BP was significantly greater in the OVX-DOCA group. In the E-DOCA group, the effects of bosentan were similar to those observed in the DOCA group.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 1. Bar graphs show IRL-1620–induced responses: vasodilation (upward bars) in mesenteric microvessels from control rats (A), and vasoconstriction (downward bars) in mesenteric microvessels from DOCA-salt hypertensive rats (B). Rats were sham-operated ({square}), ovariectomized ({blacksquare}), or treated with E ({image}). Data are expressed as percentage of change in initial microvessel diameter. Each bar represents mean±SEM (n=5 to 6). *P<0.05 OVX vs sham; {dagger}P<0.05 DOCA vs control; and {ddagger}P<0.05 E-treated vs OVX.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 2. Representative RT-PCR products of 20 ng total RNA extracted from mesenteric arteries of sham-operated ({square}), ovariectomized ({blacksquare}), or E-treated ({image}) control and DOCA-salt rats. The bar graphs show the relative optical density values of ET-1, ETB, and ETA receptor bands obtained from the different groups. Values were normalized by the corresponding RT-PCR products for GAPDH, used as the internal control. Results are expressed as mean±SEM (n=4 to 5). *P<0.05 OVX vs sham; {dagger}P<0.05 DOCA vs control; {ddagger}P<0.05 E-treated vs OVX.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 3. Effects of bosentan (10 mg/kg IV) on mean arterial blood pressure (MABP) in control (A) and DOCA-salt (B) rats that were sham-operated ({square} and ), ovariectomized ({square} and {blacksquare}), and treated with E ({triangleup} and {blacktriangleup}). Each data point represents mean±SEM of the decrease in basal blood pressure (mm Hg) (n=6 to 7). *P<0.05 OVX vs sham; {ddagger}P<0.05 E-treated vs OVX.

Discussion

Ovarian hormones are believed to posses cardiovascular protective effects, and they seem to play a role in the gender-related differences in the development of hypertension in experimental models.12 Because ET-1 plays a role in the pathogenesis of DOCA-salt hypertension,1317 it is possible that the attenuated development of hypertension in female DOCA-salt rats may be related to a modulation exerted by the gonadal hormones on ET-1 effects on the cardiovascular system.511 We have recently reported that in DOCA-salt hypertension, male rats display altered vascular and pressor responses to ET-1 and to the ETB agonist IRL-1620 and that these alterations are attenuated in female rats.3,4 We speculated that the differential and gender-related alterations in ET-1–mediated effects in DOCA-salt hypertension may be important in the higher blood pressure levels observed in male DOCA-salt hypertensive rats.3 On the basis of these results and considering that ovarian hormones modulate ET-1 responses/production,511 in the present study we tested the hypothesis that the ovarian hormones influence the attenuated changes in ET-1 actions observed in female DOCA-salt rats.

The major observation in this study is that removal of the ovaries and, consequently, a significant reduction in estradiol and progesterone levels worsens the changes in ET-1–induced effects observed in female DOCA-salt rats: it enhances IRL-1620–stimulated vasoconstriction, it further increases ET-1 and ETB receptor mRNA expression, and it exacerbates the BP-lowering effect of bosentan. Moreover, the implant of extended release pellets containing E or EP, which restored plasma levels of the hormones and uterine weight, reversed these changes. These data further support an important role for estradiol and progesterone in these processes. Changes in ETB vascular reactivity and expression have been observed in vessels from DOCA-salt hypertensive rats by us and others,3,4,15 and both functional and molecular up- or down-regulation of ETA and ETB receptors have been described in arterial hypertension.18,19 Additionally, gender differences in human saphenous vein ET-1 receptor density, as well as in the ratio of ETA to ETB receptors, favoring vasodilator effects in women, have also been reported.20

Mechanisms whereby estradiol and progesterone influence the ET-1 system have not been fully evaluated. However, there is evidence that estradiol influences vascular responses to ET-1 via receptor-dependent and -independent processes.21,22 It could also be speculated that estradiol differentially influences expression of endothelial ETB receptors that induce vasodilation and influences expression of vascular smooth muscle cell ETB receptors that are vasoconstrictory. We found increased mRNA expression of ETB receptors in DOCA-salt rats, which was associated with increased ETB-mediated vasoconstriction. Although we were unable to differentiate the cellular source of ETB receptors, the fact that IRL-1620 induced vasoconstriction suggests that ETB expression may be primarily on vascular smooth muscle cells. The fact that hormone replacement normalize these responses suggests an estrogenic/progesteronic-sensitive process. However, these aspects still wait clarification. There is also the possibility that the changes in vascular responsiveness to ETB stimulation and ET-1/ETB receptor expression are secondary to differences in blood pressure rather than because of lack of the ovarian hormones. This is supported by studies that show that chronic increases in blood flow upregulate ET-1 receptors, including ETB receptors in arterial smooth muscle.23 However, increased BP itself does not change ET-1 responses/production, because spontaneously hypertensive rats, which exhibit high BP, do not display alterations in the ET-1 pathway.17 In conclusion, the present study demonstrates that the lack of ovarian hormones increases vascular mRNA expression of ET-1 and ETB receptor subtype as well as vasoconstrictor responses to IRL-1620 and the BP-lowering effects of bosentan, whereas hormone replacement with E or EP restores these responses to a pattern similar to that observed in female DOCA-salt rats.

