| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Hypertension. 2002;40:840.)
© 2002 American Heart Association, Inc.
Scientific Contributions |
From HELIOS Klinikum-Berlin, Franz Volhard Clinic and Medical Faculty of the Charité, Humboldt University of Berlin (D.N.M., A.M., R.D., A.F., B.P., F.C.L.); Max Delbrück Center for Molecular Medicine (D.N.M., F.C.L.), Berlin-Buch; the Department of Medicine-Nephrology, Hannover Medical School (J.-K.P., H.H.), Hannover; and Hoffmann-La Roche Ltd (B.-M.L., D.B.-K., S.M., H.D., J.D.A.), Basel, Switzerland.
Correspondence to Dr Friedrich C. Luft, Franz Volhard Clinic, Wiltberg Strasse 50, 13125 Berlin, Germany. E-mail luft{at}fvk-berlin.de
| Abstract |
|---|
|
|
|---|
Key Words: angiotensin II enzymes fibrosis hypertrophy
| Introduction |
|---|
|
|
|---|
B) and transcription factor activator protein (AP)-1 in the kidney and the heart, independent of blood pressure reduction in these rats.3 Bohlender et al4 studied the same rat strain and showed that a specific ETA receptor blocker is effective, particularly when combined with an Ang II receptor blocker. ET-1 is a 21amino acid peptide that was first isolated from porcine endothelial cells.5 Two structurally related peptides differing by 2 (ET-2) and 6 (ET-3) amino acids were subsequently identified. The endothelin precursors are processed by 2 proteases that create mature active forms, termed preproendothelins. The preproendothelins are cleaved at dibasic sites by furin-like endopeptidases to produce inactive intermediates termed big endothelins. Big endothelins are cleaved to form the final products. A family of membrane-bound zinc metalloproteases from the neprilysin superfamily conducts the last processing step. These enyzmes are the endothelin-converting enzymes (ECEs). ECE-1 is found in endothelial cells and has a sharp activity peak at neutral pH. The enzyme processes big ETs both intracellularly and on the cell surface. The enzyme structure has recently been elucidated in detail.6 Big ET-1 and ET-1 levels are strongly related to survival in patents with congestive heart failure.7 Because selective enzymatic processing of ET-1 formation appears to be an important therapeutic target for heart failure, we tested the utility of ECE inhibition in our model. | Methods |
|---|
|
|
|---|
Tissue preparation and immunohistological techniques were performed as described before in detail.911 The sections were incubated with primary antibodies against rat monocytes/macrophages (surface marker ED1, Serotec), collagen I (South Bio ASS), fibronectin (Paesel), basic fibroblast growth factor (bFGF; Transductions Laboratories), and tissue factor (gift of Dr Th. Luther, TU Dresden, Germany). Scoring of ED-1positive cells was performed with the use of the program KS 300 3.0 (Zeiss). Fifteen different areas of each heart and kidney (n=5 in all groups) were analyzed without knowledge of rat identification. Collagen IV expression and fibronectin expression were assessed semiquantitatively by two independent observers who were blind to the treatments. The data are expressed in arbitrary units (0 to 5), based on the staining intensity.
For RT-PCR, RNA of the left ventricle was isolated by means of the TRIZOL protocol (Gibco Life Technology). Real-time quantitative RT-PCR was performed by using the TaqMan system (PE Biosystems), as described earlier in detail.12 The sequences were GAPDH: F: AAGCTGGTCATCAATGGGAAAC; GAPDH-R: ACCCCATTTGATGTTAGCGG;GAPDH-P: CATCACCATCTTCCAGGAGCGCGCGAT; and bFGF-F: GGAGTTGTGTCCATCAAGGGA; bFGF-R: AGCAGCCGTCCATCTTCCT; bFGF-P: TGTGTGCGAACCGGTACCTGGCT. Each sample was performed in duplicate. For quantification, the target sequence was normalized in relation to the GAPDH gene.
ECE activity of total kidney and left ventricular extracts were measured as described earlier.13 The NEP assay was based on a method described by Carvahlo et al.14 The ACE assay is based on the method described by Carmel et al.15 Incubations were carried out in 96-well microplates in triplicate at 4 to 6 concentrations ranging from 100 µmol/L to 10 nmol/L. IC50 was calculated after logit/log transformation of the percentage inhibition data with a best-fit regression model. For both assays, the inhibitors were tested for their fluorescence or quenching properties and values were corrected accordingly. ECE inhibitors were measured in triplicate at 5 to 7 concentrations in the range of 10 µmol/L to 10 pmol/L IC50 values were calculated after logit/log transformation of the percent inhibition data with a best-fit regression model. All assays were calibrated with phosphoramidon as internal standard inhibitor. Under our assay conditions, the IC50 of phosphoramidon was 1.0±0.2 µmol/L (n=30). IC50 values of unknown compounds were accepted when the IC50 (x) measured for phosphoramidon in the assay was 0.8
x
1.2 µmol/L.
Data are presented as mean±SEM. Statistically significant differences in mean values were tested by ANOVA, blood pressure by repeated ANOVA, and the Scheffé test. Mortality rate was examined with by Kaplan-Meier analysis. A value of P<0.05 was considered statistically significant. The data were analyzed with Statview statistical software.
| Results |
|---|
|
|
|---|
|
Untreated dTGR showed a mortality rate >50% at the end of the study (Figure 1C). The remaining animals in each group were killed at week 7. By this time, only 2 of 10 (20%) ECE inhibitortreated dTGR had died (P<0.05). ECE inhibitor treatment did not lower blood pressure in dTGR (Figure 1D). RO0687629 treated and untreated dTGR were severely hypertensive. Systolic blood pressure of both groups was
100 mm Hg higher compared with nontransgenic controls, namely 205±6 versus 206±6 versus 110±3 mm Hg at week 7 for dTGR, ECE inhibitor, and SD, respectively.
Left ventricular ECE activity was significantly higher in untreated dTGR compared with both other groups (Figure 2A). RO0687629 treatment reduced ECE activity below nontransgenic SD levels as follows: 1445±126 versus 885±40 versus 1046±81 ng/g tissue per hour, for dTGR, dTGR+RO0687629, and SD, respectively. Cardiac function and structure were significantly improved by ECE inhibitor treatment. Left ventricular hypertrophy and diminished left ventricular cavity dimensions were observed in untreated dTGR by M-mode echocardiography measured at week 7 and markedly improved by RO0687629 (Figure 2B). Cavity diameter of untreated dTGR (3.1±0.1 mm) was significantly lower compared with ECE inhibitortreated dTGR (5.5±0.3 mm) and nontransgenic SD (5.8±0.1 mm) (Figure 2C, P<0.05). Left ventricular systolic filling volume was similar in RO0687629-treated dTGR and SD control rats, both significantly more compared with untreated dTGR. The data were 0.42±0.04 versus 0.43±0.03 versus 0.16±0.06 mL, P<0.05 for dTGR+RO0687629, SD and dTGR, respectively. Cardiac hypertrophy index (Figure 2D), expressed as heart weighttobody weight ratio, was 5.7±0.2 versus 4.8±0.2 versus 3.6±0.1 mg/g, P<0.01 for dTGR, dTGR+RO0687629, and SD, respectively. Body weights between untreated and ECE inhibitortreated dTGR were not different. However, SD rats were heavier than dTGR.
|
ECE inhibitor treatment reduced extracellular matrix production. Collagen I (Figure 3A) and fibronectin (Figure 3B) were most prominently deposited around blood vessels, in the vascular adventitia, and focally around fibrotic areas of scarring. Collagen I (grade 3+ for RO0687629 treated dTGR versus 5+ for vehicle-treated dTGR versus 1+ for SD rats) and fibronectin staining in RO0687629-treated dTGR were reduced toward SD level (grade 2+ for RO0687629 treated dTGR versus 5+ for vehicle-treated dTGR versus 1+ for SD rats). Figure 3C shows a representative section of a dTGR heart with increased tissue factor (TF) expression in the vessel wall and adventitia as well as infiltrated cells. TF expression was markedly reduced by ECE inhibitor treatment (grade 2+ for RO0687629 treated dTGR versus 5+ for vehicle-treated dTGR versus 1+ for SD rats).
|
Basic FGF plays an important role in cardiac damage. Immunohistochemistry for bFGF shows immunostaining in the endothelium and media of arterial blood vessels as well as perivascular infiltrated cells and infiltration between the cardiomyocytes (grade 1+ for RO0687629 treated dTGR versus 5+ for vehicle-treated dTGR versus 1+ for SD rats; Figure 4). We also analyzed basic FGF mRNA expression in the left ventricle. The bFGF expression was significantly increased in vehicle-treated dTGR compared with SD rats. ECE inhibitor almost normalized bFGF mRNA (Figure 4).
|
Surprisingly, long-term ECE inhibitor treatment did not ameliorate kidney damage. Albuminuria occurred in ECE inhibitortreated dTGR to a degree no different than in untreated dTGR (Figure 5A). Furthermore, plasma creatinine and urea elevations as well as renal fibronectin staining in untreated and ECE inhibitortreated dTGR were not different. Instead, these parameters were significantly increased compared with SD (data not shown). In contrast to ECE activity in the heart, long-term ECE inhibitor treatment did not reduce ECE activity in the kidney. The results were 5665±1167 versus 5486±2006 versus 709±554 ng/g tissue per hour for dTGR, dTGR+RO0687629, and SD, respectively. Untreated and RO0687629-treated dTGR both showed significantly increased ECE activity (Figure 5B). We considered the possibility that the dose we used was not sufficient to inhibit ECE in the kidney. Therefore, we measured both the prodrug RO0687629 and thiol RO0677447 in the kidney. We could not detect any acetylsulfanyl RO0687629, indicating that the prodrug was completely cleft to its metabolite RO0677447. We found 8-fold more thiol ECE inhibitor in the kidney compared with heart. The amounts present were >800-fold and >100-fold above the IC50, respectively.
|
| Discussion |
|---|
|
|
|---|
Much interest has been generated by the possibility that Ang II exerts its effects largely through endothelin. Serneri et al18 studied cardiac Ang II formation in the clinical course of heart failure and its relation with left ventricular function. They found that the clinical course of heart failure was associated with a progressive increase in cardiac Ang II formation. Failing myocytes were unable to synthesize IGF-I and ET-1 in response to Ang II stimulation. Nonfailing myocytes, on the other hand, synthesized both IGF-I and ET-1 in response to Ang II. Thus, the heart can apparently synthesize these components during volume or pressure overload, and their production is directly correlated with increased contractility. With advancing heart failure, these adaptations are no longer possible.
ET-mediated effects are not confined to Ang IIinduced models. Schiffrin19 has emphasized the important role of ET-1 in hypertension, particularly in desoxycorticosterone acetate (DOCA)-salt hypertension. Pollock et al20 studied the combined effects of AT1 and ETA receptor antagonists in DOCA-salt hypertensive rats. They found that both compounds together were required to effectively decrease blood pressure. However, they were unable to prevent renal fibrosis. This result is puzzling because NF-
B activation has also been found in the DOCA-salt rat. Beswick et al21 found that antioxidants attenuate systolic blood pressure, suppress renal NF-
B DNA-binding activity, and partly alleviate renal monocyte/macrophage infiltration in DOCA-salt hypertension. Furthermore, in the aldosterone-infused rat, Park and Schiffrin22 found that ETA receptor blockade prevented blood pressure elevation and vascular remodeling. Conceivably, the common ground may be the mineralocorticoid receptor that is involved in both Ang II and DOCA-mediated hypertensive models. In dTGR, the mineralocorticoid receptor plays a dominant signaling role in both heart and kidney. We showed earlier that spironolactone could inhibit NF-
B and AP-1 transcription factor activation in this model. We did not examine transcription factor activation in this study because the general anesthesia required for the echocardiographic measurements interferes with reliable determinations.
We believe that our findings have therapeutic implications. The role of endothelin antagonists in the prevention of end-organ damage has been recently reviewed.23,24 We showed earlier that renin-angiotensin system inhibition is highly effective in this model. Whether or not a combined Ang IIET inhibition would have particular utility is not known for certain. A representative study examining blockade of renin-angiotensin and endothelin systems in a model of progressive renal injury was conducted by Cao et al.25 They relied on the subtotal nephrectomy rat model. The animals were randomized to control, ACE inhibitor treatment, AT1 receptor blocker treatment, ETA receptor blocker treatment, or bosentan. Treatment with the AT1 receptor blocker or the ACE inhibitor was associated with an improved glomerular filtration rate and reductions in blood pressure, urinary protein excretion, glomerulosclerosis, and tubular injury in association with reduced gene expression of TGF-ß and matrix protein type IV collagen. No beneficial effects of either the ETA blocker or combined blockade with bosentan were noted. Furthermore, the addition of ETA blockade to AT1 receptor blockade did not confer any additional benefits. The authors suggest that the renin-angiotensin system but not the endothelin system is the major mediator of progressive renal injury after renal mass reduction. We were interested to observe that ECE inhibition was more effective in ameliorating cardiac compared with renal damage. Conceivably, Ang IIrelated ET-1mediated effects are more prominent in the heart. Cao et al25 focused on the kidney and did not report whether or not combined treatment had a positive effect on cardiac hypertrophy in their model.
