Published online before print June 10, 2002, doi: 10.1161/01.HYP.0000022062.70639.1C
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Hypertension. 2002;40:101.)
© 2002 American Heart Association, Inc.
Scientific Contributions |
Role of the 
1D-Adrenegric Receptor in the Development of Salt-Induced Hypertension
Department of Molecular, Cell Pharmacology, National Center for Child Health and Development Research Institute (A.T., T.K., C.H., S.O., G.T.), Tokyo, Japan; and Discovery Research Laboratories, Nippon Shinyaku Co (M.K., S.M.), Tsukuba City, Ibaraki, Japan.
Correspondence to Gozoh Tsujimoto, Department of Molecular, Cell Pharmacology, National Center for Child Health and Development Research Institute, 3-35-31, Taishi-do, Setagaya-Ku, Tokyo 154-8567, Japan. E-mail gtsujimoto{at}nch.go.jp
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
In an attempt to elucidate whether there is a specific
1-adrenergic receptor (1-AR) subtype involved in the genesis or maintenance of hypertension, the 1D-AR subtype was evaluated in a model of salt-induced hypertension. The 1D-AR–deficient (1D-/-) and control (1D+/+) mice (n=8 to 14 in each group) were submitted to subtotal nephrectomy and given 1% saline as drinking water for 35 days. Blood pressure (BP) was monitored by tail-cuff readings and confirmed at the end point by direct intraarterial BP recording. The 1D-/- mice had a significantly (P=0.0004) attenuated increase in BP response in this protocol (baseline 94.6±2.8 versus end point 107.4±4.5 mm Hg) compared with that of their wild-type counterparts (1D+/+), from a baseline 97.4±2.9 to an end point 139.4±4.5 mm Hg. Seven of 15 1D+/+ mice died with edema, probably owing to renal failure, whereas 14 of 15 1D-/- mice were maintained for 35 days. Body weight, renal remnant weight, and residual renal function were similar in the 2 groups, whereas the values of plasma catecholamines (epinephrine, norepinephrine, and dopamine) were higher in 1D+/+ than in the 1D-/- mice. These data suggest that 1D-AR plays an important role in developing a high BP in response to dietary salt-loading, and that agents having selective 1D-AR antagonism could have significant therapeutic potential in the treatment of hypertension.
Key Words: receptors, adrenergic • mice • hypertension, sodium-dependent • nephrectomy
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Hypertension is a disease characterized by an increase in peripheral vascular resistance.1,2 Despite the great amount of research on the subject, the specific events that lead to the development of high blood pressure (BP) are not known. However, at the vascular level, 2 factors seem to be involved in the pathogenesis of this condition: (1) structural changes in blood vessel walls and (2) hypersensitivity of blood vessels to vasoconstrictor stimuli.3–6 Structural changes could represent an adaptive phenomenon in which the arterial wall thickens in response to an increase in BP.5 Consequently, hypertension predisposes the individual to the cardiovascular diseases, renal failure, and stroke.7 Hyperreactivity of vascular smooth muscle to adrenergic stimulation has been suggested as a major cause for the increase and maintenance of BP in animal models such as spontaneously hypertensive rats (SHR) and deoxycorticosterone acetate (DOCA)–salt hypertensive rats.3,6,8,9
Catecholamines cause vascular smooth muscle contraction by activating 1-adrenergic receptors (1-ARs), and drugs that block 1-ARs lead to a fall in peripheral vascular resistance and in venous return to the heart and in BP. Three subtypes of 1-AR (1A, 1B, and 1D) have been isolated and shown to share a high degree of structural similarity (50% to 60% amino acid identity). All of these receptors couple to Ca2+ signaling, leading to muscle contraction.10 Although the 3 1-ARs differ in their patterns of tissue expression, little is known about the pathophysiological role of each 1-AR subtype. Among the 3 subtypes, the 1D-AR has been implicated in mediating contraction of the aorta and superior mesenteric arteries of human,11 mouse,12–14 and rats,15–17 suggesting that this receptor may be important in the regulation of peripheral vascular tone in vivo. We have recently shown that 1D-AR regulates BP via vasoconstriction with 1D-AR–deficient mice.14 Also, vascular 1D-AR has been suggested to be related to the pathogenesis/maintenance of hypertension related to aging and SHR.18,19
Subtotal nephrectomy is a long-accepted experimental procedure20 that has been used over the years to accentuate salt-induced hypertension equivalent to that accompanying human chronic renal failure. The mechanisms by which salt-loading increases BP are still incompletely understood, but increasing evidence suggests that a neurogenic mechanism is involved in an early interaction between vasopressinergic and adrenergic neurons in the central nervous system (CNS). This then leads to a subsequent persistent hyperadrenergic state.21 Previous experimental efforts have been focused on the 2-AR as an important sympathetic component in this interaction,22–24 whereas much less attention has been paid to the role of the 1-AR. To assess the functional roles of 1D-AR subtypes in salt-induced hypertension, genetically altered mice lacking the 1D-AR were examined by a dietary salt-loading study that was initiated after subtotal nephrectomy.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Animals
Two groups of male mice, age 7 to 9 weeks and weighing 23.2 to 28.2 g, were used in the present study. Homozygous (
1D-/-) knockout mice for the 1D-AR subtype with the genetic background of 129Sv and C57Black6/J strains were used, along with their wild-type controls (1D+/+), which were littermates of the 1D-/- mice. All mice were housed in the animal quarters with a 12-hour light/dark cycle and were provided food and distilled water ad libitum. After subtotal nephrectomy, drinking water was replaced with 1% saline. All experiments were conducted in accordance with guidelines for the care and use of animals approved by the National Center for Child Health and Development Research Institute.
Animal Genotyping
Inactivation of the 1D-AR gene involved insertion of the pGK-Neo cassette.14 Genotypes were determined from DNA isolated from the tail using the following primers: 1D-1521R (CAGCTGCACTCAGTAGCAGGTCA), 1D-1239F (CGCTGTTGGTGGGAACCGGCAGCGG), and Neo-2401-F (CCTACAATTTTGAATGGAAGGATTG) were used to detect the intact (282 bp) or interrupted (637 bp) 1D-AR gene. The 1D-1521R primer was located within the first exon of the 1D-AR gene, and the 1D-1239F primer was within the region of the first exon replaced with the Neo in the mutant allele. The Neo-2401-F primer was within the Neo gene. Each sample contained the upstream and downstream primers (10 pmol of each), 0.25 mmol/L of each dNTP, 50 mmol/L KCl, 10 mmol/L Tris-HCl pH 8.6, 1.5 mmol/L MgCl2, and 2.5 U of Taq DNA polymerase (Takara Shuzo Co). Thermal cycling was performed for 1 minute at 94°C, 1 minute at 56°C, and 2 minutes at 72°C for 30 cycles. Bands were separated on 2% agarose gels.
Subtotal Nephrectomy and BP Monitoring
Mice (n=15 in each group) were submitted to subtotal nephrectomy and handled as described.22 Briefly, both poles of the left kidney were excised under anesthesia with intraperitoneal sodium pentobarbital (50 mg/kg), leaving a small amount of residual renal tissue around the hilum and preserving the ureter and hilar vessels. The excised renal tissues were weighed, and the ratios of these organs to the body weight were calculated individually. After a 7-day recovery period, the right kidney was removed, leaving 25% of the total renal mass. Twenty-four hours after the second operation, the animals were placed and maintained on 1% saline as drinking water for 35 days.
Tail-cuff systolic BP (SBP) and heart rate (HR) measurements were obtained by use of a computerized tail-cuff system (BA-98A system, Softron Co) as described elsewhere.14 Mice were monitored for 35 days or until they became hypertensive; ie, their tail-cuff SBP reached 150 mm Hg, or an increase of >40 mm Hg above baseline was recorded and sustained for 3 consecutive days. BP measurements of recorded for the last 3 days were averaged, and the resulting mean value was considered the end point tail-cuff BP for the animal. For animals that failed to develop hypertension as defined above during the 35-day period, the end point tail-cuff BP was calculated by averaging the measurements recorded for the last 3 days. The end point tail-cuff BP was confirmed by direct measurement via arterial catheterization at the end of the study, as described previously.14
Measurement of Plasma Catecholamines and Creatinine
Blood was drawn slowly from the arterial line and used for measuring plasma catecholamine levels (epinephrine, norepinephrine, and dopamine) and creatinine levels. Catecholamine levels were determined by high-pressure liquid chromatography using commercially available reagents (Tosho Co) as described elsewhere.14 Plasma creatinine was determined by use of a commercially available colorimetric kit from Sigma Diagnostics.
Statistical Analysis
All values are expressed as mean±SEM. P<0.05 according to a Student’s t test was considered statistically significant. Cumulative survival curves were constructed by the Kaplan-Meier method,25 and difference between the curves was tested for significance with the use of the log-rank statistic.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
General
Fifteen mice from each group were submitted to subtotal nephrectomy and 1% saline loading. Four of the 15
1D+/+ mice died with general edema within 4 days without an appreciable change in BP, and 3 of the 1D+/+ mice died with general edema and hypertension (139 to 145 mm Hg, >40 mm Hg from the baseline) at the seventh, 12th, and 35th day, respectively. All 1D-/- mice were maintained for 35 days, except 1 mouse that died on the 26th day after nephrectomy, during handling for the tail-cuff monitoring, without an appreciable change in BP (Figure 1). At the 35th day, the Kaplan-Meier analysis detected a favorable effect of 1D-/- gene ablation on cumulative survival. The difference in survival rates calculated by log-rank test was significantly better in the mutant mice group (53% for 1D+/+ and 93% for 1D-/-; P=0.0121).
|
No significant differences were observed between genetically altered mice and their controls in regard to body weight at baseline and end point, ratios of excised or remnant kidney weight to body weight at the end point, and ratios of heart weight to body weight at the end point. There were also no differences in plasma creatinine levels (Table), indicating that the residual renal function after subtotal nephrectomy was similar in the 2 groups and within a normal range, compared with another report.26 Plasma creatinine levels and ratios of heart weight to body weight in both groups were significantly (P<0.05) increased compared with those of controls that did not undergo salt-loading (creatinine: 7.25±0.05 µmol/L in 1D+/+, n=8, 7.07±0.05 µmol/L in 1D-/-, n=12; heart-weight/body-weight ratio: 4.62±0.31 mg/g, in 1D+/+, n=8, 4.82±0.23 mg/g, in 1D-/-, n=12, respectively), indicating that this kind of salt loading could affect the renal or cardiac functions.
|
Tail-Cuff Measurements
Figure 2 shows the time course of tail-cuff HR and SBP changes during the 1% saline drinking period after subtotal nephrectomy in the 2 groups. Figure 2A presents HR changes and shows that in both groups, HR did not differ and significantly increased compared with the baseline (baseline versus end point: 557±23 bpm and 629±26 bpm in 1D+/+, n=8, P=0.041 and 502±23 bpm and 597±16 bpm, in 1D-/-, n=14, P=0.0004). On the other hand, Figure 2B presents SBP changes in the 1D+/+ (n=8) and the 1D-/- (n=14) mice and shows that SBP in the 1D+/+ mice increased significantly by the end of the 35-day period, whereas that in the 1D-/- mice did not change significantly. Hypertension, as defined in the Methods section, developed within 3 weeks on average in the 1D+/+ mice, not including the 7 mice that died. Only 2 out of 14 1D-/- mice that survived developed hypertension (their SBP reached 150 mm Hg), whereas 6 out of 8 surviving 1D+/+ mice developed hypertension (2 SBPs were increased >40 mm Hg from the baseline, and 4 reached 150 mm Hg).
|
, n=8) or
Figure 3 summarizes BP and HR measurements of 2 groups of mice at the baseline and end point. Figure 3A shows that there was no difference in baseline SBP (ie, before surgery) between the 1D-/- (n=14) and control 1D+/+ (n=8) mice (97.4±2.8 mm Hg and 94.6±2.9 mm Hg in 1D+/+ and 1D-/- mice, respectively, P=0.46). However, an attenuated hypertensive response to subtotal nephrectomy and salt loading was observed in the 1D-/- mice, resulting in a significantly lower end point SBP compared with that of their wild-type controls (139.4±4.5 mm Hg and 107.4±4.5 mm Hgin 1D+/+ and 1D-/- mice, respectively, P=0.0004) (Figure 3B). Figure 3D and 3E present mean tail-cuff HR measurements for the 2 groups. Tail-cuff HR levels at baseline and end point tended to be somewhat higher in the 1D+/+ (n=8) than in the 1D-/- mice (n=14), but these differences were not significant. A significant increase in tail-cuff HR relative to baseline was observed in both groups after subtotal nephrectomy and 1% saline loading (according to a paired t test).
|
Intraarterial BP and HR Measurements
The end point direct mean arterial pressure (MAP) and HR measurements for each group are shown in Figure 3C and 3F. Consistent with the end point tail-cuff BP measurements, direct MAP was significantly lower in the 1D-/- (n=14) group compared with the 1D+/+ mice (n=8) (124.1±7.6 mm Hg in the 1D-/- versus 161.9±6.8 mm Hg in the 1D+/+ mice; P=0.016). Comparison of end point tail-cuff SBP measurements with direct MAP values showed that direct MAP values were higher than tail-cuff SBP measurements. Direct HR tended to be higher in the 1D+/+ mice, but this difference was not significant (565±46 bpm in the 1D-/- versus 634±18 bpm in the 1D+/+ mice; P=0.14).
Catecholamines Levels
Plasma catecholamine levels for both groups are shown in the Table. Plasma catecholamines for both groups increased after salt loading compared with those measured in 1D+/+ or 1D-/- mice without salt loading (basal levels of plasma total catecholamines; 31.05±2.82 nmol/L in 1D+/+, 27.43±4.57 nmol/L, in 1D-/-).14 Plasma epinephrine levels tended to be higher in 1D+/+ (n=8) than in the 1D-/- mice (n=14), but this difference was not significant. Norepinephrine, dopamine, and total catecholamine levels were significantly higher in 1D+/+ (n=8) than in the 1D-/- mice (n=14).
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The functional role of the
1D-AR subtype in the development of high BP was investigated using a model of salt-induced hypertension. One percent saline was given as drinking water to mice genetically lacking 1D-AR after subtotal nephrectomy. The 1D-/- mice had a significantly attenuated increase in MAP compared with that of 1D+/+ mice. The present study provides clear evidence that 1D-AR plays an important role in developing high BP in response to dietary salt loading. In addition to our observations, several reports support the idea that 1D-AR could be involved in the pathogenesis and/or maintenance of hypertension.19,27–30
We observed that 7 1D+/+ mice died with general edema during 1% saline drinking after subtotal nephrectomy, whereas only 1 1D-/- mouse died in the same period. This might suggest that 1D-/- mice are less susceptible to acute renal failure caused by subtotal nephrectomy followed by 1% saline drinking. As the amount of excised kidney in the dead 1D+/+ mice was comparable to that in surviving 1D+/+ mice (the ratio of excised kidney weight to body weight was 3.31±0.02 mg/g in surviving mice, n=8, and 3.33±0.04 mg/g in dead mice, n=7), our view is that the lesser amount of remaining kidney was not the direct cause of death. Although the exact reason for the different death rates is uncertain, the present study clearly shows that the lack of 1D-AR leads to a better prognosis.
Interestingly, relative heart weights significantly increased even in the 1D-/- mice without hypertension. It is generally accepted that cardiac hypertrophy develops in response to increased cardiac workload as a compensatory mechanism. Various factors, including mechanical and biochemical ones, are involved in the development of cardiac hypertrophy.31 As the 1D-/- mice did not develop hypertension by salt loading, an enhanced adrenergic effect on the heart, rather than the mechanical stress owing to hypertension, might be directly related to the increased heart weight in the 1D-/- mice. Although studies have suggested that 1-ARs are pivotal in promoting cardiac hypertrophy, most studies favor the 1A-AR as the dominant subtype,32 with little cardiac role of 1D-AR. This is in good agreement with our observation that the heart was enlarged in the 1D-/- mice under high circulating catecholamines. Besides the enhanced adrenergic system, biochemical alterations such as saltwater imbalance, other exogenous factors could be involved. Further study is required to clarify the functional role of 1D-AR in this type of acute renal failure.
The present experiment also clearly indicates that 1D-AR is a prerequisite for development of salt-induced hypertension. Possible explanations for the observation that mice lacking the 1D-AR gene are less susceptible to developing salt-induced hypertension could include (1) decreased vascular reactivity to enhanced adrenergic stimuli that accompanies salt loading, (2) altered sympathetic activity in the CNS, and (3) altered functional activity of renal 1D-AR in reabsorption of sodium.
The 1D-/- mice had a significantly attenuated increase in MAP with salt loading compared with that of 1D+/+ mice. Catecholamines induce vasoconstriction mainly via stimulation of vascular 1-AR family, 1D-AR in particular.33 Our recent characterization of 1D-/- mice showed that the vascular contractile response and the pressor response to 1-AR stimulation are mediated primarily by 1D-AR, among the 3 1-AR subtypes.14 Thus, 1-AR antagonists such as prazosin are considered to exert their hypotensive effect mainly by inhibiting vascular 1D-AR. Hence, mice lacking the 1D-AR are less susceptible to developing salt-induced hypertension, and this could partly be owing to their reduced vascular reactivity to 1-AR stimulation. In addition to 1D-AR, it was previously reported that mice lacking 2B-AR, which is abundant in the vasculature rather than in CNS and is responsible for a peripheral vasoconstrictive action, 34 are less susceptible to develop hypertension in the same salt-loading hypertension model.22 Hence, these studies may indicate that an enhanced sympathetic activity is of importance in developing and maintaining this salt-loading hypertension. Moreover, the studies show that 1D-AR and 2B-AR, those mediating adrenergic vasoconstriction, can be potentially important therapeutic targets in this type of hypertension. Further studies with selective pharmacological tools will clarify the relative contribution of each receptor in this hypertension model.
The lesser increase in BP observed in 1D-/- mice can also be explained by a suppressed sympathetic activity. 1-AR has been implicated to regulate sympathetic outflow in the CNS, and the 1-AR blocker prazosin has been implicated to act in the CNS to suppress sympathetic outflow.35 In fact, we observed that the increase in circulating catecholamines with salt loading was less in 1D-/- mice compared with 1D+/+ mice, although the basal levels of circulating catecholamines were not much different between 1D+/+ and 1D-/- mice. As most of patients with hypertension have a higher norepinephrine level,36,37 this is reminiscent of the previous report that prazosin appears to depress baroreflex function, in hypertensive patients in particular.38 Hence, 1D-AR, which is abundant in the CNS, might play an important role in the regulation of sympathetic outflow, and mice lacking the 1D-AR might be less susceptible to develop salt-induced hypertension, primarily because they cannot respond to salt loading with the normal increase in sympathetic outflow. Hence, ablating 1D-AR may lead to antihypertensive effects salt-induced hypertension, partly by reducing the amount of endogenous agonist as well as by modulating vascular reactivity to them. The role of 1D-AR in developing a hyperadrenergic state in salt-sensitive hypertension is clearly of great interest and needs to be further investigated.
Besides the 2 above-mentioned possibilities, altered 1-AR function in renal reabsorption of sodium should be taken into account. Renal 1-ARs have been implicated in BP control and hypertension in rats. They apparently mediate Na+-H+ exchange,39–43 although the responsible subtypes are considered to be 1A-AR and 1B-AR, but not 1D-AR. As in the case of rats, murine kidney expresses 1A-AR and 1B-AR and very low levels of 1D-AR;14,44 however, 1D-AR could be induced and would have an important regulatory activity in subtotal nephrectomy/salt-loading. Therefore, the potential functional significance of 1D-AR in the pathophysiological setting of salt-induced hypertension is still uncertain in the present study.
The results presented here support the idea that 1D-AR can play a role in the development of essential hypertension or hypertension with salt-sensitivity.29 Furthermore, it was reported that functional expression of 1D-AR in the resistance vessels increases with age.18 These observations make it worth exploring whether genetic differences in 1D-AR structure, density, or function or alterations due to aging and other factors, are associated with differences in salt sensitivity in humans. Also, the present study strongly suggests that 1D-AR antagonism could have therapeutic potential in the treatment of hypertension.
Perspective
Using 1D-AR knockout mice, the present study shows that 1D-AR plays an important role in developing the dietary salt-loading hypertension. Selective 1D-AR antagonism could have significant therapeutic potential in the treatment of hypertension.
|
Acknowledgments |
|---|
We thank Michi Narutomi for assistance. This work was supported in part by research grants from the Scientific Fund of the Ministry of Education, Science, and Culture of Japan; the Japan Health Science Foundation; the Ministry of Human Health and Welfare; the Organization for Pharmaceutical Safety and Research (OPSR), and a Grant for a Liberal Harmonious Research Promotion System from the Science and Technology Agency.
|
Footnotes |
|---|
Drs Tanoue, Koba, and Miyawaki contributed equally to this work.
Received April 3, 2002; accepted May 1, 2002.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Jackson CA, Insel PA. Renal
-adrenergic receptors and genetic hypertension. Pediatr Nephrol. 1993; 7: 853–858.[CrossRef][Medline]
[Order article via Infotrieve]2. Marin J. Mechanisms involved in the increased vascular resistance in hypertension. J Auton Pharmacol. 1993; 13: 127–176.[Medline] [Order article via Infotrieve]
3. Suzuki S, Takata Y, Kubota S, Ozaki S, Kato H. Characterization of the 1 adrenoceptors in the mesenteric vasculature from deoxycorticosterone-salt hypertensive rats: studies on vasoconstriction, radioligand binding and postreceptor events. J Pharmacol Exp Ther. 1994; 268: 576–583.
4. Caveney SW, Taylor DA, Fleming WW. Examination by radioligand binding of the 1 adrenoceptors in the mesenteric arterial vasculature during the development of salt-sensitive hypertension. Naunyn Schmiedebergs Arch Pharmacol. 1997; 356: 374–382.[CrossRef][Medline]
[Order article via Infotrieve]
5. Simon G, Illyes G, Csiky B. Structural vascular changes in hypertension: role of angiotensin II, dietary sodium supplementation, blood pressure, and time. Hypertension. 1998; 32: 654–660.
6. Ibarra M, Lopez-Guerrero JJ, Villalobos-Molina R. Further evidence for the predominance of 1D-adrenoceptors in arteries of normotensive and spontaneously hypertensive rats. Pharmacol Rev Commun. 1998; 10: 135.
7. Williams GH. Hypertensive vasculopathy.In: Isselbacher KJ, Brauaunwald E, Wilson JD, Martin JB, Fauci AS, Kasper DL, eds. Harrison’s Internal Medicine, 13th ed. New York: McGraw-Hill; 1994: 1116–1131.
8. Takata Y, Kato H, Adrenoceptors in SHR. alterations in binding characteristics and intracellular signal transduction pathways. Life Sci. 1996; 58: 91–106.[Medline] [Order article via Infotrieve]
9. Jones AW, Geisbuhler BB, Shukla SD, Smith JM. Altered biochemical and functional responses in aorta from hypertensive rats. Hypertension. 1988; 11: 627–634.
10. Piascik MT, Perez DM. 1-Adrenergic receptors: new insights and directions. J Pharmacol Exp Ther. 2001; 298: 403–410.
11. Rudner XL, Berkowitz DE, Booth JV, Funk BL, Cozart KL, D’Amico EB, El-Moalem H, Page SO, Richardson CD, Winters B, Marucci L, Schwinn DA. Subtype specific regulation of human vascular 1-adrenergic receptors by vessel bed and age. Circulation. 1999; 100: 2336–2343.
12. Yamamoto Y, Koike K. Characterization of 1-adrenoceptor–mediated contraction in the mouse thoracic aorta. Eur J Pharmacol. 2001; 424: 131–140.[CrossRef][Medline]
[Order article via Infotrieve]
13. Yamamoto Y, Koike K. 1-Adrenoceptor subtypes in the mouse mesenteric artery and abdominal aorta. Br J Pharmacol. 2001; 134: 1045–1054.[CrossRef][Medline]
[Order article via Infotrieve]
14. Tanoue A, Nasa Y, Koshimizu T, Shinoura H, Oshikawa S, Kawai T, Sunada S, Takeo S, Tsujimoto G. The 1D-adrenergic receptor directly regulates arterial blood pressure via vasoconstriction. J Clin Invest. 2002; 109: 765–775.[CrossRef][Medline]
[Order article via Infotrieve]
15. Piascik MT, Hrometz SL, Edelmann SE, Guarino RD, Hadley RW. Brown RD. Immunocytochemical localization of the 1B adrenergic receptor and the contribution of this and other subtypes to vascular smooth muscle contraction: analysis with selective ligands and antisense oligonucleotides. J Pharmacol Exp Ther. 1997; 283: 854–868.
16. Kenny BA, Chalmers DH, Philpott PC, Naylor AM. Characterization of an 1D-adrenoceptor mediating the contractile response of rat aorta to noradrenaline. Br J Pharmacol. 1995; 115: 981–986.[Medline]
[Order article via Infotrieve]
17. Villalobos-Molina R, Lopez-Guerrero JJ, Ibarra M. 1D- and 1A-Adrenoceptors mediate contraction in rat renal artery. Eur J Pharmacol. 1997; 322: 225–227.[CrossRef][Medline]
[Order article via Infotrieve]
18. Ibarra M, Terron JA, Lopez-Guerrero JJ, Villalobos-Molina R. Evidence for an age-dependent functional expression of 1D-adrenoceptors in the rat vasculature. Eur J Pharmacol. 1997; 322: 221–224.[CrossRef][Medline]
[Order article via Infotrieve]
19. Villalobos-Molina R, Lopez-Guerrero JJ, Ibarra M. Functional evidence of 1D-adrenoceptors in the vasculature of young and adult spontaneously hypertensive rats. Br J Pharmacol. 1999; 126: 1534–1536.[CrossRef][Medline]
[Order article via Infotrieve]
20. Koletsky S, Goodsitt AM. Natural history and pathogenesis of renal ablation hypertension. Arch Pathol. 1960; 69: 654–662.[Medline] [Order article via Infotrieve]
21. Gavras H, Gavras I. Salt-induced hypertension: the interactive role of vasopressin and of the sympathetic nervous system. J Hypertens. 1989; 7: 601–606.[CrossRef][Medline] [Order article via Infotrieve]
22. Makaritsis KP, Handy DE, Johns C, Kobilka B, Gavras I, Gavras H. Role of the 2B-adrenergic receptor in the development of salt-induced hypertension. Hypertension. 1999; 33: 14–17.
23. Gavras I, Manolis AJ, Gavras H. The 2-adrenergic receptors in hypertension and heart failure: experimental and clinical studies. J Hypertens. 2001; 19: 2115–2124.[CrossRef][Medline]
[Order article via Infotrieve]
24. Gavras I, Gavras H. Role of 2-adrenergic receptors in hypertension. Am J Hypertens. 2001; 14: 171S–177S.[CrossRef][Medline]
[Order article via Infotrieve]
25. Kaplan EL, Meier P. Nonparametric estimation from incomplete observations. J Am Stat Assoc. 1958; 53: 457–481.[CrossRef]
26. Melnikov VY, Ecder T, Fantuzzi G, Siegmund B, Lucia MS, Dinarello CA, Schrier RW, Edelstein CL. Impaired IL-18 processing protects caspase-1–deficient mice from ischemic acute renal failure. J Clin Invest. 2001; 107: 1145–1152.[Medline] [Order article via Infotrieve]
27. Ibarra M, Pardo JP, Lopez-Guerrero JJ, Villalobos-Molina R. Differential response to chloroethylclonidine in blood vessels of normotensive and spontaneously hypertensive rats: role of 1D- and 1A-adrenoceptors in contraction. Br J Pharmacol. 2000; 129: 653–660.[CrossRef][Medline]
[Order article via Infotrieve]
28. Villalobos-Molina R, Lopez-Guerrero JJ, Ibarra M. The hypotensive effect of BMY 7378 is antagonized by a silent 5-HT1A receptor antagonist: comparison with 8-hydroxy-dipropylaminotetralin. Arch Med Res. 2001; 32: 389–393.[CrossRef][Medline] [Order article via Infotrieve]
29. Villalobos-Molina R, Ibarra M. Vascular 1D-adrenoceptors: are they related to hypertension? Arch Med Res. 1999; 30: 347–352.[CrossRef][Medline]
[Order article via Infotrieve]
30. Villalobos-Molina R, Ibarra M. 1-adrenoceptors mediating contraction in arteries of normotensive and spontaneously hypertensive rats are of the 1D or 1A subtypes. Eur J Pharmacol. 1996; 298: 257–263.[CrossRef][Medline]
[Order article via Infotrieve]
31. Varagic J, Susic D, Frohlich E, Heart, aging, and hypertension. Curr Opin Cardiol. 2001; 16: 336–341.[CrossRef][Medline] [Order article via Infotrieve]
32. Rokosh DG, Stewart AF, Chang KC, Bailey BA, Karliner JS, Camacho SA, Long CS, Simpson PC. 1-Adrenergic receptor subtype mRNAs are differentially regulated by 1-adrenergic and other hypertrophic stimuli in cardiac myocytes in culture and in vivo: repression of 1B and 1D but induction of 1C. J Biol Chem. 1996; 271: 5839–5843.
33. Gavras H, Handy D, Gavras I. Alpha-adrenergic receptors in hypertension.In: Laragh JH, Brenner BM, eds. Hypertension Pathophysiology, Diagnosis, and Management, 2nd ed. New York: Raven Press; 1995: 853–861.
34. Link RE, Desai K, Hein L, Stevens ME, Chruscinski A, Bernstein D, Barsh GS, Kobilka BK. Cardiovascular regulation in mice lacking 2-adrenergic receptor subtypes b and c. Science. 1996; 273: 803–805.[Abstract]
35. Hoffman BB, Lefkowitz R J. Catecholamines, sympathomimetic drugs, and adrenergic receptor antagonists.In: Hardman JG, Limbird LE, Molinoff RB, Ruddon RW, eds. The Pharmacological Basis of the Therapeutics. 9th ed. New York: McGraw-Hill; 1996: 199–248.
36. Floras JS. Epinephrine and the genesis of hypertension. Hypertension. 1992; 19: 1–18.
37. Jacobs MC, Lenders JW, Willemsen JJ, Thien T. Adrenomedullary secretion of epinephrine is increased in mild essential hypertension. Hypertension. 1997; 29: 1303–1308.
38. Sasso EH, O’Connor DT. Prazosin depression of baroreflex function in hypertensive man. Eur J Clin Pharmacol. 1982; 22: 7–14.[CrossRef][Medline] [Order article via Infotrieve]
39. Guyton AC. Blood pressure control-body fluids. Science. 1991; 252: 1813–1816.
40. Michel MC, Siepmann F, Bilscher R, Philipp T, Brodde OE. Ontogenesis of sympathetic responsiveness in spontaneously hypertensive rats. Hypertension. 1993; 22: 169–177.
41. DiBona GF, Kopp UC. Neural control of renal function. Physiol Rev. 1997; 77: 75–197.
42. Ferrandi M, Tripodi G, Salardi S, Florio M, Modica R, Barassi P, Parenti P, Shainskaya A, Karlish S, Bianchi G, Perrari P, Renal Na,K-ATPase in genetic hypertension. Hypertension. 1996; 28: 1018–1025.
43. Liu F, Nesbitt T, Drezner M, Friedman PA, Gesek FA. Proximal nephron Na+/H+ exchange is regulated by 1A- and 1B-adrenergic receptor subtypes. Mol Pharmacol. 1997; 52: 1010–1018.
44. Yang M, Reese J, Cotecchia S, Michel MC. Murine 1-adrenoceptor subtypes. I. Radioligand binding studies. J Pharmacol Exp Ther. 1998; 286: 841–847.
This article has been cited by other articles:
 |
|
 |
|
  E. Oliver, D. Marti, F. Monto, N. Flacco, L. Moreno, D. Barettino, M. D. Ivorra, and P. D'Ocon The Impact of {alpha}1-Adrenoceptors Up-Regulation Accompanied by the Impairment of {beta}-Adrenergic Vasodilatation in Hypertension J. Pharmacol. Exp. Ther., March 1, 2009; 328(3): 982 - 990. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. I. Cohn, D. M. Harris, S. Pesant, M. Pfeiffer, R.-H. Zhou, W. J. Koch, G. W. Dorn 2nd, and A. D. Eckhart Inhibition of vascular smooth muscle G protein-coupled receptor kinase 2 enhances {alpha}1D-adrenergic receptor constriction Am J Physiol Heart Circ Physiol, October 1, 2008; 295(4): H1695 - H1704. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. S. Lyssand, M. C. DeFino, X.-b. Tang, A. L. Hertz, D. B. Feller, J. L. Wacker, M. E. Adams, and C. Hague Blood Pressure Is Regulated by an {alpha}1D-Adrenergic Receptor/Dystrophin Signalosome J. Biol. Chem., July 4, 2008; 283(27): 18792 - 18800. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Chen, T. W. Moon, K. R. Olson, R. A. Dombkowski, and S. F. Perry The effects of salt-induced hypertension on {alpha}1-adrenoreceptor expression and cardiovascular physiology in the rainbow trout (Oncorhynchus mykiss) Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2007; 293(3): R1384 - R1392. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Hosoda, M. Hiroyama, A. Sanbe, J.-i. Birumachi, T. Kitamura, S. Cotecchia, P. C. Simpson, G. Tsujimoto, and A. Tanoue Blockade of both {alpha}1A- and {alpha}1B-adrenergic receptor subtype signaling is required to inhibit neointimal formation in the mouse femoral artery Am J Physiol Heart Circ Physiol, July 1, 2007; 293(1): H514 - H519. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Hosoda, T.-a. Koshimizu, A. Tanoue, Y. Nasa, R. Oikawa, T. Tomabechi, S. Fukuda, H. Shinoura, S. Oshikawa, S. Takeo, et al. Two {alpha}1-Adrenergic Receptor Subtypes Regulating the Vasopressor Response Have Differential Roles in Blood Pressure Regulation Mol. Pharmacol., March 1, 2005; 67(3): 912 - 922. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. M. Wall, Y. H. Kim, L. Stanley, D. M. Glapion, L. A. Everett, E. D. Green, and J. W. Verlander NaCl Restriction Upregulates Renal Slc26a4 Through Subcellular Redistribution: Role in Cl- Conservation Hypertension, December 1, 2004; 44(6): 982 - 987. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Zhang, S. Cotecchia, S. A. Thomas, A. Tanoue, G. Tsujimoto, and J. E. Faber Gene deletion of dopamine {beta}-hydroxylase and {alpha}1-adrenoceptors demonstrates involvement of catecholamines in vascular remodeling Am J Physiol Heart Circ Physiol, November 1, 2004; 287(5): H2106 - H2114. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T.-a. Koshimizu, G. Tsujimoto, A. Hirasawa, Y. Kitagawa, and A. Tanoue Carvedilol selectively inhibits oscillatory intracellular calcium changes evoked by human {alpha}1D- and {alpha}1B-adrenergic receptors Cardiovasc Res, September 1, 2004; 63(4): 662 - 672. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. E. Gates, H. Tanaka, W. R. Hiatt, and D. R. Seals Dietary Sodium Restriction Rapidly Improves Large Elastic Artery Compliance in Older Adults With Systolic Hypertension Hypertension, July 1, 2004; 44(1): 35 - 41. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. W. Jones Dietary Sodium and Blood Pressure Hypertension, May 1, 2004; 43(5): 932 - 935. [Full Text] [PDF]
|
|
|
|
|
|
C. Hague, Z. Chen, A. S. Pupo, N. A. Schulte, M. L. Toews, and K. P. Minneman The N Terminus of the Human {alpha}1D-Adrenergic Receptor Prevents Cell Surface Expression J. Pharmacol. Exp. Ther., April 1, 2004; 309(1): 388 - 397. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||