| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Hypertension. 2003;41:414.)
© 2003 American Heart Association, Inc.
Scientific Contributions |
From INSERM U586, Faculté de Médecine, Laboratoire de Pharmacologie Médicale et Clinique, Toulouse Cedex, France.
Correspondence to Philippe Rouet, INSERM U586, Faculté de Médecine, Laboratoire de Pharmacologie Médicale et Clinique, 37 Allées Jules Guesde. 31073 Toulouse Cedex. France. E-mail Philippe.rouet{at}toulouse.inserm.fr
| Abstract |
|---|
|
|
|---|
Key Words: obesity hypertension, arterial heart rate heart dogs
| Introduction |
|---|
|
|
|---|
Currently, very little is known about early cardiac molecular mechanisms induced by obesity-related hypertension, especially shortly after weight gain acquisition and before major structural changes in the heart have occurred. Therefore, we investigated, at the transcriptome level, the early changes in cardiac gene expression in the dog model of obesity-related hypertension before observable LVH. We prepared dog heart cDNA libraries and used subtractive hybridization to generate sublibraries and microarrays containing differentially expressed cDNAs2022 and compared the patterns of regulation in the right atrium and the left ventricle.
| Methods |
|---|
|
|
|---|
After 9 weeks of HFD, cardiac echocardiography was performed as previously described11 to detect LVH or cardiac failure. Telesystolic and telediastolic diameters and wall thickness of left ventricle were measured from time-movement recordings by Devereuxs method.23 Telesystolic and telediastolic volumes (cm3) of the left ventricle were calculated according to Cubes method. Left ventricular mass (g) was evaluated by Devereuxs formula.23 Septum and posterior wall thickness ratio were calculated as an index of ventricular asymmetry. Left ventricular function was evaluated by means of left ventricular ejection fraction (%), defined as the ratio between the difference of telediastolic and telesystolic volumes and telediastolic volume.
At the end of the experiment, animals were anesthetized, and surgery was quickly performed. Right atrium and left ventricle tissue samples were frozen in liquid nitrogen and maintained at -80°C until RNA preparation.
All animal procedures were performed according to the guidelines of the French Ministry of Agriculture.
Blood Pressure and Heart Rate Measurement
A receiver unit (RL 200) was used to monitor and amplify signal from each implantable transmitter and to convert it into a series of digital pulses to be decoded and evaluated by computer.24 Systolic and diastolic BP and HR were obtained from the femoral artery pressure waveform. BP and HR signal were digitalized at 500 Hz. Systolic and diastolic BP were computed for each cycle and extracted at 2 Hz, then stored in a compatible IBM-PC for analysis. BP and HR measurements were performed between 9 and 10 AM on quiet, unrestrained animals in their individual cages.
RNA Extraction and Generation of Differentially Expressed cDNA
RNA was extracted by disrupting tissues in Trizol reagent (Invitrogen) and prepared according to recommended procedures (Clontech). We used 500 ng of total RNA to produce cDNA that was polymerase chain reaction (PCR)-amplified with a SMART PCR cDNA synthesis kit (Clontech). Amplification linearity was checked by fluorescent monitoring of the PCR products using PicoGreen (Molecular Probes) and a plate fluorometer (Fluoroscan, Labsystems). To generate enriched cDNA libraries for differentially expressed genes, the PCR-select cDNA subtraction kit reagents and protocol (Clontech) were used. Two separate subtractions, obese-control to enrich for genes upregulated in obese, and the reciprocal control-obese to enrich for genes upregulated in control (ie, downregulated in obese), were performed as follows: In a first subtraction, cDNAs from obese dogs were used as "tester" and control cDNA as "driver" to generate a library containing upregulated genes in the obese phenotype. In the reciprocal reaction, we used cDNA from obese dogs as "driver" for subtraction, enriched the resulting library in downregulated genes. Subtraction reaction efficiency was checked by agarose gel electrophoresis. Subtracted products were ligated to pGEM-T vector DNA (Promega) and electroporated in DH5-
Electromax-competent cells (Invitrogen). This established a library of potentially upregulated and downregulated cDNAs. The complexity of these libraries was determined to be
1000, so
1200 cDNA of each library were PCR-amplified from bacterial clones and spotted in duplicates onto nylon membranes at Toulouse Genomic Core Facilities with a BioRobotics apparatus.
DNA Array Hybridization and Expression Analysis
Labeling with
-[32P]-dATP (NEN) of unsubtracted cDNA from obese hypertensive or control dogs, hybridization to the membranes, and washes were performed as described in the PCR-select differential screening kit manual (Clontech). Membranes were exposed for
1 to 3 hours in a cassette and revealed with a Storm 860 PhosphorImager (Molecular Dynamics). Signal intensity was analyzed with X-dot reader software (COSE) and normalized to the mean intensity from all the measured values. Since cDNA subtraction generally enriches up to
9% of differential expressed cDNA in the library,25 and that subtraction was done to enrich in upregulated and reciprocally to enrich in downregulated sequences, differentially expressed cDNA will not affect dramatically the overall signal of a membrane. Considering the large number of clones screened and that the percentage of differentially expressed genes was expected to be <10%, global normalization has been considered as appropriate26,27 and preferred to normalization with housekeeping genes, which is sometimes used successfully with lower numbers of clones.28 In addition, because housekeeping gene expression can also vary significantly,29 the use of housekeeping genes to normalize expression data could have led to erroneous conclusions.30 Results are shown as ratio of obese/control of the mean from 10 normalized measurements. Expression was considered as induced (ratio>1.2;
) and repressed (ratio<0.8;
).
DNA Sequencing and Sequence Analysis
PCR products (200 to 1500 bp) were directly sequenced according to the Applied Biosystems AmpliTaq FS dye terminator kit and loaded on an ABI 373 automated sequencer that provided an average of
400 bases of good quality sequence. Sequence homologies were searched with an on-line BLAST server (NCBI) set with default parameters. Gene identity was given if BLAST probability values were <10-30. The probability value is the smallest sum probability that by chance one would observe a matched score as high as the observed high score when searching the database with a random sequence of the same size as the query sequence. This value allowed identification sequences of at least 83% homology to known human or rodent sequences.
Verification of mRNA Levels by Northern Blot Analysis
Twenty micrograms of total RNA was loaded per lane, and Northern blot analysis was performed with the use of standard procedures. PCR products from differentially expressed genes were used as probes and labeled with
-[32P]-dATP according to the NEB blot kit manual (New England Biolabs). Quickhyb solution (Stratagene) was used for overnight hybridization, and washes were done as recommended. Membranes were exposed 6 to 24 hours in a PhosphorImager cassette, and exposure was analyzed in a SI445 PhosphorImager (Molecular Dynamics). Band intensity was determined with the use of ImageQuant software (Molecular Dynamics).
Real-Time Quantitative PCR
Primers were designed with the use of Primer Express 2.0 software (Applied Biosystems). Oligos sequences were as follows: Cytochrome oxidase subunit 1: AGGAATAGATGTAGACACAC-GAGCAT and CTCCCGTTGGAATAGCGATAAT; Matrix metalloproteinase-9: CCCTTGAACACGCATGACAT and AAGCGGTCCTGGCAGAAGTA: Lectomedin-3: ATTGCCAGCGGCGAATAC and GGGCGGTCTCGTTATGGTTA; NRF2: GCAGGGTGATTTTCTTCCTTATGA and CTGTGGACCGTGTGTTGACAA; ß-actin: GACCCAGATCATGTTCGAGACTT and AGCCTGGATGGCCACGTA; ANP: TGGACCATTTGGAAGAAAAGATG and CGGCTCACTGAGCACT-TGTG; tensin: GGTATCTGCCGTCAGGTCATC and CAGCTTGGCCTGGCATTT; VDAC 2: ATTTGGTTTTGGGTTGGTGAAA and TTAGATGAACCGGACGTTGAAA; ALS 2: TTCCACAAAAACAAAGGGTGAA and TCTACACTCTATTGACCTCAGCACAA; NADH dehydrogenase: GTGAAGTCCCCTCCCAATACC and GCGAGGCTTGATATTGCTAGTATG; hsp70: TGGCACACTGGACCCTGTAG and CCCACCAAGACAATATCATGGA; SERCA2: TCGAACCTTCCCACAAGTCAA and TCACACCATCCCCAGTCATG; 18 S: CGCCGCTAGAGGTTGAAATTC and TCCGACTTTCGTTCTTGATTAATG.
One microgram of DNAse I-treated (DNAfree, Ambion) total RNA was retrotranscribed in the presence of random primers and Thermoscript enzyme (Invitrogen) according to the manufacturers protocol. Real-time PCR reactions were carried out with Sybergreen PCR Master Mix (Applied Biosystems) in a GenAmp 5700 apparatus (Applied Biosystems). The standard curve method was used for relative quantification of the PCR products, and gene expression was normalized to 18 S RNA quantification.
Statistical Analysis
All results are depicted as mean±SEM. Multiple comparisons (Table 1) were analyzed by ANOVA, followed, when appropriate, by the Dunnett post hoc test with Statview 4.5 software (Abacus Concepts). Single comparisons (Table 2 and echocardiographic parameters on Table 1) were performed by means of unpaired Student t test, with a value of P
0.05 considered significant. Preliminary microarray experiments independent from the present study but using the same methods allowed us to calculate that 8 hybridizations were necessary to reach enough statistical power to detect a significant variation of expression of at least 20% with a risk of error of 5%. Therefore, we performed 10 experimental hybridizations on our custom microarrays to ensure sufficient statistical power.
|
|
| Results |
|---|
|
|
|---|
Identification of Differentially Expressed Genes in Atrium
RNA from 6 atrial tissue samples from each group were pooled to provide average complex probes to screen our subtracted libraries. According to our statistical analysis and criteria, we found
200 genes that were differentially regulated with at least 20% of variation in expression in atria from obese dogs compared with control animals. BLAST homology searches of sequenced clones identified 32 single known genes with identifiable function and 13 new genes that were potentially altered in atria of obese compared with lean dogs (Table 2). A Student t test with microarray data revealed statistically relevant significance for differential expression of 29 known genes and 11 new genes. Four of these 40 genes (ß-actin, Myoferlin, ß-hemoglobin, and Tensin) were found to be not differentially expressed in Northern blot experiments. Lectomedin-3 and VDAC2, which were not found to be statistically differentially expressed by microarray analysis, were found to be differentially expressed by Northern blot analysis. Therefore a total of 38 genes can be considered as differentially expressed in atria.
To assemble a molecular physiological view of the adaptation processes, we organized genes into groups representing cellular functions (Table 2). These functions included extracellular matrix remodeling processes, cytoskeletal structure, nuclear and sarcolemma structure, energy metabolism, ionic flux, cell proliferation, stress response, signal transduction, hormones, and proteins associated with translation. We also found 11 new genes of unknown function that will require further investigation.
Northern analysis confirmed differential expression for 15 genes of 20 tested, and loading was controlled for by means of 18 S rRNA hybridization. A difference of expression of at least 20% was detectable in the 15 genes from atria of dogs subjected to HFD (Table 2). Two genes, sarcoplasmic reticulum Ca2+ ATPase (SERCA2) and ß-hemoglobin, which were found to be downregulated in the microarrays, were found to be upregulated by Northern blot analysis in 2 separate trials (Table 2 and data not shown).
Quantitative PCR performed on cDNA obtained from each animal confirmed expression of 12 genes of 15 randomly chosen in the known gene list (Table 2). Expression of 3 genes (Tensin, ALS 2, and NRF2) displayed high variability, and differential expression was not statistically relevant. Interestingly, real-time PCR confirmed downregulation of SERCA-2.
Identification of Differentially Expressed Genes in Ventricle
Differentially expressed genes identified in the atrium were also tested in left ventricle samples by the use of our cDNA microarrays. This experiment revealed differential expression for 14 genes of 38. Of the 24 genes that showed no differential expression in ventricles of obese compared with lean dogs, 6 genes were randomly selected for Northern blot analysis. Results obtained with microarrays were confirmed by Northern blot for 6 of 6 genes (Table 2).
| Discussion |
|---|
|
|
|---|
Previous studies have provided considerable evidence that in dogs, HFD closely mimics cardiovascular and metabolic changes observed in obese humans.31 Although this model has provided important information about some of the physiological events that underlie the mechanisms of arterial hypertension and of other cardiovascular adaptations to obesity, a molecular understanding of these processes has been limited by the lack of tools for functional genomic studies in dogs. To our knowledge, there have been no previous reports of cardiac gene expression profiling in obese dogs. This contrasts to the large amount of data available concerning gene regulation in other experimental models of ventricular overload or of cardiac failure in rodents. Therefore, we prepared our own dog cDNA arrays with a focus on differentially expressed genes using a subtractive-hybridization approach (SSH).20 The use of cDNA microarrays to further screen such libraries has been shown to be efficient,32 and these new tools will be of great importance in future studies. SSH cannot be considered as exhaustive but enriches rare, differentially expressed transcripts by >1000-fold.20 One major advantage of the combined approach of SSH and cDNA microarrays is the identification of differentially expressed genes without the availability of already-cloned dog cDNA. The use of custom-made cDNA arrays allowed us to perform enough hybridizations to gain accuracy for monitoring gene expression and to assess variations as small as 20% in transcript level. This low threshold for detection of changes in gene expression, which required a high degree of repeatability in 10 microarray hybridizations, for each experiment, is important because many physiological variables change by 20% or less in the early phases of obesity and structural changes in the heart and blood vessels are modest.33 Therefore, one might also expect modest changes in expression of many genes involved in the early stages of cardiovascular adaptation to an HFD, thus requiring sensitive and repeatable methods of detection. Using 10 microarray hybridizations that were highly repeatable for each experiment, we found 38 genes that were upregulated or downregulated in atria from dogs made obese and hypertensive by HFD. Confirmation was obtained in almost half of them with Northern analyses (15 successful confirmations out of 20 Northern blots) and with a high success rate by quantitative PCR (12 confirmations out of 15 randomly chosen genes), thus indicating, as previously reported, that microarrays can be reliable indicators of altered gene expression. In addition, quantitative PCR evaluated individual variability as low for expression of 80% of the tested genes and further confirmed differential expression for 2 genes (VDAC and Lectomedin-3) that were not statistically differentially expressed with microarray analysis. Despite this measure of reliability, microarrays can also generate some artifacts, as shown in our comparison of expression profiles between microarrays and Northern blots for SERCA2 and ß-hemoglobin. Even taking into account limitations, our data globally show that in a dietary model of obesity produced by feeding dogs ad libitum an HFD, gene-regulated reprogramming occurs. The importance of these early mRNA level modifications for the pathophysiology of cardiovascular morbidity related to obesity-related hypertension remains to be elucidated. In the same way, the respective roles of increased fat mass and of hypertension in theses genic adaptations will need further studies, which could, for instance, investigate the pattern of gene expression in hearts from transgenic obese mice without arterial hypertension.
The qualitative aspects of our findings and their relevance for the pathophysiology of heart changes related to HFD deserves some comments in view of the differences observed between atrium and ventricle changes in pattern of gene expression. A first set of genes was found to exhibit similar regulation in both right atrium and left ventricle, suggesting that weight gain and arterial hypertension induced by HFD are associated with early and diffuse cardiac reprogramming. Among the genes that belong to this group, we found induction of MMP-9. Overexpression of MMP-9, a gelatinase B whose substrates include gelatin, collagen IV, V, and XIV, aggrecan, elastin, entactin, and vibronectin,34 as previously reported in LVH in humans.35 These genes could be involved in the pathophysiological mechanisms leading to the genesis and progression of heart failure. We also found upregulation, in both chambers, of mRNA levels encoding proteins of the mitochondria respiratory chain such as cytochrome C oxidase subunit I and VIIb, NADH dehydrogenase, and ATP synthase F0 subunit. These changes probably reflect increased energy and ATP consumption secondary to the increased venous return and cardiac preload as well as to arterial hypertension. Similar positive regulations of ATP synthesis have also been described in left ventricular mitochondria from spontaneously hypertensive rats.36,37 These findings showing that even if more marked in atrium, gene expression pattern changes also concern left ventricle, contrasts with the absence of major ventricular macroscopic alterations and of increased left ventricular mass measured with echocardiography after 9 weeks of an HFD. However, one can speculate that we detected initial molecular changes in the extracellular matrix that will participate in tissue remodeling that is usually seen after 20 weeks of an HFD.18
A second group of genes was differentially regulated in the atria from obese dogs but not in ventricle. This feature could be explained by the specific function and structure of the atria, which acts as a volume sensor38 that is prone to distension by volume overload, a key feature of obesity-related hypertension.17 Interestingly, mRNA from genes involved in cardiac excitation-contraction coupling such as phospholamban (PLB) and SERCA-2 were found to be differentially regulated in the atria from obese dogs. This regulation may contribute to the marked increase in heart rate and may be a consequence of decreased baroreflex efficiency observed in obese dogs.11 Thyroid hormones, which are also increased during caloric overfeeding,39 have also been shown to increase PLB mRNA levels.40 However, the relevance of these changes to explain changes in atrial gene expression in obesity-related hypertension remains to be elucidated. In obese dogs, we also observed a specific 9-fold reduction of N-acetyl galactosaminyl transferase mRNA levels in atrium by Northern blot analysis, whereas its expression was not significantly modified in left ventricle. This enzyme, which mediates acquisition of carbohydrate side-chains in O-glycosidic linkage to either threonine or serine, modifies the structure of polypeptide backbone and heavily O-glycosylated proteins involved in cell interactions such as mucin glycoproteins.41 In addition, O-glycans function as ligands for receptors mediating tumor cell adhesion.42 The levels of mRNA encoding lectomedin-3 were also found to be upregulated. This protein harbors a galactose binding domain and is a G-protein-coupled receptor that also regulates cell adhesion by means of an inside-out effector signaling pathway. Overexpression of this protein can promote adhesion to ligands present in the extracellular matrix or on opposing cells resulting in chemotaxis and extravasation.43 Such proteins have recently been identified and may be triggered by cell-cell or cell-matrix interactions that implicate them in planar polarization during organogenesis.43 The last gene from this group is atrial natriuretic peptide, whose induction has been considered an index for cardiac remodeling toward a fetal pattern.44
Reorganization of tissue structure is often concomitant with cell proliferation.45 We observed the expression of a set of genes that have not yet been studied in heart. First of all, nucleophosmin (NPM), which is known to accumulate in nuclei of exponential growing HeLa cells46 and is strongly upregulated during estrogen-induced cell proliferation in MCF-7 breast cancer cells,47 was upregulated in atria of obese dogs. NPM has several potentially important roles in regulating cell function and signaling. Specifically, NPM is a chaperone for nuclear import of proteins.48,49 This feature lends itself to chromatin dynamics50 and plays an important role in the regulation of cellular mitogenesis. In this same group of genes, we found upregulation of mRNA levels for ERK-3, a mitogen-activated protein kinase present in the nucleus.51 ERK3, also called p97, is activated by protein kinase C52 and is responsive to different growth factors, implying a mechanism for specificity in cellular signaling53 in response to activation of the p38 pathway.54 As expected in a situation of tissue growth, we observed upregulation of RNA levels encoding ribosomal proteins and elongation factor-1
, a protein involved in mRNA translation. Taken together, these changes in gene expression are in accordance with a situation of cell proliferation in response to extracellular stimuli associated with an HFD. These findings point toward several potential molecular pathways that may offer a better understanding of the mechanisms involved in atrial and ventricular adaptations to a long-term HFD.
We also found 11 cDNA sequences representative of mRNA coding for new proteins of unknown functions to be differentially expressed in atria and in ventricle after 9 weeks of an HFD. Analysis of the encoded proteins and their functions will be undertaken in future works.
Perspectives
Our work shows that HFD-induced obesity not only is associated with arterial hypertension and other important cardiovascular changes but also causes early profound and specific modifications of the cardiac transcriptome both at the atrium and at the ventricular level. However, because obesity is associated in our model with arterial hypertension, it is not possible to conclude that changes observed are specific to obesity-related hypertension. Further studies in experimental models of obesity without changes in blood pressure are therefore necessary.
Since we focused on modifications that occur early after the installation of obesity and hypertension, the observed changes constitute one basis for the study of the mechanisms linking the increase in fat mass and myocardium. In fact, the search for the potential mechanisms that initiate alterations in cardiac gene expression secondary to HFD represents an important area for further studies that could be fruitful for a better understanding of the pathophysiology of obesity-related cardiovascular morbidity.
| Acknowledgments |
|---|
Received September 25, 2002; first decision October 16, 2002; accepted January 10, 2003.
| References |
|---|
|
|
|---|
2. Bray GA. Health hazards of obesity. Endocrinol Metab Clin North Am. 1996; 25: 907919.[CrossRef][Medline] [Order article via Infotrieve]
3. Kannel WB. Fifty years of Framingham Study contributions to understanding hypertension. J Hum Hypertens. 2000; 14: 8390.[CrossRef][Medline] [Order article via Infotrieve]
4. Hall JE, Brands MW, Hildebrandt DA, Mizelle HL. Obesity-associated hypertension: hyperinsulinemia and renal mechanisms. Hypertension. 1992; 19 (suppl I): I-45I-55.[Medline] [Order article via Infotrieve]
5. Laakso M, Lehto S. Epidemiology of risk factors for cardiovascular disease in diabetes and impaired glucose tolerance. Atherosclerosis. 1998; 137: S65S73.[CrossRef][Medline] [Order article via Infotrieve]
6. Pelkonen R, Nikkila EA, Koskinen S, Penttinen K, Sarna S. Association of serum lipids and obesity with cardiovascular mortality. BMJ. 1977; 2: 11851187.
7. Ascaso JF, Sales J, Merchante A, Real J, Lorente R, Martinez-Valls J, Carmena R. Influence of obesity on plasma lipoproteins, glycaemia and insulinaemia in patients with familial combined hyperlipidaemia. Int J Obes Relat Metab Disord. 1997; 21: 360366.[CrossRef][Medline] [Order article via Infotrieve]
8. Nicholas SB. Lipid disorders in obesity. Curr Hypertens Rep. 1999; 1: 131136.[Medline] [Order article via Infotrieve]
9. Hall JE, Hildebrandt DA, Kuo J. Obesity hypertension: role of leptin and sympathetic nervous system. Annu Rev Nutr. 2001; 21: 121.[CrossRef][Medline] [Order article via Infotrieve]
10. Redon J. Hypertension in obesity. Nutr Metab Cardiovasc Dis. 2001; 11: 344353.[Medline] [Order article via Infotrieve]
11. Verwaerde P, Senard JM, Galinier M, Rouge P, Massabuau P, Galitzky J, Berlan M, Lafontan M, Montastruc JL. Changes in short-term variability of blood pressure and heart rate during the development of obesity-associated hypertension in high-fat fed dogs. J Hypertens. 1999; 17: 11351143.[CrossRef][Medline] [Order article via Infotrieve]
12. Kikuya M, Hozawa A, Ohokubo T, Tsuji I, Michimata M, Matsubara M, Ota M, Nagai K, Araki T, Satoh H, Ito S, Hisamichi S, Imai Y. Prognostic significance of blood pressure and heart rate variabilities: the Ohasama study. Hypertension. 2000; 36: 901906.
13. Carney RM, Blumenthal JA, Stein PK, Watkins L, Catellier D, Berkman LF, Czajkowski SM, OConnor C, Stone PH, Freedland KE. Depression, heart rate variability, and acute myocardial infarction. Circulation. 2001; 104: 20242028.
14. Alpert MA, Hashimi MW. Obesity and the heart. Am J Med Sci. 1993; 306: 117123.[Medline] [Order article via Infotrieve]
15. Kenchaiah S, Evans JC, Levy D, Wilson PW, Benjamin EJ, Larson MG, Kannel WB, Vasan RS. Obesity and the risk of heart failure. N Engl J Med. 2002; 347: 305313.
16. Rocchini AP, Moorehead C, Wentz E, Deremer S. Obesity-induced hypertension in the dog. Hypertension. 1987; 9 (suppl III): III-64III-68.[Medline] [Order article via Infotrieve]
17. Hall JE, Brands MW, Dixon WN, Smith MJ Jr. Obesity-induced hypertension: renal function and systemic hemodynamics. Hypertension. 1993; 22: 292299.
18. Massabuau P, Verwaerde P, Galinier M, Fourcade J, Rouge P, Galitzky J, Senard JM, Berlan M, Bounhoure JP, Montastruc JL. Left ventricular repercussion of obesity-induced arterial hypertension in the dog. Arch Mal Coeur Vaiss. 1997; 90: 10331035.[Medline] [Order article via Infotrieve]
19. Pelat M, Verwaerde P, Merial C, Galitzky J, Berlan M, Montastruc JL, Senard JM. Impaired atrial M(2)-cholinoceptor function in obesity-related hypertension. Hypertension. 1999; 34: 10661072.
20. Diatchenko L, Lau YF, Campbell AP, Chenchik A, Moqadam F, Huang B, Lukyanov S, Lukyanov K, Gurskaya N, Sverdlov ED, Siebert PD. Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc Natl Acad Sci U S A. 1996; 93: 60256030.
21. Duggan DJ, Bittner M, Chen Y, Meltzer P, Trent JM. Expression profiling using cDNA microarrays. Nat Genet. 1999; 21: 1014.[CrossRef][Medline] [Order article via Infotrieve]
22. Brown PO, Botstein D. Exploring the new world of the genome with DNA microarrays. Nature Genetics. 1999; 21: 3337.[CrossRef][Medline] [Order article via Infotrieve]
23. Devereux RB, Reichek N. Echocardiographic determination of left ventricular mass in man: anatomic validation of the method. Circulation. 1977; 55: 613618.
24. Gelzer AR, Ball HA. Validation of a telemetry system for measurement of blood pressure, electrocardiogram and locomotor activity in beagle dogs. Clin Exp Hypertens. 1997; 19: 11351160.[Medline] [Order article via Infotrieve]
25. Rebrikov DV, Britanova OV, Gurskaya NG, Lukyanov KA, Tarabykin VS, Lukyanov SA. Mirror orientation selection (MOS): a method for eliminating false positive clones from libraries generated by suppression subtractive hybridization. Nucleic Acids Res. 2000; 28: E90.[CrossRef][Medline] [Order article via Infotrieve]
26. Marton MJ, DeRisi JL, Bennett HA, Iyer VR, Meyer MR, Roberts CJ, Stoughton R, Burchard J, Slade D, Dai H, Bassett DE Jr, Hartwell LH, Brown PO, Friend SH. Drug target validation and identification of secondary drug target effects using DNA microarrays. Nat Med. 1998; 4: 12931301.[CrossRef][Medline] [Order article via Infotrieve]
27. Sehl PD, Tai JT, Hillan KJ, Brown LA, Goddard A, Yang R, Jin H, Lowe DG. Application of cDNA microarrays in determining molecular phenotype in cardiac growth, development, and response to injury. Circulation. 2000; 101: 19901999.
28. Camerer E, Gjernes E, Wiiger M, Pringle S, Prydz H. Binding of factor VIIa to tissue factor on keratinocytes induces gene expression. J Biol Chem. 2000; 275: 65806585.
29. Welsh JB, Sapinoso LM, Su AI, Kern SG, Wang-Rodriguez J, Moskaluk CA, Frierson HF Jr, Hampton GM. Analysis of gene expression identifies candidate markers and pharmacological targets in prostate cancer. Cancer Res. 2001; 61: 59745978.
30. Yu Z, Ford BN, Glickman BW. Identification of genes responsive to BPDE treatment in HeLa cells using cDNA expression assays. Environ Mol Mutagen. 2000; 36: 201205.[CrossRef][Medline] [Order article via Infotrieve]
31. Brands MW, Hall JE, Van Vliet BN, Alonso-Galicia M, Herrera GA, Zappe D. Obesity and hypertension: roles of hyperinsulinemia, sympathetic nervous system and intrarenal mechanisms. J Nutr. 1995; 125: 1725S-1731S.
32. Yang GP, Ross DT, Kuang WW, Brown PO, Weigel RJ. Combining SSH and cDNA microarrays for rapid identification of differentially expressed genes. Nucleic Acids Res. 1999; 27: 15171523.
33. Yang J, Moravec CS, Sussman MA, DiPaola NR, Fu D, Hawthorn L, Mitchell CA, Young JB, Francis GS, McCarthy PM, Bond M. Decreased SLIM1 expression and increased gelsolin expression in failing human hearts measured by high-density oligonucleotide arrays. Circulation. 2000; 102: 30463052.
34. Creemers EE, Cleutjens JP, Smits JF, Daemen MJ. Matrix metalloproteinase inhibition after myocardial infarction: a new approach to prevent heart failure? Circ Res. 2001; 89: 201210.
35. Hwang DM, Dempsey AA, Lee CY, Liew CC. Identification of differentially expressed genes in cardiac hypertrophy by analysis of expressed sequence tags. Genomics. 2000; 66: 114.[CrossRef][Medline] [Order article via Infotrieve]
36. Seccia TM, Atlante A, Vulpis V, Marra E, Passarella S, Pirrelli A. Mitochondrial energy metabolism in the left ventricular tissue of spontaneously hypertensive rats: abnormalities in both adeninenucleotide and phosphate translocators and enzyme adenylate-kinase and creatine-phosphokinase activities. Clin Exp Hypertens (New York). 1998; 20: 345358.[CrossRef][Medline] [Order article via Infotrieve]
37. Atlante A, Seccia TM, Pierro P, Vulpis V, Marra E, Pirrelli A, Passarella S. ATP synthesis and export in heart left ventricle mitochondria from spontaneously hypertensive rat. Int J Mol Med. 1998; 1: 709716.[Medline] [Order article via Infotrieve]
38. Opie LH. The Heart, Physiology From Cell to Regulation. 3rd ed. Baltimore, Md: Lippincott Williams & Wilkins; 1998: 377378.
39. Roti E, Minelli R, Salvi M. Thyroid hormone metabolism in obesity. Int J Obes Rel Metab Disord. 2000; 24 (suppl 2): S113S115.[CrossRef]
40. Nagai R, Zarain-Herzberg A, Brandl CJ, Fujii J, Tada M, MacLennan DH, Alpert NR, Periasamy M. Regulation of myocardial Ca2+-ATPase and phospholamban mRNA expression in response to pressure overload and thyroid hormone. Proc Natl Acad Sci U A. 1989; 86: 29662970.
41. Tabak LA. In defense of the oral cavity: structure, biosynthesis, and function of salivary mucins. Annu Rev Physiol. 1995; 57: 547564.[CrossRef][Medline] [Order article via Infotrieve]
42. Sawada T, Ho JJ, Chung YS, Sowa M, Kim YS. E-selectin binding by pancreatic tumor cells is inhibited by cancer sera. Int J Cancer. 1994; 57: 901907.[Medline] [Order article via Infotrieve]
43. Hayflick JS. A family of heptahelical receptors with adhesion-like domains: a marriage between two super families. J Recept Signal Transduct Res. 2000; 20: 119131.[Medline] [Order article via Infotrieve]
44. Mercadier JJ, Lompre AM, Duc P, Boheler KR, Fraysse JB, Wisnewsky C, Allen PD, Komajda M, Schwartz K. Altered sarcoplasmic reticulum Ca2(+)-ATPase gene expression in the human ventricle during end-stage heart failure. J Clin Invest. 1990; 85: 305309.[Medline] [Order article via Infotrieve]
45. Anversa P, Capasso JM, Olivetti G, Sonnenblick EH. Cellular basis of ventricular remodeling in hypertensive cardiomyopathy. Am J Hypertens. 1992; 5: 758770.[Medline] [Order article via Infotrieve]
46. Yung BY, Bor AM, Yang YH. Immunolocalization of phosphoprotein B23 in proliferating and non-proliferating HeLa cells. Int J Cancer. 1990; 46: 272275.[Medline] [Order article via Infotrieve]
47. Skaar TC, Prasad SC, Sharareh S, Lippman ME, Brunner N, Clarke R. Two-dimensional gel electrophoresis analyses identify nucleophosmin as an estrogen regulated protein associated with acquired estrogen-independence in human breast cancer cells. J Steroid Biochem Mol Biol. 1998; 67: 391402.[CrossRef][Medline] [Order article via Infotrieve]
48. Dingwall C, Laskey RA. Nucleoplasmin: the archetypal molecular chaperone. Semin Cell Biol. 1990; 1: 1117.[Medline] [Order article via Infotrieve]
49. Szebeni A, Olson MO. Nucleolar protein B23 has molecular chaperone activities. Protein Sci. 1999; 8: 905912.[Medline] [Order article via Infotrieve]
50. Laskey RA, Mills AD, Philpott A, Leno GH, Dilworth SM, Dingwall C. The role of nucleoplasmin in chromatin assembly and disassembly. Philos Trans R Soc Lond B Biol Sci. 1993; 339: 263269.[CrossRef][Medline] [Order article via Infotrieve]
51. Cheng M, Zhen E, Robinson MJ, Ebert D, Goldsmith E, Cobb MH. Characterization of a protein kinase that phosphorylates serine 189 of the mitogen-activated protein kinase homolog ERK3. J Biol Chem. 1996; 271: 1205712062.
52. Sauma S, Friedman E. Increased expression of protein kinase C beta activates ERK3. J Biol Chem. 1996; 271: 1142211426.
53. Janulis M, Trakul N, Greene G, Schaefer EM, Lee JD, Rosner MR. A novel mitogen-activated protein kinase is responsive to Raf and mediates growth factor specificity. Mol Cell Biol. 2001; 21: 22352247.
54. Zimmermann J, Lamerant N, Grossenbacher R, Furst P. Proteasome- and p38-dependent regulation of ERK3 expression. J Biol Chem. 2001; 276: 1075910766.
This article has been cited by other articles:
![]() |
S. Kenchaiah, H. D. Sesso, and J. M. Gaziano Body Mass Index and Vigorous Physical Activity and the Risk of Heart Failure Among Men Circulation, January 6, 2009; 119(1): 44 - 52. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lamant, F. Smih, R. Harmancey, P. Philip-Couderc, A. Pathak, J. Roncalli, M. Galinier, X. Collet, P. Massabuau, J.-M. Senard, et al. ApoO, a Novel Apolipoprotein, Is an Original Glycoprotein Up-regulated by Diabetes in Human Heart J. Biol. Chem., November 24, 2006; 281(47): 36289 - 36302. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hlaing, P. Spitz, K. Padmanabhan, B. Cabezas, C. S. Barker, and H. S. Bernstein E2F-1 Regulates the Expression of a Subset of Target Genes during Skeletal Myoblast Hypertrophy J. Biol. Chem., October 15, 2004; 279(42): 43625 - 43633. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Philip-Couderc, F. Smih, J. E. Hall, A. Pathak, J. Roncalli, R. Harmancey, P. Massabuau, M. Galinier, P. Verwaerde, J.-M. Senard, et al. Kinetic analysis of cardiac transcriptome regulation during chronic high-fat diet in dogs Physiol Genomics, September 16, 2004; 19(1): 32 - 40. [Abstract] [Full Text] [PDF] |
||||
![]() |
R S Vasan Cardiac function and obesity Heart, October 1, 2003; 89(10): 1127 - 1129. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Hypertension Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2003 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |