doi: 10.1161/hy1001.091782
(Hypertension. 2001;38:786.)
© 2001 American Heart Association, Inc.
Scientific Contributions |
Neither the New Zealand Genetically Hypertensive Strain nor Dahl Salt-Sensitive Strain Has an A1079T Transversion in the 
1 Isoform of the Na+,K+-ATPase Gene
From the Department of Biochemistry, University of Queensland (R.B.), Brisbane, Australia; School of Life Sciences and Cooperative Research Centre for Diagnostic Technologies, Queensland University of Technology (G.K., S.M.), Brisbane, Australia; and Department of Surgery, University of Otago (E.L.H.), Dunedin, New Zealand.
Correspondence to Dr Eugenie L. Harris, Department of Surgery, University of Otago, Dunedin Public Hospital, Academic Wing, PO Box 913, Dunedin, New Zealand. E-mail jean.harris{at}stonebow.otago.ac.nz
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract—— A putative 1079A
T mutation in the 
1 isoform of the Na+, K+-ATPase (Atp1a1) gene of the Dahl salt-sensitive rat inbred by John Rapp (SS/Jr) strain was projected to cause a conformation change in the membrane hydrophobic region of the protein product, possibly resulting in hypertension. The existence of the mutation was challenged, but the challenge was apparently rebutted. The New Zealand genetically hypertensive (GH) rat is known to have a blood pressure quantitative trait locus on chromosome 2 containing the gene for the ATPase. Thus, we sought to determine whether the GH rat carried the 1079AT transversion. We chose a method, first nucleotide change analysis, that can detect point mutations in a mixed population of polymerase chain reaction (PCR) products, even in the presence of PCR bias, and confirmed our analysis by restriction enzyme digestion of PCR products. To ensure the validity of our analyses, we used site-directed mutagenesis to create positive controls containing the mutation. Surprisingly, we found that neither the GH nor the SS/Jr strain had the A1079T transversion. Indeed, the transversion was not found in any strain tested. As an incidental observation, we have sequenced the intron preceding the exon containing the putative A1079T transversion. Within this intron, a single-base C/T polymorphism was observed at base 132. Our results definitively eliminate the putative A1079T transversion in Atp1a1 as a causative factor underlying hypertension in the GH, spontaneously hypertensive, and SS/Jr rat strains and indicate that alternative candidate genes in the region defined by the chromosome 2 hypertension quantitative trait locus should be examined.
Key Words: Na+-K+-transporting ATPase • genetics • blood pressure • polymerase chain reaction • mutation
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The complex etiology of essential hypertension remains incompletely understood, despite much progress. Physiological studies have shown that imbalances in hormonal, cytokine, and salt-handling systems can cause increases in blood pressure, whereas genetic studies have identified quantitative trait loci (QTLs) for hypertension.1 Indeed, the genetic basis of some forms of hypertension with mendelian inheritance is understood: glucocorticoid remediable hyperaldosteronism, Liddle’s syndrome, and apparent mineralocorticoid excess come readily to mind.1,2 Less drastic damage to the genes involved in these disorders may contribute to essential hypertension in some populations.3,4
Research into the etiology of essential hypertension has been facilitated by the development of the genetically hypertensive inbred rat strains.5 Among these strains, the Dahl salt-sensitive rat inbred by John Rapp (SS/Jr) has particular appeal because, among humans, 
15% of normotensive white subjects and 27% of black subjects (rising to 29% and 50%, respectively, in borderline hypertensives) are thought to be salt sensitive6; additionally, it is well known that, regardless of the mechanism, increased reabsorption of Na+ by the kidney results in hypertension.2
The reported discovery of an 1079AT point mutation in the Atp1a1 allele of the SS/Jr strain7 presented the possibility of bringing together genetic and physiological findings to explain a component of hypertension in SS/Jr and to fulfill most of the criteria for establishing a gene/causality effect.8 This mutation would result in a Q276L substitution in the ATPase protein (Figure 1). Such a substitution was posited to alter the membrane confirmation of Na+,K+-ATPase, resulting in a change in the Na+-K+ pumping ratio and a concordant increase in reabsorption of Na+ in the kidney.7,9 Thus, the discovery of the point mutation in the ATPase, the location of the ATPase within a genomic region implicated in hypertension in a number of crosses10–15 and in the spontaneously hypertensive rat (SHR)XxBrown Norway (BN) recombinant inbred strains,16 and the probable physiological abnormalities created by the change in the protein structure of ATPase all came together to create an appealing scenario.