Acknowledgments

These studies were supported by grants from FAPESP and CNPq. We are most grateful to Dr Martine Clozel (Actelion Ltd, Allschwil, Switzerland) for the donation of bosentan and to M.A. Oliveira for excellent technical expertise.

Received March 28, 2001; accepted June 27, 2001.

References

  1. Cambotti LJ, Cole FE, Gerall AA, Frolich ED, Macphee AA. Neonatal gonadal hormones and blood pressure in the spontaneously hypertensive rat. Am J Physiol. . 1984; 247: E258–E264.[Abstract/Free Full Text]
  2. Crofton J, Share L. Gonadal hormones modulate deoxycorticosterone-salt hypertension in male and female rats. Hypertension. . 1997; 29: 494–499.[Abstract/Free Full Text]
  3. Tostes RCA, David FL, Fortes ZB, Nigro D, Scivoletto R, Carvalho MHC. Deoxycorticosterone acetate-salt hypertensive rats display gender-related differences in ETB receptor–mediated vascular responses. Brit J Pharmacol. . 2000; 130: 1092–1098.[Medline] [Order article via Infotrieve]
  4. Tostes RCA, David FL, Carvalho MHC, Nigro D, Scivoletto R, Fortes ZB. Gender differences in vascular reactivity to endothelin-1 in deoxycorticosterone acetate-salt hypertensive rats. J Cardiovasc Pharmacol. . 2000; 35 (suppl 6): S99–S101.
  5. Lamping KG, Nuno DW. Effects of 17ß-estradiol on coronary microvascular responses to endothelin-1. Am J Physiol. . 1996; 271: H1117–H1124.[Abstract/Free Full Text]
  6. Sudhir K, Ko E, Zellner C, Wong HE, Hutchison SJ, Chou TM, Chatterjee K. Physiological concentrations of estradiol attenuate endothelin-1-induced coronary vasoconstriction in vivo. Circulation. . 1997; 96: 3626–3632.[Abstract/Free Full Text]
  7. Polderman KH, Stehouwer CD, van Kamp GJ, Schalkwijk CG, Gooren LJ. Modulation of plasma endothelin levels by the menstrual cycle. Metabolism. . 2000; 49: 648–650.[Medline] [Order article via Infotrieve]
  8. Polderman KH, Stehouwer CD, van Kamp GJ, Dekker GA, Verheugt FW, Gooren LJ. Influence of sex hormones on plasma endothelin levels. Ann Intern Med. . 1993; 118: 429–432.[Abstract/Free Full Text]
  9. Best PJ, Berger PB, Miller VM, Lerman A. The effect of estrogen replacement therapy on plasma nitric oxide and endothelin-1 levels in postmenopausal women. Ann Intern Med. . 1998; 128: 285–288.[Abstract/Free Full Text]
  10. Wang X, Barber DA, Lewis DA, Mcgregor CGA, Sieck GC, Fitzpatrick LA, Miller VM. Gender and transcriptional regulation of NO synthase and ET-1 in porcine aortic endothelial cells. Am J Physiol. . 1997; 273: H1962–H1967.
  11. Ylikorkala O, Orpana A, Puolakka J, Pyorala T, Viinikka L. Postmenopausal hormonal replacement decreases plasma levels of ET-1. J Clin Endocrinol Metab. . 1995; 80: 3384–3387.[Abstract]
  12. Dantas APV, Scivoletto R, Fortes ZB, Nigro D, Carvalho MHC. Influence of female sex hormones on endothelium-derived vasoconstrictor prostanoid generation in microvessels of spontaneously hypertensive rats. Hypertension. . 1999; 34: 914–919.[Abstract/Free Full Text]
  13. Carvalho MHC, Nigro D, Scivoletto R, Barbeiro HV, Oliveira MA, Nucci G, Fortes ZB. Comparison of the effect of endothelin on microvessels and macrovessels in Goldblatt II and deoxycorticosterone acetate-hypertensive rats. Hypertension. . 1990; 15 (suppl I): I-68–I-71.
  14. Deng LY, Schiffrin EL. Effects of endothelin on resistance arteries of DOCA-salt hypertensive rats. Am J Physiol. . 1992; 262: H1782–H1787.[Abstract/Free Full Text]
  15. Zhao H, Joshua IG, Porter JP. Microvascular responses to endothelin in deoxycorticosterone acetate–salt hypertensive rats. Am J Hypertens. . 2000; 13: 819–826.[Medline] [Order article via Infotrieve]
  16. Larivière R, Day R, Schiffrin EL. Increased expression of endothelin-1 gene in blood vessels of deoxycorticosterone acetate–salt hypertensive rats. Hypertension. . 1993; 21: 916–920.[Abstract/Free Full Text]
  17. Schiffrin EL, Touyz RM. Vascular biology of endothelin. J Cardiovasc Pharmacol. . 1998; 32 (suppl 3): S2–S13.
  18. Cannan CR, Burnett JC, Lerman A. Enhanced coronary vasoconstriction to endothelin-B receptor activation in experimental congestive heart failure. Circulation. . 1996; 93: 646–651.[Abstract/Free Full Text]
  19. Ivy DD, Lecras TD, Horan MP, Abman SH. Increased lung preproET-1 and decreased ETB-receptor gene expression in fetal pulmonary hypertension. Am J Physiol. . 1998; 274: L535–L541.
  20. Ergul A, Shoemaker K, Puett D, Tackett RL. Gender differences in the expression of endothelin receptors in human saphenous vein in vitro. J Pharmacol Exp Ther. . 1998; 285: 511–517.[Abstract/Free Full Text]
  21. Akishita M, Kozaki K, Eto M, Yoshizumi M, Ishikawa M, Toba K, Orimo H, Ouchi Y. Estrogen attenuates endothelin-1 production by bovine endothelial cells via estrogen receptor. Biochem Biophys Res Commun. . 1998; 251: 17–21.[Medline] [Order article via Infotrieve]
  22. Dubey RK, Jackson EK, Keller PJ, Imthurn B, Rosseli M. Estradiol metabolites inhibit endothelin synthesis by an estrogen receptor-independent mechanism. Hypertension. . 2001; 37: 640–644.[Abstract/Free Full Text]
  23. Barber DA, Michener SR, Ziesmer SC, Miller VM. Chronic increases in blood flow upregulate endothelin-B receptors in arterial smooth muscle. Am J Physiol. . 1996; 270: H65–H71.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. P. Kunert, M. R. Dwinell, I. Drenjancevic Peric, and J. H. Lombard
Sex-specific differences in chromosome-dependent regulation of vascular reactivity in female consomic rat strains from a SS x BN cross
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2008; 295(2): R516 - R527.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
Md. S. Bhuiyan, N. Shioda, and K. Fukunaga
Ovariectomy augments pressure overload-induced hypertrophy associated with changes in Akt and nitric oxide synthase signaling pathways in female rats
Am J Physiol Endocrinol Metab, December 1, 2007; 293(6): E1606 - E1614.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
B. A. Parker, S. L. Smithmyer, J. A. Pelberg, A. D. Mishkin, M. D. Herr, and D. N. Proctor
Sex differences in leg vasodilation during graded knee extensor exercise in young adults
J Appl Physiol, November 1, 2007; 103(5): 1583 - 1591.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
R. A. Khalil
Sex Hormones as Potential Modulators of Vascular Function in Hypertension
Hypertension, August 1, 2005; 46(2): 249 - 254.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. F. Reckelhoff
Sex Steroids, Cardiovascular Disease, and Hypertension: Unanswered Questions and Some Speculations
Hypertension, February 1, 2005; 45(2): 170 - 174.
[Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
L. L. Yanes, D. G. Romero, V. E. Cucchiarelli, L. A. Fortepiani, C. E. Gomez-Sanchez, F. Santacruz, and J. F. Reckelhoff
Role of endothelin in mediating postmenopausal hypertension in a rat model
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2005; 288(1): R229 - R233.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. M. Orshal and R. A. Khalil
Gender, sex hormones, and vascular tone
Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2004; 286(2): R233 - R249.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by David, F. L.
Right arrow Articles by Tostes, R. C.A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by David, F. L.
Right arrow Articles by Tostes, R. C.A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
*PROGESTERONE
Medline Plus Health Information
*High Blood Pressure
Related Collections
Right arrow Animal models of human disease