doi: 10.1161/hy0202.103275
(Hypertension. 2002;39:219.)
© 2002 American Heart Association, Inc.
Scientific Contributions |
Expression of Human Angiotensinogen-Renin in Rat
Effects on Transcription and Heart Function
From the Franz-Volhard Clinic, Humboldt University (S.B.), Berlin, Germany; and Max Delbrück Center for Molecular Medicine (B.H., D.V., E-G.K.), Berlin, Germany.
Correspondence to Sabine Bartel, Max Delbrück Center for Molecular Medicine, Robert Rössle Strasse 10, D-13125 Berlin, Germany. E-mail vkuhle{at}mdc-berlin.de
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
In double transgenic rats (dTGR) harboring the human angiotensinogen (hAOGEN) and human renin (hREN) genes, we studied cardiac transcript levels of hypertrophy-related, Ca2+ regulatory, and ß-adrenoceptor–associated proteins. The contractile properties and the cellular signaling of isolated hearts exposed to (-)isoproterenol and/or angiotensin (Ang) I were evaluated. dTGR developed hypertension of 174.1±7.6 versus 109.6±2.0 mm Hg (P<0.05) in Sprague-Dawley rats and heart hypertrophy. In hearts of dTGR, the transcript levels of ANP, ß-MHC, and
-MHC were altered (percentage versus Sprague-Dawley rats, 100%) by 304%, 178%, and 78%, respectively. Transcript levels of L-type Ca2+ channel, Ca2+ release channel, SERCA2a, phospholamban, Gi- and Gs-proteins were unchanged. Isolated hearts of dTGR indicated higher baseline contractility versus Sprague-Dawley rats. (-)Isoproterenol-modified contractility occurred in both groups; however, the extent (predrug value, 100%) was less in hearts of dTGR versus Sprague-Dawley rats (+dP/dt, 310±42% versus 534±63%; P<0.05). Interestingly, (-)isoproterenol shortened the relaxation time by 
25% in both groups. This finding was reflected by a protein kinase A–related phospholamban phosphorylation. Ang I depressed the heart contractility but did not interact with the protein kinase A pathway. In conclusion, we have found that expression of the hAOGEN-hREN complex in dTGR elicited specific effects on transcripts of ANP and myofibrillar proteins. Although the ß-adrenergically mediated relaxation was not impaired in the hypertrophied hearts, the extent of ß-adrenergic inotropic responsiveness was reduced.
Key Words: hypertrophy • contraction • relaxation • angiotensin I • adrenergic receptor agonists
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Cardiac hypertrophy is an adaptation to hemodynamic overload accompanied by a switch to embryonic gene expression profiles in myocardial cells.1–6 These changes were assumed to cause functional adaptation/impairment of hypertrophied hearts.3,7 Additionally, defects in ß-adrenoceptor–modified responses occur in the hypertrophied heart.6,8,9 The renin-angiotensin system (RAS) plays a prominent role in the pathophysiology of hypertrophy.10,11 An interesting model of hypertrophy was established using double transgenic rats (dTGR) resulting from crossings of homozygous human renin (hREN) with homozygous human angiotensinogen (hAOGEN) rats.12 Transcripts for the hAOGEN transgene were detected in all tissues tested, whereas the hREN transgene was present in the kidney, ovary, and adrenal gland. The transgenic offspring of the crosses show significantly elevated total plasma renin activity and chronic elevation of the blood pressure, resulting in cardiac hypertrophy and adrenergic dysfunction.12,13 The expression of human RAS provides the possibility to study human RAS-caused hypertrophy without interaction with the endogenous RAS. Therefore, we studied in the myocardium of dTGR the expression of markers for cardiac hypertrophy (ANP,
-MHC, ß-MHC), the transcript levels of Ca2+ regulatory proteins (L-type Ca2+ channel, Ca2+ release channel, Ca2+ ATPase [SERCA2a], phospholamban [PLB]) as well as G proteins. The sarcoplasmic reticulum plays the major role in the regulation of intracellular Ca2+ concentration in cardiomyocytes. The Ca2+ pumping activity of SERCA2a is controlled by PLB, which depresses Ca2+ sequestration in its dephosphorylated form. The importance of cAMP-dependent protein kinase (PKA)-dependent phosphorylation of PLB in the ß-adrenergic regulation of inotropy and lusitropy has been reported by several groups.14,15 The coupling between the cAMP and the angiotensin (Ang) II system in the heart remains controversial.16,17 But there are no data available concerning the interaction between cAMP and Ang I signaling in adult rat myocardium at the level of PKA-mediated phosphorylation of PLB. Therefore, we studied contractile parameters, the activation of PKA and the phosphorylation of PLB in isolated hearts of Sprague-Dawley rats and dTGR subjected to ß-adrenergic stimulation and/or Ang I. |
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Animals
Male dTGR (transgenic rats[hRENxhAOGEN]), age 5 to 6 weeks, were obtained from our in-house animal facility. Age-matched male Sprague-Dawley rats were from Sprague Dawley, Schönwalde, Germany. The rats were kept in a 12-hour/12-hour light/dark cycle. The blood pressure was measured by the tail-cuff method.13 Animals were kept in accordance with institutional guidelines for animal research.
Reverse Transcription–Polymerase Chain Reaction
RNA preparation was performed as described by Hoch et al.18 Polymerase chain reactions (PCRs) were performed in the linear ranges of the amplification reactions (cycle numbers given in italics) and normalized to GAPDH.19 Primer combinations and conditions for amplification of the 1C subunit of the L-type Ca2+ channel (24), the Ca2+ release channel (21), PLB (19), and GAPDH (19) are given by Hoch et al18; for -MHC and ß-MHC (16), by Luther et al.20 PCR condition for ANP (19) is given in Hoch et al,19 with the forward primer AGAGAGTGAGCCGAGACAGC and the reverse primer GCAGAGTGGGAGAGGTAAGG. For SERCA2a (19; forward primer GGAATTCCTAGAGATGTGCAATGCCCTC, reverse primer CGGGATCCCGTAACAACGCACATGCACGCA), cycling conditions as given by Hoch et al18 were used. Specificity of amplification products was confirmed by sequencing (InViTek).
Heart Perfusion
Hearts were perfused as described15 using a perfusion pressure of 80 mm Hg. Developed left ventricular pressure (dLVP), maximal rate of left ventricular pressure development (+dP/dt), and decline (-dP/dt) and coronary flow were recorded.
Drug Administration
For (-)isoproterenol, hearts were exposed for 2 minutes to 5 or 50 nmol/L (-)isoproterenol. For Ang I, after a 10-minute preexposure with the standard medium containing 0.05% bovine serum albumin (BSA), hearts were treated for 30 minutes with 0.3 µmol/L Ang I. For Ang I and 5 nmol/L (-)isoproterenol, (-)isoproterenol was co-added during the last 2 minutes of Ang I infusion. Control hearts were perfused with BSA for 40 minutes.
Western Blot Analysis
Nonphosphorylated and PKA phosphorylated PLB was immunologically detected as described.15 Gs, Gi2, and Gi3 proteins were assayed by adapted procedures reported in Bartel et al.21 The immunoreactions were evaluated as reported by Kuschel et al.15 Results are expressed as arbitrary units of optical density.
Other Assays
The activation of PKA was detected as reported in Kuschel et al.15 The Lowry method was used to measure the protein concentration.22
Statistics
Data are mean±SEM. Statistical analysis was done with Student‘s unpaired t test or ANOVA when appropriate. Differences were considered significant at P<0.05.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Characteristics of Sprague-Dawley Rats and dTGR
Table 1 summarizes characteristics of Sprague-Dawley rats and dTGR used in this study. The blood pressure of dTGR was increased 1.6-fold (P<0.05). Furthermore, dTGR had an increased heart weight–to–body weight index (P<0.05).
|
Gene Expression in Hearts of Sprague-Dawley Rats and dTGR
Evaluation of reverse transcription (RT)-PCR derived signals (n=5) demonstrate significant increases of the ANP mRNA levels in left ventricular tissue of dTGR (304.5±23.5% versus Sprague-Dawley rats, 100.0±3.6%; P<0.05) and a qualitative and quantitative switch in the expression of -MHC and ß-MHC mRNA (Figure 1). For the -MHC mRNA level, a significant decrease (77.8±3.4%) in hearts of dTGR compared with control (100.0±3.6, P<0.05) was detected, accompanied by a re-expression of the embryonic ß-MHC mRNA (178.0±17.5% versus Sprague-Dawley rats, 100.0±12.0; P<0.05). The transcript levels of various Ca2+-cycling proteins did not change significantly in dTGR compared with controls (Figure 2). Western blotting data (optical density) indicate no significant altered expression of G proteins (Gs: Sprague-Dawley rats, 0.60±0.04 versus dTGR, 0.72±0.05; Gi2: Sprague-Dawley rats, 3.02±0.10 versus dTGR, 3.32±0.12; Gi3: Sprague-Dawley rats, 2.19±0.20 versus dTGR, 2.35±0.23; n= 5 to 6).
|
|
Functional Studies in Isolated Hearts of Sprague-Dawley Rats and dTGR
Baseline contractile parameters of hearts from Sprague-Dawley rats and dTGR are presented in Table 2. There was a marked increase in dLVP (164%), +dP/dt (162%), and -dP/dt (172%) in dTGR compared with Sprague-Dawley rats (100%). In another subset of experiments, hearts of both groups were subjected to ß-adrenergic intervention (Figure 3). The observed percentage alterations of dLVP, +dP/dt, and -dP/dt were significantly lower (56%) in dTGR. The contractile baseline values of isolated hearts of Sprague-Dawley rats and dTGR were measured to be as follows: dLVP, 65.8±6.7 versus 97.8±5.5 mm Hg; +dP/dt, 1620±121 versus 2825±130 mm Hg/s; -dP/dt, -1334±11 versus -2328±92 mm Hg/s. In (-)isoproterenol–exposed hearts of Sprague-Dawley rats and dTGR, the parameters were changed to the following: dLVP, 271.4±27 versus 215.7±14.8 mm Hg; +dP/dt, 8662±101 versus 8672± 227 mm Hg/s; -dP/dt, 7539±260 versus 7217±370 mm Hg/s. The relaxation time (
1/2) was shortened in (-)isoproterenol–treated hearts of Sprague-Dawley rats, from 42.6±0.6 to 32.4±0.8 ms (P<0.05), and of dTGR, from 42.0±0.7 to 31.3±1.2 ms (P<0.05), respectively.
|
|
(-)Isoproterenol-Dependent Signaling in Hearts of Sprague-Dawley Rats and dTGR
(-)Isoproterenol activated PKA to similar degrees in the soluble and particulate heart tissue fractions in both groups (Figure 4). Next, we studied the PKA-related Ser16 phosphorylation of PLB in (-)isoproterenol–exposed hearts using a phosphorylation site-specific antibody. (-)Isoproterenol–stimulated Ser16 phosphorylation was observed in hearts of both groups. Ser16 phosphorylation in Sprague-Dawley rats was increased from a baseline value (optical density) of 0.23±0.2 to 12.6±1.7 and 25.4±3.9 and in dTGR to 15.0±0.02 and 24.9±2.6, when hearts were treated with 5 or 50 nmol/L (-)isoproterenol.
|
Interaction of Ang I With the ß-Adrenergic System in Hearts of Sprague-Dawley Rats and dTGR
Ang I attenuated the dLVP in both Sprague-Dawley rats and dTGR (Figure 5A). Contractile baseline values of hearts (n=5) of Sprague-Dawley rats and dTGR were measured to be as follows: dLVP, 71.3±4.8 versus 107.9±5.9 mm Hg; +dP/dt, 1671±84 versus 3017±140 mm Hg/s; -dP/dt, -1381±112 versus -2296±148 mm Hg/s. Ang I reduced significantly (P<0.05) these baseline values in Sprague-Dawley rats and dTGR to levels of the following: dLVP, 58.2±3.2 versus 75.0±3.9 mm Hg; +dP/dt, 1196±29 versus 2342±118 mm Hg/s; -dP/dt, -1159±80 versus -1443±82 mm Hg/s. The coronary flow was reduced in Ang I exposed hearts of both groups by 33.5±0.9% and 29.0±1.4% (P<0.05). (-)Isoproterenol enhanced the contractility in Ang I–pretreated hearts of Sprague-Dawley rats and dTGR to levels as follows: +dP/dt, 6694±305 versus 6428±271 mm Hg; and -dP/dt, -5926±353 versus -5640±305 mm Hg/s. For comparison, we performed experiments in which the hearts were challenged with (-)isoproterenol alone. +dP/dt was changed from 1621±75 to 6421±280 mm Hg/s (Sprague-Dawley rats, n=6) and from 3002±161 to 6836±265 mm Hg/s (dTGR, n=8) under these conditions. -dP/dt was increased from -1324±106 to -6676±333 mm Hg/s in Sprague-Dawley rats and from -2122±122 to -5818±279 mm Hg/s in dTGR. (-)Isoproterenol shortened 1/2 in hearts of Sprague-Dawley rats to 77.5±1.7% and of dTGR to 75.6±1.6% compared with the baseline values (100%). To analyze the potential role of PLB in modulation of lusitropy, we studied the PKA-related phosphorylation of PLB (Figure 5B). Because of the relatively low level of PLBl (16% of total phosphorylated PLB), the variance of the PLBl values is higher compared with that of PLBh. Summarizing the densitometric data (optical density) of PLBl and PLBh, there is no difference in the (-)isoproterenol–caused PLB phosphorylation between both groups (Sprague-Dawley rats: isoproterenol, 17.8±3, and Ang I+ isoproterenol, 17.9±3.2; dTGR: isoproterenol, 20.8±2.2, and Ang I+ isoproterenol, 19.5±0.6) (Figure 5B). Ang I alone has not affected the phosphorylated status of PLB.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Gene Expression in Hearts of dTGR
We have found that the expression of Gs and Gi proteins and of Ca2+-regulating proteins involved in E-C coupling and Ca2+ uptake into the sarcoplasmic reticulum were unchanged in hearts of dTGR. Therefore, these proteins seem to not be responsible for the diminished ß-adrenergic responsiveness of the hearts of dTGR. Interestingly, we have recognized that there is a human RAS-related shift in the
-MHC/ß-MHC composition. Remodeling of myofibrils may play a role in myocardial dysfunction in hearts of hypertensive rats.2,23 A shift from -MHC to ß-MHC is associated with decreased myosin ATPase activity and shortening but also an energetically more efficient contraction.24 Moreover, it has been demonstrated that the myosin ATPase of ß-MHC is not a target of the cAMP-regulated pathway.25 Whether the change in the proportion of -MHC to ß-MHC indicates additionally a process of accelerated aging in dTGR, dying after a mean time of 55 days12 remains to be established. Previous studies have shown that blocking of the Ang II type 1 receptor may prevent the myofibrillar remodeling and account for the beneficial effects of angiotensin antagonists in old SHR.23 These findings may also explain the alterations in the MHC status of dTGR characterized by increased plasma renin activity.12
ß-Adrenergic Responsiveness in Hearts of dTGR
We observed increased baseline contractility in hearts of dTGR, which may be linked to the -MHC–to–ß-MHC shift. These data are in line with results reported for hearts of old hypertensive rats.2,23,26 The diminished (-)isoproterenol–mediated inotropic response could be attributed, at least in part, to the inverse shift of -MHC and ß-MHC and their relative content. Furthermore, the decreased myocardial ß-adrenergic responsiveness has been attributed to downregulation of ß-adrenoceptors and to increased Gi proteins.3 But in our study, no altered Gs and Gi protein profile was found in dTGR. Other groups, including ours,14,15 have demonstrated the important role of ß-adrenergically mediated phosphorylation of PLB in regulating relaxation. (-)Isoproterenol–shortened relaxation is associated with PKA-dependent PLB phosphorylation also in the hearts of dTGR.
Interaction Between Ang I and (-)Isoproterenol in Hearts of dTGR
Cardiac ACE has been demonstrated to be the major enzyme for Ang II generation.27–30 However, the myocardial function of Ang II is not clear. Although Ang II exerted positive inotropic effects in heart preparations of dog31 and in human atrial heart,32 the opposite was found in neonatal and adult rat cardiomyocytes.16,33 Additionally, it has been demonstrated that Ang I/Ang II contribute to coronary vasoconstriction and impaired diastolic function of perfused rat hearts with pressure-overload–induced hypertrophy.27,28 Now, we present data showing that Ang I reduces the baseline contractility in both, isolated hearts of Sprague-Dawley rats and dTGR. Because of the high plasma renin activity and the occurrence of Ang I in the effluent of hearts of dTGR,12,13 we suggest that there must be a chronological vasoconstriction in dTGR. Recent data from Ang I or human renin–perfused hearts of rats overexpressing the hAOGEN gene support our conclusion.29 With regard to controversial reports concerning the interplay of cAMP- and Ang I/Ang II–mediated pathways in the cardiovascular system,16,17,33 our results clearly demonstrate contractile (-)isoproterenol responsiveness in the presence of Ang I. More interestingly, the effect of (-)isoproterenol on relaxation was maintained in hypertrophied hearts pre-exposed to Ang I. Additionally, a PKA-related PLB phosphorylation occurs in the presence of Ang I in hearts of dTGR. Thus, we postulate no relationship between Ang I and cAMP-induced shortening of relaxation time. In summary, hearts of dTGR are characterized by (1) increased ANP-transcript levels, (2) a MHC isoform-switch, and (3) reduced ß-adrenergic positive responsiveness but unimpaired lusitropy.
|
Acknowledgments |
|---|
The authors acknowledge the assistance of Wolfgang Schlegel and the critical discussion of Peter Karczewski, PhD. This work was supported by the Sonnenfeld-Stiftung, Berlin, Germany.
Received September 12, 2001; first decision September 24, 2001; accepted November 13, 2001.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Katz AM. The cardiomyopathy of overload: an unnatural growth response in the hypertrophied heart. Ann Intern Med. 1994; 121: 363–371.
2. Ohata K, Kim S, Iwao H. Role of angiotensin-converting enzyme, adrenergic receptors, and blood pressure in cardiac gene expression of spontaneously hypertensive rats during development. Hypertension. 1996; 28: 627–634.
3. Castellano M, Böhm M. The cardiac ß-adrenoceptor–mediated signaling pathway and its alterations in hypertensive heart disease. Hypertension. 1997; 29: 715–722.
4. Arai M, Matsui H, Periasamy M. Sarcoplasmic reticulum gene expression in cardiac hypertrophy and heart failure. Circ Res. 1994; 75: 555–564.
5. Lompre AM, Schwartz K, d‘Àlbis A, Lacombe G, van Tiem NV, Swynghedauw B. Myosin isoenzyme redistribution in chronic heart overload. Nature. 1979; 282: 105–107.[CrossRef][Medline] [Order article via Infotrieve]
6. Feldmann RD, Chorazyczewski J. G protein function is reduced in hypertension. Hypertension. 1997; 29: 422–427.
7. Eizema K, Fechner H, Bezstarosti K, Schneider-Rasp S, Laarse A, Wang H, Schultheiss HP, Poller WC, Lamers JMJ. Adenovirus-based phospholamban antisense expression as a novel approach to improve cardiac contractile dysfunction. Circulation. 2000; 101: 2193–2199.
8. Böhm M, Gierschik P, Knorr A, Larisch K, Weismann K, Erdmann E. Desensitization of adenylate cyclase and increase of Gi in cardiac hypertrophy due to acquired hypertension. Hypertension. 1992; 20: 103–112.
9. Moravec CS, Keller E, Bond M. Decreased inotropic response to beta-adrenergic stimulation and normal sarcoplasmic reticulum calcium stores in the spontaneously hypertensive rat heart. J Mol Cell Cardiol. 1995; 27: 2101–2109.[CrossRef][Medline] [Order article via Infotrieve]
10. Lijnen P, Petrov V. Renin-angiotensin system, hypertrophy and gene expression in cardiac myocytes. J Mol Cell Cardiol. 1999; 31: 949–970.[CrossRef][Medline] [Order article via Infotrieve]
11. Lindpaintner K, Ganten D. The cardiac renin-angiotensin system: an appraisal of present experimental and clinical evidence. Circ Res. 1991; 68: 905–921.
12. Bohlender J, Fukamizi A, Lippoldt A, Nomura T, Dietz R, Menard J, Murakami K, Luft FC, Ganten D. High human renin hypertension in transgenic rats. Hypertension. 1997; 29: 428–434.
13. Bohlender J, Hildenbrand U, Wagner KD, Günther J, Hempel P, Schlegel WP, Luft FC, Krause EG, Bartel S. Myocardial adrenergic dysfunction in rats with transgenic, human renin-dependent hypertension. J Hypertens. 2001; 19: 1–11.[CrossRef][Medline] [Order article via Infotrieve]
14. Luo W, Grupp IL, Harrer J, Ponniah S, Grupp G, Duffy JJ, Deutschmann T, Kranias EG. Targeted ablation of the phospholamban gene is associated with markedly enhanced myocardial contractility and loss of ß-agonist stimulation. Circ Res. 1994; 75: 401–409.
15. Kuschel M, Karczewski P, Hempel P, Schlegel WP, Krause EG, Bartel S. Ser16 prevails over Thr17 phospholamban phosphorylation in the ß-adrenergic regulation of cardiac relaxation. Am J Physiol. 1999; 276: H1625–H1633.[Medline] [Order article via Infotrieve]
16. Allen IS, Cohen NM, Dhallan RS, Gaa ST, Lederer WJ, Rogers TB. Angiotensin II increases spontaneous contractile frequency and stimulates calcium current in cultured neonatal rat heart myocytes: insights into the underlying biochemical mechanisms. Circ Res. 1988; 62: 524–534.
17. Obayashi K, Horie M, Xie LH, Tsuchiya K, Kubota A, Ishida H, Sasayama S. Angiotensin II inhibits protein kinase A–dependent chloride conductance in heart via pertussis toxin–sensitive G proteins. Circulation. 1997; 95: 197–204.
18. Hoch B, Haase H, Schulze W, Hagemann D, Morano I, Krause E-G, Karczewski P. Differentiation-dependent expression of cardiac 
-CaMKII isoforms. J Cell Biochem. 1998; 68: 259–268.[CrossRef][Medline]
[Order article via Infotrieve]
19. Hoch B, Meyer R, Hetzer R, Krause EG, Karczewski P. Identification and expression of -isoforms of the multifunctional Ca2+/calmodulin-dependent protein kinase in failing and nonfailing human myocardium. Circ Res. 1999; 84: 713–721.
20. Luther HP, Hille S, Haase H, Morano I. Influence of mechanical activity, adrenergic stimulation, and calcium on the expression of myosin heavy chains in cultivated neonatal cardiomyocytes. J Cell Biochem. 1997; 64: 458–465.[CrossRef][Medline] [Order article via Infotrieve]
21. Bartel S, Karczewski P, Krause EG. G proteins, adenylyl cyclase and related phosphoproteins in the developing rat heart. J Mol Cell Biochem. 1996; 163/164: 99–106.[CrossRef]
22. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with Folin phenol reagent. J Biol Chem. 1951; 193: 265–275.
23. Brooks WW, Bing OHL, Boluyt MO, Malhorta A, Morgan JP, Satoh N, Colucci WS, Conrad CH. Altered inotropic responsiveness and gene expression of hypertrophied myocardium with captopril. Hypertension. 2000; 35: 1203–1209.
24. Alpert NR, Mulieri LA. Increased myothermal economy of isometric force generation in compensated cardiac hypertrophy induced by pulmonary artery constriction in the rabbit. Circ Res. 1982; 50: 491–500.
25. Winegard S, Weisberg A. Isozyme specific modification of myosin ATPase by cAMP in rat heart. Circ Res. 1987; 60: 383–392.
26. Brooksby P, Levi AJ, Jones JV. Investigation of the mechanisms underlying the increased contraction of hypertrophied ventricular myocytes isolated from the spontaneously hypertensive rat. Cardiovasc Res. 1993; 27: 1268–1277.
27. Schunkert H, Jackson B, Tang SS, Schoen FJ, Smits JF, Apstein CS, Lorell BH. Distribution and functional significance of cardiac angiotensin converting enzyme in hypertrophied rat hearts. Circulation. 1993; 87: 1328–1339.
28. Lopez JJ, Lorell BH, Ingelfinger JR, Weinberg EO, Schunkert H, Diamant D, Tang SS. Distribution and function of cardiac AT1- and AT2-receptor subtypes in hypertrophied rat hearts. Am J Physiol. 1994; 36: H844–H852.
29. Müller DN, Fischli W, Clozel JP, Hilgers KF, Bohlender J, Menard, Busjahn A, Ganten D, Luft FC. Local angiotensin II generation in the rat heart: role of renin uptake. Circ Res. 1998; 82: 13–20.
30. De Mello WC, Danser AHJ. Angiotensin II and the heart. Hypertension. 2000; 35: 1183–1188.
31. Kobaiashi M, Furukawa Y, Chiba S. Positive chronotropic and inotropic effects of angiotensin II in the dog heart. Eur J Pharmacol. 1978; 501: 17–25.
32. Drexler H, Hasenfuss G, Holubarsch C. Signaling pathways in failing human heart muscle cells. Trends Cardiovasc Med. 1997; 7: 151–160.[CrossRef]
33. De Mello WC. Intracellular angiotensin II regulates the inward calcium current in cardiac myocytes. Hypertension. 1998; 32: 976–982.
This article has been cited by other articles:
 |
|
 |
|
  J. Piuhola, I. Szokodi, P. Kinnunen, M. Ilves, R. deChatel, O. Vuolteenaho, and H. Ruskoaho Endothelin-1 Contributes to the Frank-Starling Response in Hypertrophic Rat Hearts Hypertension, January 1, 2003; 41(1): 93 - 98. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||