|
However, when another group attempted to use the point mutation to create an assay that would allow F2 rats from an SS/JrxDahl salt-resistant rat inbred by John Rapp (SR/Jr) cross to be genotyped for the ATPase, they were unable to find the mutation by either direct sequence analysis of polymerase chain reaction (PCR)–generated fragments from SS/Jr genomic DNA templates or EaeI digests of the fragments and concluded that the mutation probably did not exist.17 These negative findings were vigorously challenged,18 and a controversy arose over the existence of the mutation.19
The Npr1 allele of the genetically hypertensive rat has been shown to be associated with hypertension in a New Zealand genetically hypertensive (GH)xBN cross.12 The Npr1 gene is near Atp1a1 in the rat genome, presenting the possibility that the GH/BN polymorphism in Npr1 may be serving as a marker for a defect in the GH allele of Atp1a1. Both genes represent appealing candidates for hypertension causality. Furthermore, a genome-wide scan of this cross revealed a strong hypertension QTL on chromosome 2 containing the Atp1a1 and Npr1 genes (Figure 2). To resolve whether this QTL might be the result of a 1079AT transversion in the Atp1a1 allele of the GH rat, we analyzed genomic DNA from GH and BN rats for the point mutation. We also examined genomic DNA from SS/Jr and SR/Jr rats. Because the controversy over the ATPase centered on the possibility of PCR bias, we chose a method, first nucleotide change (FNC) analysis, that can detect point mutations in a mixed population of PCR products, even in the presence of PCR bias.20,21 Furthermore, we confirmed our results by restriction enzyme analysis and direct sequencing.
|
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Genomic DNA
Genomic DNA was purified from the livers of GH, BN, SHR, Wistar-Kyoto (WKY), and Lewis rats with a modification12 of the cationic salt method described by Gustincich et al.22 This procedure results in a genomic DNA concentration of approximately 1 mg/mL. Professor Stephen Harrap of the University of Melbourne kindly contributed genomic DNA purified from the livers of Donryu (DRY) rats. SS/Jr and SR/Jr genomic DNA was kindly contributed by Professor John Rapp of the Medical College of Ohio, Toledo.
PCR Analysis
Primers were designed with PrimerSelect (DNASTAR), with the cDNA sequence of Atp1a1 (GenBank accession No. M14511). The following primers (high-performance liquid chromatography purity, Life Technologies) were used: 1079+: GTCCCCGGATTTCACAAACGAGA; 1079-: ACCCGTGATGAGGTGGATGAAGTG; RAT1: BiotinCTTGCTTCTGGGCTGGAAGGCGGCC; MT-RAT: ACCCGTGATGAGGTGGATGAAGTGCTCGATTTCTTCAGCA-ATGGGGGTCAGGC.
These primers were used to amplify fragments from genomic DNA templates and to generate the PCR for the FNC procedure. The RAT1 primer was the mutation-specific primer used in the FNC analysis, and the MT-RAT primer was a mutagenic primer designed to create a positive control containing a T at base 1079 (mismatch base shown in bold type above). The 1079+/1079- primers amplify a base 918 to 1128 fragment of the Atp1a1 gene cDNA (GenBank accession No. M14511).
Either Platinum Taq (Life Technologies) or Pfu (Stratagene) was used for the PCRs. The PCR conditions were as follows: 200 µmol/L dNTPs, 500 nmol/L primers, 1.5 mmol/L MgCl2, and 25 mU/µL of Taq or Pfu in the appropriate PCR buffer mix, as recommended by the manufacturer of Pfu or Platinum Taq.
SS/Jr and SR/Jr genomic DNA templates were diluted 1:5, except for 34582 (SR/Jr) and 64651 (SS/Jr), which were diluted 1:50. The samples from the other strains were diluted 1:10 for PCR. A 20-µL aliquot of genomic DNA was used for the PCRs, which had a total volume of 100 µL. Template DNA was amplified in a Hybaid Touchdown thermal cycler with 2 minutes of denaturation at 95°C, followed by 35 cycles of annealing at 60°C for 30 seconds, extension at 72°C for 10 seconds, and denaturation at 95°C for 30 seconds, with a final cycle of 60°C for 30 seconds and 72°C for 3 minutes.
Products of PCR reactions were loaded and run on 2% agarose gels. Gels were stained with ethidium bromide (2 µL of 10 mg/mL stock added to 100 mL of agarose in Tris, acetate, EDTA [TAE] buffer) and visualized under ultraviolet light in a transilluminator (UVP Inc). Images were captured and saved in tagged image file format (TIFF) with Grab-it software from UVP Inc.
Site-Directed Mutagenesis
A mutant sequence with the same size insert as the wild type was produced by PCR mutagenesis with Platinum Taq, the 1079+ primer, and a 53-bp primer, MT-RAT, with a mismatch base 4 bases from the 3'. The mutagenic primer had the same 5' end as the 1079- primer so that the ends of the mutant product are the same as the ends of the PCR product generated from genomic samples and can be reamplified with the same primers. The mutant insert was cloned into the vector p-GEM-T (Promega) according to the manufacturer’s protocol.
FNC Analysis
This method20 measures the incorporation of a single fluorescent dideoxynucleotide triphosphate (ddNTP) into a minisequencing primer annealed to the PCR product. In brief, the PCR product is denatured by heating at 95°C for 10 minutes. The denatured PCR product is allowed to anneal to a biotin-labeled mutation detection primer, such that the 3' base of the mutation detection primer is adjacent to the base that may be mutated in the amplified sequence.
The annealed primer was then captured onto streptavidin-coated 96-well plates (NEN). Fluorescein-labeled ddNTPs (1 well each for ddATP, ddCTP, ddGTP, and ddUPT) were added along with the enzyme sequenase (Amersham). Incorporated fluoresceinated ddNTPs were detected with the use of an antifluorescein antibody conjugated to alkaline phosphatase (Roche), followed by measurement at 410 nm of conversion of paranitrophenylphosphate substrate (Sigma) to a colored product. The particular fluorescein ddNTP incorporated identifies the mutation. Table 1 shows a typical FNC output.
|
Sequencing
Sequencing reactions were performed in-house with the use of big-dye terminator chemistry (Roche), and sequencing gels were run and analyzed on ABI 377 sequencers at the Australian Genome Research facility (University of Queensland, Brisbane, Australia). Control sequences, generated by site-directed mutagenesis and cloned into P-GEM-T, were sequenced bidirectionally with the use of the 1079+ and 1079- primers, as were PCR products from 3 SS/Jr and 3 SR/Jr rats.
Restriction Digests
PCR fragments amplified from genomic DNA, with the use of the 1079+/1079- primer pair, and from control and mutant clones were subjected to parallel restriction digestion with EaeI or StuI (New England Biolabs Inc). For EaeI digests, approximately 0.2 to 0.5 µg of PCR products was mixed with 0.75 U of enzyme in the recommended buffer and digested for 75 minutes at 37°C. For StuI digests, approximately 2 U of enzyme was added to 10 µL of PCR product and incubated at 37°C for 2 hours in the recommended buffer. After the addition of 2 µL of bromphenol blue loading buffer, the digestion products were run on 2% agarose gels. Gels were stained with ethidium bromide and visualized under ultraviolet light. Images were captured and saved as TIFF files with Grab-it software from UVP Inc.
ATPase Modeling
No crystallography-derived model of the 1 isoform of the Na+,K+-ATPase was available, and therefore homology modeling was undertaken with the use of Deep View.23 Because no homologues were found in the database, the sequence had to be fractionated into 4 fragments consistent with homologous moieties in other proteins. The modeling of these fragments was performed as described elsewhere.23 The SWISS model server predicted the TM regions to be in the inaccessible core of the protein. To model these regions as external elements, the Ramachandran coordinates were changed to acceptable regions.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
FNC Analysis
FNC analysis revealed the presence of a T at the position equivalent to base 1079 of GenBank accession No. M14511 in the positive control created by site-directed mutagenesis. FNC analysis consistently showed that all the strains (GH, BN, SR/Jr, SS/Jr, SHR, WKY, Lewis, and DRY) had the base 1079A of the CD strain from Charles River, from which the M14511 sequence was obtained.23 Genomic DNA from 11 SS/Jr rats, 7 SR/Jr rats, 2 GH rats, 1 BN rat, 1 WKY rat, 1 SHR, 1 DRY rat, and 1 Lewis rat was assayed, and each assay was repeated at least twice. Results are summarized in Table 2.
|
EaeI Digest Results
The putative A1079T transversion abolishes an EaeI restriction site in the 1079+/1079- fragment. EaeI cleaved all of the 605-bp, 1079+/1079- PCR products into fragments of 551 and 54 bp (not visible on the gel shown in Figure 3). EaeI restriction digestion was performed on PCR products from 8 SS/Jr and 6 SR/Jr rats. Only the PCR products amplified from the 2 mutant positive control clones, M13 and M14, failed to produce the 551-bp fragment (Figure 3). Thus, the EaeI digests confirmed the results of the FNC analysis.
|
ATPase Modeling
Homology modeling was used to construct a 3-dimensional structure for the subunit of the Na+,K+ ATPase (see Methods). As can be seen in Figure 1, if the putative 1079AT transversion does indeed exist, it would modify the structure in a manner that could be expected to change the hydrophobicity of a cytoplasmic helical domain near the cytosolic opening of the pore structure.
The Intron
The 1079+/1079- primers amplify a 211-bp fragment from bases 918 to 1128 of the cDNA sequence,24 thus bracketing the putative A to T transversion site at nucleotide 1079. Amplification of genomic DNA, with the use of the 1079+/1079- primers, consistently produced fragments of approximately 600 bp, indicating the presence of an intron of approximately 390 bp. The exact size and position of this intron were determined by direct sequencing, revealing a 394-bp intron inserted between bases 988 and 989 of the cDNA sequence.
Searches against the GenBank database did not allow us to designate the intron number in the rat, but the intron/exon junction found in our sequence showed a strong homology with a short sequence on human chromosome 1 (HS1 to 3576). A BLAST alignment search, with the use of 40 base pairs that included our rat exon-intron boundary, against the entire human genome sequence found a single match against bases 969 to 996 of the chromosome 1 genomic sequence for exons 2 to 5 of human Na/K ATPase 1 subunit (GenBank accession No. M28284, gi:179213). This sequence is the boundary between human exon 4 and intron 4.
Comparison of intronic sequences among several strains (3 SS/Jr, 3 SR/Jr, and 1 BN were sequenced bidirectionally with the use of the 1079+ and 1079- primers) revealed a single nucleotide polymorphism (SNP) at base 132 of the intronic sequence: this base is a T in SS/Jr and BN, whereas it is a C in SR/Jr. The C at base 132 introduces a StuI cutting site. Accordingly, the remaining strains were genotyped for the SNP by applying StuI restriction digest analysis to genomic DNA fragments amplified by the 1079+/1079- primer pair. By StuI analysis, base 132 is a C in GH and SR/Jr strains, whereas it is a T in BN, SS/Jr, SHR, WKY, Lewis, and DRY strains (Table 2; Figure 4).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The importance of the Na+,K+-ATPase in maintaining ionic homeostasis, particularly the
1 isoform in the kidney and its relevance to hypertension,9 is alone enough to make this ATPase a worthy topic of research. The presence of the Atp1a1 gene within a QTL where GH alleles are associated with increased blood pressure12,15 (Figure 2) made it almost mandatory to determine whether the GH rat had the putative A1079T transversion reported by Herrera et al.7,18,25 If the GH rat could be shown to have the transversion, most of the criteria for determining whether this gene is causally involved in hypertension in the GH rat would have been fulfilled.8 Surprisingly, our results show that neither the GH nor the SS/Jr strain have this transversion.
Examination of the initial report on the transversion7 indicates that its discovery was based on just 1 clone from a cDNA library made from the kidney mRNA of a single SS/Jr rat. The rat was from a Boston University School of Medicine Dahl S colony, now defunct,18 but originally derived from an inbred hypertensive line obtained from Professor John Rapp, who developed the SS/Jr and SR/Jr strains. One possibility that would explain the discrepancy between our results and those of Herrera et al7,18,25 is that at least some of the rats, or even just the rat selected to make the cDNA library, formed a substrain that did indeed have the transversion. Alternatively, as suggested by Simonet et al,17 reverse transcriptase may have made an AT error at base 1079 when the mRNA used to make the library was converted to cDNA. In further work, Herrera et al7,18,25 considered the transversion confirmed on the basis of ligase chain reaction analysis, polymerase allele-specific amplification (PASA), and other methods.18,26 However, they failed to detect the transversion by sequencing a Dahl S Atp1a1 genomic DNA fragment isolated from a Dahl SHSD rat genomic library.25 They considered a PASA analysis that detected the transversion more valid than the sequence analysis that failed to detect the transversion, postulating that, when the PCR process encounters a T at base 1079, it is changed to an A.25 Although neither reverse transcriptases nor Taq polymerase is error free,26–30 we find no evidence of consistent obliteration of the 1079T mutation when it is present.
Direct sequencing of PCR products is relatively robust in comparison to sequencing a cloned PCR or cDNA fragment. A clone represents only 1 molecule. If that molecule has a polymerase or transcriptase error, that error is locked into all of the replicates of the clone. In direct sequencing, polymerase errors occur randomly, and any particular error is unlikely to affect a significant portion of the fragment molecules. Direct sequencing may be considered more robust than the PASA analysis used to confirm the transversion25 since PASA can be subject to read through.31,32 Direct sequencing, FNC analysis, and EaeI restriction digest analysis were all in accord in finding no A1079T transversion in any rat strain tested. We consider the FNC analysis particularly strong because it was proven able to detect point mutations in a mixed population of PCR products, even in the presence of PCR bias.21 In repeated FNC assays of samples from 11 SS/Jr rats, there was no significant signal indicative of the presence of a T at position 1079. The creation of a positive control by site-directed mutagenesis was also crucial to our investigation. This positive control demonstrated that each method we used was indeed able to detect a T at base 1079 and that, when present, the T at base 1079 persisted through the PCR amplification process. Thus, the failure to detect the A1079T transversion in all the rats tested can conclusively be ascribed to its absence rather than methodological bias.
The 1079+/1079- primer pair was chosen with the principal criteria of strong and specific amplification of a fragment that would contain the transversion. The primer design program PrimerSelect operates on nearest neighbor rules33 for determining primer melting/annealing and considers other parameters as well, such as 5'-3' primer stability, when picking primers. Indeed, amplifications with the 1079+/1079- primer pair were always extremely robust, and nonspecific bands were never observed. However, since there were no suitable Atp1a1 genomic sequences available for primer design, we knew that an intron might be encountered when applying the 1079+/1079- primer pair to rat genomic DNA, and an intron was indeed found (GenBank accession Nos. AF304110 to AF304117). Sequencing of the 394-bp intron, which is inserted between bases 988 and 989 of the mRNA sequence (GenBank accession No. M14511), revealed an SNP. This SNP should prove useful as a specific diagnostic marker (D2Elh1 in RATMAP34) for rat Atp1a1 gene alleles.
Our results eliminate an A1079T transversion in the Atp1a1 gene as a cause of hypertension in the GH, SHR, and SS/Jr hypertensive strains. However, it is still possible that some other, as yet undiscovered, abnormality in the untranscribed portion of the Atp1a1 gene could be responsible for a component of hypertension in these strains. While this possibility should be borne in mind, the elimination of the point mutation in the coding region as a factor contributing to hypertension suggests that some other gene is responsible for the chromosome 2 QTL observed in the GHXxBN cross and for similarly located hypertension QTLs in other crosses.
A number of candidate genes for hypertension are present in or near the region of the rat genome defined by the chromosome 2 hypertension QTL in our GHXxBN cross. Of these, the guanylyl cyclase A/atrial natriuretic peptide receptor (Npr1) gene lies at, or very close to, the peak of the QTL (Figure 2). The genes for the principal 2 soluble forms of guanylyl cyclase, Gucy1a1 and Gucy1b1, have recently been mapped close to Npr1 in the rat genome35 and therefore are also candidate genes. All 3 of these genes affect cGMP production. ANP binding results in increased cGMP mediated through the Npr1 gene product, an effect also produced by NO mediated through the Gucy1a1 and Gucy1b1 gene products. The GH rat has recently been shown to rapidly develop a strokelike syndrome (accompanied by basilar artery and resistance mesenteric artery remodeling) when given a NO synthase (NOS) inhibitor.36,37 Considering these genetic and physiological results, we postulate that a defect in Npr1, or possibly Gucy1a1 or Gucy1b1, may limit compensatory cGMP in the face of NOS inhibition and account for the development of stroke engendered by NOS inhibition in the GH rat. In this context, it is interesting to note that an NPR1 variant was recently shown to be associated with hypertension in the Japanese population,38 whereas the heterodimeric guanylyl cyclase subunit loci were not linked to hypertension in whites.39 Whereas Npr1, Gucy1a1, and Gucy1b1 are in close proximity in the rat genome, in humans NPR1 is on chromosome 1q21-q22, while GUCY1B3 and GUCY1A3, the human homologues of Gucy1a1 and Gucy1b1, are on chromosome 4 at q31.3-q33.40
In conclusion, it is clear that hypertension in several inbred hypertensive rat strains cannot be attributed to a transversion at position 1079 of the Atp1a1 gene, and alternative candidate genes should therefore be examined.
Received November 15, 2000; first decision December 12, 2000; accepted April 3, 2001.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Rapp JP. Genetic analysis of inherited hypertension in the rat. Physiol Rev. 2000; 80: 135–172.
2. Warnock DG. Hypertension. Semin Nephrol. 1999; 19: 374–380.[Medline] [Order article via Infotrieve]
3.
Gates LJ, MacConnachie AA, Lifton RP, Haites NE, Benjamin N. Variation of phenotype in patients with glucocorticoid remediable aldosteronism. J Med Genet. 1996; 33: 25–28.
4. Ferrari P, Lovati E, Frey FJ. The role of the 11ß-hydroxysteroid dehydrogenase type 2 in human hypertension. J Hypertens. 2000; 18: 241–248.[Medline] [Order article via Infotrieve]
5.
Jacob HJ. Functional genomics and rat models. Genome Res. 1999; 9: 1013–1016.
6. Sullivan JM. Salt sensitivity: definition, conception, methodology, and long-term issues. Hypertension. 1991; 17 (suppl I): I-61–I-68.
7.
Herrera VL, Ruiz-Opazo N. Alteration of alpha 1 Na+,K+-ATPase 86Rb+ influx by a single amino acid substitution. Science. 1990; 249: 1023–1026.
8. Rapp JP. A paradigm for identification of primary genetic causes of hypertension in rats. Hypertension. 1983; 5 (suppl I): I-198–I-203.
9.
Orosz DE, Hopfer U. Pathophysiological consequences of changes in the coupling ratio of Na,K-ATPase for renal sodium reabsorption and its implications for hypertension. Hypertension. 1996; 27: 219–227.
10. Jacob HJ, Lindpaintner K, Lincoln SE, Kusumi K, Bunker RK, Mao YP, Ganten D, Dzau VJ, Lander ESJr. Genetic mapping of a gene causing hypertension in the stroke-prone spontaneously hypertensive rat. Cell. 1991; 67: 213–224.[Medline] [Order article via Infotrieve]
11. Deng AY, Dene H, Rapp JP. Mapping of a quantitative trait locus for blood pressure on rat chromosome 2. J Clin Invest. 1994; 94: 431–436.
12. Harris EL, Phelan EL, Thompson CM, Millar JA, Grigor MR. Heart mass and blood pressure have separate genetic determinants in the New Zealand genetically hypertensive (GH) rat. J Hypertens. 1995; 13: 397–404.[Medline] [Order article via Infotrieve]
13.
Schork NJ, Krieger JE, Trolliet MR, Franchini KG, Koike G, Krieger EM, Lander ES, Dzau VJ, Jacob HJ. A biometrical genome search in rats reveals the multigenic basis of blood pressure variation. Genome Res. 1995; 5: 164–172.
14.
Samani NJ, Gauguier D, Vincent M, Kaiser MA, Bihoreau MT, Lodwick D, Wallis R, Parent V, Kimber P, Rattray F, Thompson JR, Sassard J, Lathrop M. Analysis of quantitative trait loci for blood pressure on rat chromosomes 2 and 13: age-related differences in effect. Hypertension. 1996; 28: 1118–1122.
15.
Stoll M, Kwitek-Black AE, Cowley AWJr, Harris EL, Harrap SB, Krieger JE, Printz MP, Provoost AP, Sassard J, Jacob HJ. New target regions for human hypertension via comparative genomics. Genome Res. 2000; 10: 473–482.
16. Pravenec M, Gauguier D, Schott J-J, Buardh J, Kren V, Bila V, Szpirer C, Szpirer J, Wang J-M, Huang H, St Lezin E, Spence MA, Flodman P, Printz M, Lathrop GM, Vergnaud G, Kurtz TW. Mapping of quantitative trait loci for blood pressure and cardiac mass in the rat by genome scanning of recombinant inbred strains. J Clin Invest. 1995; 96: 1973–1978.
17.
Simonet L, St Lezin E, Kurtz TW. Sequence analysis of the alpha 1 Na+,K+-ATPase gene in the Dahl salt-sensitive rat. Hypertension. 1991; 18: 689–693.
18.
Ruiz-Opazo N, Barany F, Hirayama K, Herrera VL. Confirmation of mutant alpha 1 Na,K-ATPase gene and transcript in Dahl salt-sensitive/JR rats. Hypertension. 1994; 24: 260–270.
19.
Analysis of Na+ pump genes. Hypertension. 1992; 19: 495–496.Letter.
20. Pecheniuk NM, Marsh NA, Walsh TP, Dale L. Use of first nucleotide change technology to determine the frequency of factor V Leiden in a population of Australian blood donors. Blood Coag Fibrinol. 1997; 8: 491–495.[Medline] [Order article via Infotrieve]
21. Barnard R, Futo V, Pecheniuk N, Slattery M, Walsh T. PCR bias toward the wild-type k-ras and p53 sequences: implications for PCR detection of mutations and cancer diagnosis. Biotechniques. 1998; 25: 684–691.[Medline] [Order article via Infotrieve]
22. Gustincich S, Manfioletti G, Del Sal G, Schneider C. A fast method for high-quality genomic DNA extraction from whole human blood. Biotechniques. 1991; 11: 298–303.[Medline] [Order article via Infotrieve]
23. Guex N, Diemand A, Peitsch MC. Protein modelling for all. Trends Biochem Sci. 1999; 24: 364–367.[Medline] [Order article via Infotrieve]
24. Shull GE, Greeb J, Lingrel JB. Molecular cloning of three distinct forms of the Na+,K+-ATPase alpha-subunit from rat brain. Biochemistry. 1986; 25: 8125–8132.[Medline] [Order article via Infotrieve]
25. Herrera VL, Xie HX, Lopez LV, Schork NJ, Ruiz-Opazo N. The alpha1 Na, K-ATPase gene is a susceptibility hypertension gene in the Dahl salt-sensitive HSD rat. J Clin Invest. 1998; 102: 1102–1111.[Medline] [Order article via Infotrieve]
26.
Roberts JD, Bebenek K, Kunkel TA. The accuracy of reverse transcriptase from HIV-1. Science. 1988; 242: 1171–1173.
27.
Yu H, Goodman MF. Comparison of HIV-1 and avian myeloblastosis virus reverse transcriptase fidelity on RNA and DNA templates. J Biol Chem. 1992; 267: 10888–10896.
28. http://listeria.nwfsc.noaa.gov/protocols/taq-errors.html.
29.
Keohavong P, Thilly WG. Fidelity of DNA polymerases in DNA amplification. Proc Natl Acad Sci U S A. 1989; 86: 9253–9257.
30.
Mendelman LV, Boosalis MS, Petruska J, Goodman MF. Nearest neighbor influences on DNA polymerase insertion fidelity. J Biol Chem. 1989; 264: 14415–14423.
31. De Milito A, Catucci M, Iannelli F, Romano L, Zazzi M, Valensin PE. Increased reliability of selective PCR by using additionally mutated primers and a commercial Taq DNA polymerase enhancer. Mol Biotechnol. 1995; 3: 166–169.[Medline] [Order article via Infotrieve]
32. Zhu KY, Clark JM. Addition of a competitive primer can dramatically improve the specificity of PCR amplification of specific alleles. Biotechniques. 1996; 21: 586–590.[Medline] [Order article via Infotrieve]
33.
Breslauer KJ, Frank R, Blöcker H, Marky LA. Predicting DNA duplex stability from the base sequence. Proc Natl Acad Sci U S A. 1986; 83: 3746–3750.
34. http://ratmap.gen.gu.se./.
35.
Azam M, Gupta G, Chen W, Wellington S, Warburton D, Danziger RS. Genetic mapping of soluble guanylyl cyclase genes: implications for linkage to blood pressure in the Dahl rat. Hypertension. 1998; 32: 149–154.
36. Ledingham JM, Laverty R. Basilar artery remodeling in the genetically hypertensive (GH) rat: effects of NOS inhibition and treatment with valsartan and enalapril. Clin Exp Pharmacol Physiol. 2000; 27: 642–646.[Medline] [Order article via Infotrieve]
37. Ledingham JM, Laverty R. Nitric oxide synthase (NOS) inhibition with L-NAME affects blood pressure and cardiovascular structure in the genetically hypertensive (GH) rat strain. Clin Exp Pharmacol Physiol. 1997; 24: 433–435.[Medline] [Order article via Infotrieve]
38.
Nakayama T, Soma M, Takahashi Y, Rehemudula D, Kanmatsuse K, Furuya K. Functional deletion mutation of the 5'-flanking region of type A human natriuretic peptide receptor gene and its association with essential hypertension and left ventricular hypertrophy in the Japanese. Circ Res. 2000; 86: 841–845.
39. Danziger RS, Pappas C, Barnitz C, Varvil T, Hunt SC, Leppert MF. Evaluation of heterodimeric guanylyl cyclase genes as candidates for human hypertension. J Hypertens. 2000; 18: 263–266.[Medline] [Order article via Infotrieve]
40. Giuili G, Roechel N, Scholl U, Mattei MG, Guellaen G. Colocalization of the genes coding for the alpha 3 and beta 3 subunits of soluble guanylyl cyclase to human chromosome 4 at q31.3-q33. Hum Genet. 1993; 91: 257–260.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
 |
|
 |
|
  M. Mokry and E. Cuppen The Atp1a1 Gene From Inbred Dahl Salt Sensitive Rats Does Not Contain the A1079T Missense Transversion Hypertension, April 1, 2008; 51(4): 922 - 927. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Tremblay, D. H.F. Hum, R. Sanchez, P. Dumas, M. Pravenec, D. Krenova, V. Kren, J. Kunes, Z. Pausova, F. Gossard, et al. TA Repeat Variation, Npr1 Expression, and Blood Pressure: Impact of the Ace Locus Hypertension, January 1, 2003; 41(1): 16 - 24. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. N. ORLOV, J. DUTIL, P. HAMET, and A. Y. DENG Replacement of {alpha}1-Na-K-ATPase of Dahl rats by Milan rats lowers blood pressure but does not affect its activity Physiol Genomics, December 21, 2001; 7(2): 171 - 177. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||