Perspectives
ECE inhibition is feasible in an animal model and provides protection against Ang IIinduced cardiac damage. The recent clarification of ECE structure will facilitate the development of other novel ECE inhibitors. These compounds may add an additional dimension to cardiovascular treatment. They may be particularly useful as an adjunct to other therapies.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received August 6, 2002; first decision August 27, 2002; accepted September 16, 2002.
| References |
|---|
|
|
|---|
2. Mervaala E, Muller DN, Schmidt F, Park JK, Gross V, Bader M, Breu V, Ganten D, Haller H, Luft FC. Blood pressure-independent effects in rats with human renin and angiotensinogen genes. Hypertension. 2000; 35: 587594.
3. Muller DN, Mervaala EM, Schmidt F, Park JK, Dechend R, Genersch E, Breu V, Loffler BM, Ganten D, Schneider W, Haller H, Luft FC. Effect of bosentan on NF-kappaB, inflammation, and tissue factor in angiotensin II-induced end-organ damage. Hypertension. 2000; 36: 282290.
4. Bohlender J, Gerbaulet S, Kramer J, Gross M, Kirchengast M, Dietz R. Synergistic effects of AT(1) and ET(A) receptor blockade in a transgenic, angiotensin II-dependent, rat model. Hypertension. 2000; 35: 992997.
5. Kedzierski RM, Yanagisawa M. Endothelin system: the double-edged sword in health and disease. Annu Rev Pharmacol Toxicol. 2001; 41: 851876.[CrossRef][Medline] [Order article via Infotrieve]
6. Bur D, Dale GE, Oefner C. A three-dimensional model of endothelin-converting enzyme (ECE) based on the X-ray structure of neutral endopeptidase 24.11 (NEP). Protein Eng. 2001; 14: 337341.
7. Nambi P, Clozel M, Feuerstein G. Endothelin and heart failure. Heart Fail Rev. 2001; 6: 335340.[CrossRef][Medline] [Order article via Infotrieve]
8. Aebi J, Bur D, Chucholowski A, Dehmlow H, Kitas EA, Obst U, Wessel HP. Preparation of pyrrolidinethiols and analogs as metalloprotease inhibitors. PCT Int Appl. 2002; 160: WO0208185A1.
9. Muller DN, Mervaala EM, Dechend R, Fiebeler A, Park JK, Schmidt F, Theuer J, Breu V, Mackman N, Luther T, Schneider W, Gulba D, Ganten D, Haller H, Luft FC. Angiotensin II (AT[1]) receptor blockade reduces vascular tissue factor in angiotensin II-induced cardiac vasculopathy. Am J Pathol. 2000; 157: 111122.
10. Muller DN, Heissmeyer V, Dechend R, Hampich F, Park JK, Fiebeler A, Shagdarsuren E, Theuer J, Elger M, Pilz B, Breu V, Schroer K, Ganten D, Dietz R, Haller H, Scheidereit C, Luft FC. Aspirin inhibits NF-kappaB and protects from angiotensin II-induced organ damage. FASEB J. 2001; 15: 18221824.
11. Dechend R, Fiebeler A, Park JK, Muller DN, Theuer J, Mervaala E, Bieringer M, Gulba D, Dietz R, Luft FC, Haller H. Amelioration of angiotensin IIinduced cardiac injury by a 3-hydroxy-3-methylglutaryl coenzyme a reductase inhibitor. Circulation. 2001; 104: 576581.
12. Fiebeler A, Schmidt F, Muller DN, Park JK, Dechend R, Bieringer M, Shagdarsuren E, Breu V, Haller H, Luft FC. Mineralocorticoid receptor affects AP-1 and nuclear factor-kappa-B activation in angiotensin II-induced cardiac injury. Hypertension. 2001; 37: 787793.
13. Schweizer A, Valdenaire O, Nelbock P, Deuschle U, Dumas Milne Edwards JB, Stumpf JG, Loffler BM. Human endothelin-converting enzyme (ECE-1): three isoforms with distinct subcellular localizations. Biochem J. 1997; 328: 871877.[Medline] [Order article via Infotrieve]
14. Carvahlo KM, Boileau G, Cannargo ACM, Juliano L. A highly selective assay for neutral endopeptidase based on the cleavage of a fluorogenic substrate related to leu-enkephalin. Anal Biochem. 1998; 237: 167173.
15. Carmel A, Ehrlich-Rogozinsky S, Yaron A. A fluorimetric assay for angiotensin-I converting enzyme in human serum. Clin Chim Acta. 1979; 93: 215220.[CrossRef][Medline] [Order article via Infotrieve]
16. Mervaala EMA, Cheng ZJ, Tikkanen I, Lapatto R, Nurminen K, Vapaatalo Muller DN, Fiebeler A, Ganten U, Ganten D, Luft FC. Endothelial dysfunction and xanthine oxidoreductase activity in rats with human renin and angiotensinogen genes. Hypertension. 2001; 37: 414418.
17. Muller DN, Dechend R, Mervaala EMA, Schmidt F, Park J-K, Fiebeler A, Theuer J, Breu V, Ganten D, Haller H, Luft FC. Inhibition of NF-
B protects against end-organ damage in rats with human renin and angiotensinogen genes. Hypertension. 2000; 35: 193201.
18. Serneri GG, Boddi M, Cecioni I, Vanni S, Coppo M, Papa ML, Bandinelli B, Bertolozzi I, Polidori G, Toscano T, Maccherini M, Modesti PA. Cardiac angiotensin II formation in the clinical course of heart failure and its relationship with left ventricular function. Circ Res. 2001; 88: 961968.
19. Schiffrin EL. Role of endothelin-1 in hypertension and vascular disease. Am J Hypertens. 2001; 14: 83S89S.[CrossRef][Medline] [Order article via Infotrieve]
20. Pollock DM, Derebail VK, Yamamoto T, Pollock JS. Combined effects of AT(1) and ET(A) receptor antagonists, candesartan, and A-127722 in DOCA-salt hypertensive rats. Gen Pharmacol. 2000; 34: 337342.[CrossRef][Medline] [Order article via Infotrieve]
21. Beswick RA, Zhang H, Marable D, Catravas JD, Hill WD, Webb RC. Long-term antioxidant administration attenuates mineralocorticoid hypertension and renal inflammatory response. Hypertension. 2001; 37: 781786.
22. Park JB, Schiffrin EL. Et(a) receptor antagonist prevents blood pressure elevation and vascular remodeling in aldosterone-infused rats. Hypertension. 2001; 37: 14441449.
23. Benigni A, Perico N, Remuzzi G. Endothelin antagonists and renal protection. J Cardiovasc Pharmacol. 2000; 35 (suppl 2): S75S78.[Medline] [Order article via Infotrieve]
24. Spieker LE, Noll G, Ruschitzka FT, Lüscher TF. Endothelin receptor antagonists in congestive heart failure: a new therapeutic principle for the future? J Am Coll Cardiol. 2001; 37: 14931505.
25. Cao Z, Cooper ME, Wu LL, Cox AJ, Jandeleit-Dahm K, Kelly DJ, Gilbert RE. Blockade of the renin-angiotensin and endothelin systems on progressive renal injury. Hypertension. 2000; 36: 561568.
This article has been cited by other articles:
![]() |
Y. Ikeda, K.-i. Aihara, T. Sato, M. Akaike, M. Yoshizumi, Y. Suzaki, Y. Izawa, M. Fujimura, S. Hashizume, M. Kato, et al. Androgen Receptor Gene Knockout Male Mice Exhibit Impaired Cardiac Growth and Exacerbation of Angiotensin II-induced Cardiac Fibrosis J. Biol. Chem., August 19, 2005; 280(33): 29661 - 29666. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Pollock Endothelin, Angiotensin, and Oxidative Stress in Hypertension Hypertension, April 1, 2005; 45(4): 477 - 480. [Full Text] [PDF] |
||||
![]() |
N. G Perez, M. C Villa-Abrille, E. A Aiello, R. A Dulce, H. E Cingolani, and M. C Camilion de Hurtado A low dose of angiotensin II increases inotropism through activation of reverse Na+/Ca2+ exchange by endothelin release Cardiovasc Res, December 1, 2003; 60(3): 589 - 597. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chen, Z. A. Khan, M. Cukiernik, and S. Chakrabarti Differential activation of NF-kappa B and AP-1 in increased fibronectin synthesis in target organs of diabetic complications Am J Physiol Endocrinol Metab, June 1, 2003; 284(6): E1089 - E1097. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Hypertension Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2002 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |