Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 2003;41:874-878
Published online before print March 17, 2003, doi: 10.1161/01.HYP.0000063885.48344.EA
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
41/4/874    most recent
01.HYP.0000063885.48344.EAv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Farjah, M.
Right arrow Articles by Danziger, R. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Farjah, M.
Right arrow Articles by Danziger, R. S.

(Hypertension. 2003;41:874.)
© 2003 American Heart Association, Inc.


Rapid Communication

Dietary Salt Regulates Renal SGK1 Abundance

Relevance to Salt Sensitivity in the Dahl Rat

Mariam Farjah; Bryan P. Roxas; David L. Geenen; Robert S. Danziger

From the Section of Cardiology, Department of Medicine, University of Illinois at Chicago (M.F., B.P.R., D.L.G., R.S.D.), Chicago, Ill; and West Side Division Veterans Administration Chicago Health Care System (M.F., B.P.R., R.S.D.), Chicago, Ill.

Correspondence to Robert S. Danziger, MD, Department of Medicine, University of Illinois at Chicago, 840 S Wood St, Chicago, IL 60612. E-mail Rdanziger{at}aol.com


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Serum and glucocorticoid-induced kinase 1 (SGK1) activates the epithelial sodium channel (eNaC) in tubules. We examined renal SGK1 abundance in salt-adaptation and in salt-sensitive hypertension. Sprague-Dawley and Dahl salt-sensitive rats were placed on either 8% or 0.3% NaCl diets for 10 days. Plasma aldosterone levels were {approx}2.5-fold greater on 0.3% versus 8% NaCl diets in both rat strains. Both serum and glucocorticoid-induced kinase 1 transcript and protein abundance were less (P<0.01) in Sprague-Dawley rats and greater (P<0.01) in Dahl salt-sensitive rats on 8% versus 0.3% NaCl diets. The cDNA sequences of serum and glucocorticoid-induced kinase 1 in both strains of rat were the same. The present results provide evidence that the abundance of serum and glucocorticoid-induced kinase 1 in rat kidney may play a role in salt adaptation and the pathogenesis of hypertension and suggests that aldosterone is not the primary inducer of SGK1 in the Sprague-Dawley rat.


Key Words: aldosterone • rat, Dahl • glucocorticoids • kinase • hypertension, renal • sodium, dietary • blood pressure


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Serum and glucocorticoid-induced serine/threonine kinase 1 (SGK1) is a 49-kDa protein of the AGC subfamily, which includes protein kinases A, G, and C. The aldosterone-activated mineralocorticoid receptor increases SGK1 gene transcription in the cortical collecting ducts, and SGK1, in turn, strongly stimulates the activity and expression of the epithelial sodium channel (ENaC) and renal Na+/H+ exchanger isoform (NHE).1–6 It is postulated to be a principal mediator of aldosterone-induced Na+ uptake in nephrons.

SGK1 expression is highly regulated. In addition to aldosterone and glucocorticoids,7,8 inducers of SGK1 transcript include follicle-stimulating hormone (FSH),9 high extracellular osmolarity,10 injury of the brain,11 p53,12 and oxidant stress.13 Although the transcription factors have not been discerned, the promoter of rat SGK1 has been shown to contain a glucocorticoid response element consensus sequence 1.0 kb upstream from the transcription start site, which is able to stimulate chloramphenicol acetyltransferase reporter gene activity in a dexamethasone-dependent manner.7,8

The catalytic domain of SGK1 has significant sequence homology (45% to 55% identity) with protein kinase B, protein kinase C, ribosomal protein S6 kinase, cAMP-dependent protein kinase, and rac protein kinase.7,8,14 It preferentially phosphorylates Ser and Thr residues that lie in Arg-Xaa-Arg-Xaa-Xaa-Ser/Thr motifs. The primary substrates for SGK1-mediated increases in expression of ENaC are not known, and primary in vivo SGK substrates remain to be identified.

This study examines renal abundance of SGK1 transcript and protein during salt adaptation and provides evidence of its potential importance in the pathogenesis of salt-sensitive hypertension in the Dahl salt-sensitive rat (Dahl SS/Jr rat).


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Animals
The animal use protocols were approved by the Chicago–West Side Veterans Administration Institutional Animal Care and Use Committee and were in compliance with NIH guidelines. Fourteen Male Sprague-Dawley and 14 Dahl SS/Jr rats, obtained from Harlan (Indianapolis), were placed on 0.3% (basal) and 8% (high) NaCl rat chow diets (Purina series 5500) for 10 days. Urinary sodium was measured to confirm correct diets.

Blood Pressure Measurements
Rats were anesthetized with methoxyflurane inhaled though a nose cone and intubated with an 18-gauge Angiocath tube. Anesthesia was maintained at a positive-pressure ventilation with 1.0% isoflurane delivered with 100% oxygen. A right lateral incision on the ventral portion of the neck exposed the carotid artery, and it was dissected free from surrounding tissue. A Millar ultraminiature pressure transducer (SPR-671, 1.4F) was inserted into the carotid artery to measure baseline arterial pressure. Gould ACQuire16 system and Ponemah Physiology Platform software were used for data acquisition. Measurements were done for 10 minutes after heart rate and blood pressure of the rat had stabilized. Readings from the 5-minute span with the least fluctuations were averaged.

RNA Preparation
Kidneys were removed and fast-frozen in liquid nitrogen. Total RNA was isolated with RNA Stat-60 (Tel-Test, Inc), with subsequent removal of residual contaminants using the RNeasy Total RNA Isolation Kit (Qiagen).

Real-Time PCR
SYBR Green PCR amplifications were performed with an ABI Prism 7700 real-time PCR system. Primers were designed on the basis of GenBank Database accession number L01624, using the primer 3 input (primer3_www.cgi V0.2) and checked by running virtual PCR (SGK1 forward 5'ATGTGAAGCACCCTTTCCTG3', reverse 5'TAGAACAGCTCTCCGCCATT3'; GAPDH forward 5'GAAGGGCTCATGACCACAGT3', reverse 5'GGATGCAGGGATGATGTTCT3'. Standards for quantification of SGK1 and GAPDH transcripts, full-length cDNA was cloned in pCR4-TOPO plasmid (Invitrogen) and measured by UV spectroscopy. Synthesis of cDNA from total RNA was carried out in a 20-µL reaction volume containing 5 µg total RNA, 1 µL of 10 mmol/L dNTPs and 0.75 µmol/L of random hexamers primer followed by incubation at 65°C for 5 minutes. The mixture was incubated with 1xRT-PCR first-strand buffer, 0.1 mol/L dithiothreitol (DTT) mixed and incubated at 42°C for 2 minutes; 50 U of SuperScript II (Invitrogen) then was added and incubated for a further 50 minutes at 42°C. The RT/PCR reactions were carried out in 96-well plates in a 25-µL reaction volume containing 12.5 µL of 2xSYBR Green Master Mix (PE Applied Biosystem), the total of 10 ng of cDNA and 0.3 µmol/L of each forward and reverse primer. The thermoprofile for SYBR real-time PCR was 50°C, 2 minutes at 94°C for 10 minutes followed by 40 cycles of amplification, 94°C for 15 seconds, and 60°C for 1 minute. Data acquisition and subsequent data analyses were performed with the use of the GeneAmp Sequence Detection System (version 1.3). Standard curves for SGK1 and GAPDH were constructed using full-length cDNA cloned in pCR 4MDSU-TOPO plasmid. Expression was normalized to GAPDH as an endogenous reference, and relative to SGK1 transcript abundance in kidneys from rats on 0.3% NaCl diet, sgk1 protein and transcript abundance as a calibrator. Amplifying known quantities of SGK1 and GAPDH plasmid clones were used to generate standard curves. Normalization was done by dividing SGK1 by GAPDH quantities.

Statistics
Expression of genes within strains was compared using ANOVA and change between strains by 2-sided t test. Significance was set at a level of P<0.05.

Sequencing of SGK1
Full-length cDNA was synthesized from total RNA using 11 RNase H- Reverse Transcriptase (RT). (Invitrogen) with the SGK1 gene specific antisense primer (5'-CGCGAGGAAGGAGTCCATAGG- AG-3'). cDNA was amplified by PCR using Taq polymerase (Invitrogen) with the 3' specific primer for RT and oligonucleotide to the 5' end (5'CGCGAGGAAGGAGTCCATAGGAG -3'). PCR product was separated by agarose gel electrophoresis and the band purified by use of the QIAEX11 Gel Extraction Kit (Qiagen). The PCR product was cloned into TOPO TA (pCR 4MDSU-TOPO) cloning vector (Invitrogen) and DNA was prepared with the use of the Qiaprep spin miniprep kit (Qiagen). Full-length SGK1 clone was sequenced by dideoxy-chain termination sequencing reactions, using 3 primers: M13 reverse primer, T7, and gene-specific primer SGK1 Forward 450 (5'-GCATGACCGTCAAAACCGA-3').

Plasma Aldosterone
Three milliliters of blood, collected from the carotid artery after making blood pressure measurements, was centrifuged at 5000g for 5 minutes to separate the serum. Aldosterone concentration was measured by solid-phase 125I radioimmunoassay (Coat-A-Count Aldosterone, DPC Cat. No. TKA1).

Western Analyses
Kidney tissues were washed with PBS and homogenized in a lysis buffer (20 mmol/L Tris-HCl, 150 mmol/L Na2EDTA, 1 mmol/L EGTA 1% Triton 2.5 mmol/L sodium pyrophosphate, 1 mmol/L b-glycerolphosphate-1 mmol/L Na3VO4) supplemented with 1 mmol/L PMSF and 1xprotease inhibitors (Roche Molecular Biochemicals). The homogenate was spun at 14 000 rpm for 30 minutes at 4°C, and the supernatant was collected and stored in aliquots at -80°C until use. Protein concentrations were estimated on each lysate with Bradford’s reagent (Bio-Rad Laboratories, Inc). Samples were separated on a 10% polyacrylamide gel. Membranes were immunoprobed with rabbit polyclonal anti-rat SGK1 antibody (Genex Bioscience Inc). The secondary antibody was a goat anti-rabbit IgG HRP-conjugated antibody (Santa Cruz Biotechnology Inc). The blot was developed using the ChemiLucent Western Blot Detection kit (Chemicon International). Membranes were stripped and immunoprobed with B-actin antibody. Densitometric analysis of Western blots was carried out by visualizing the band with Transilluminator (Eagle Eye ll) (Stratagene), and the band density was calculated with Image software (NIH, Research Service Branch).

Statistics
Transcript/protein expression within strains was compared using ANOVA and change between strains by 2-sided t test. Significance was set at a level of P<0.05.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Blood Pressure and Plasma Aldosterone
Arterial blood pressure (seeTable) was similar in Sprague-Dawley rats on 0.3% and 8% NaCl diets. In the Dahl SS/Jr rats, blood pressure was similar on a 0.3% NaCl diet as in the Sprague-Dawley rats but was increased in rats on an 8% NaCl diet. The standard deviations of the mean blood pressure measurements were similar in the 2 strains. The weights were similar for rats of both strains and on both diets.


View this table:
[in this window]
[in a new window]
 
Intra-Arterial Mean Blood Pressures in Sprague Dawley and Dahl SS/Jr Rats on 0.3% and 8% NaCl Diets for 10 Days

Plasma aldosterone was measured in Dahl SS/Jr and Sprague-Dawley rats on 0.3 and 8% NaCl diets (Figure 1). On 0.3% diets, plasma aldosterone was 2.3-fold greater in Sprague-Dawley rats than in the Dahl SS/Jr rats (P<0.01). In both strains, plasma aldosterone was {approx}2-fold greater in rats on 0.3% versus 8% NaCl diets.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 1. Plasma aldosterone levels in Sprague-Dawley and Dahl SS/Jr rats on 8% and 0.3% NaCl diets for 10 days (see Methods).

Renal SGK1 in Sprague-Dawley and Dahl SS/Jr Rats on 0.3% and 8% NaCl Diets
Renal SGK1 1 transcript and protein abundance was measured in whole kidney from rats on 0.3% and 8% NaCl diets. SGK1 transcript abundance was similar in Dahl SS/Jr and Sprague Dawley rats on 0.3% NaCl diets. On the 8% NaCl diet, abundance was reduced (P<0.01) to approximately one-half in Sprague Dawley and increased (P<0.05) 2-fold in Dahl SS/Jr rats compared with that in rats on 0.3% NaCl (Figure 2A). Renal SGK1 protein abundance (Figure 2B) in rats on a 0.3% NaCl diet was 1.5-fold greater (P<0.01) in Sprague-Dawley rats than in Dahl SS/Jr rats. On the 8% NaCl diet, abundance was less (P<0.01) in Sprague-Dawley and increased (P<0.05) in Dahl SS/Jr rats compared with that in rats of the same strains on the 0.3% NaCl (Figure 2B). Thus, although there is a difference in the relationship of dietary salt intake with SGK1 protein and transcript abundance, protein and transcript abundance parallel each other in both strains.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 2. Renal SGK1 transcript and protein abundance. A, Abundance of renal SGK1 transcript in Sprague-Dawley and Dahl SS/Jr rats on 8% (high) or 0.3% (basal) NaCl diets by (kinetic) RT-PCR, using SYBR Green. PCR amplification for both SGK1 and GAPDH yielded unique bands of predicted sizes. Sequencing of cloned products verified gene specificity. Near log-linear amplification was observed, with amplification occurring between cycles 14 and 40. Expression of genes within strains compared by ANOVA and change between strains by 2-sided t test. Representative immunoblot on top. B, Western analysis of SGK1 protein abundance in Sprague-Dawley and Dahl SS/Jr rat kidneys (see Methods).

SGK1 Transcript Sequences
SGK1 transcripts were sequenced in Sprague-Dawley and Dahl SS/Jr rats for 4 rats. The full-length cDNA sequences were identical in Sprague-Dawley and Dahl SS/Jr rats (n=4 of each strain) and the same as of accession number L01624 in GenBank (National Center for Biotechnology Information, NCBI).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
This study shows that renal SGK1 abundance is regulated by dietary salt content. Differences in the regulation of renal SGK1 in Dahl SS/Jr versus Sprague-Dawley rats suggest that this may be a mechanism of salt-adaptation and salt-sensitive hypertension.

Renal SGK1 transcript and protein abundance in the Sprague-Dawley rat is reduced on a high salt diet, suggesting that decreased SGK1 activity may be a mechanism of reducing renal tubule Na+ uptake in normal adaptation. From the present studies, it is not possible to differentiate whether a change in SGK1 abundance contributes to the development versus maintenance of pressure in salt-adaptation, since the temporal relationship of the increase in blood pressure to the reduction in SGK1 abundance in the rats was not evaluated.

A high salt diet increases renal SGK1 transcription and protein abundance in Dahl SS/Jr rats, suggesting that increased SGK1 expression may be a mechanism for increased renal Na+ uptake in the Dahl SS/Jr rat strain. The role of the renin-angiotensin-aldosterone system (RAAS) in salt adaptation and the Dahl rat has been extensively reviewed by Rapp et al15 and Gomez-Sanchez et al.16 It is generally accepted that the RAAS undergoes a compensatory decrease in activity in the Dahl SS/Jr and Sprague-Dawley rats.16–18 However, the present data with SGK1 raises the possibility that the SGK1 component of the signaling pathway is upregulated, and therefore there is increased activity.

We have begun to address the issue as to whether a specific polymorphism of the SGK1 transcript is preferentially expressed in the Dahl SS/Jr versus Sprague-Dawley rat kidney by sequencing the transcripts. Since the sequences were the same in the 2 strains, we conclude that SGK1 gene polymorphisms, if present, are in the noncoding and/or flanking regions.

Support for SGK1 as a candidate gene and the existence of polymorphisms in nontranslated and/or regulatory regions is provided by the finding that it maps to a known blood pressure quantitative trait locus (Figure 3), which was determined from a series of congenic strains with segments of chromosome 1 from Lewis–Dahl SS/Jr rat crosses.19,20 However, it does not map to the chromosome 1 QTL reported from crosses involving spontaneously hypersensitive rats (SHR) and Wistar-Kyoto rats (WKY).21 This QTL corresponds to blood pressure QTLs described on mouse chromosome 10 and human chromosome 6, which has been linked to human hypertension.21,22



View larger version (24K):
[in this window]
[in a new window]
 
Figure 3. Schematic diagram of integrated radiation hybrid map location of SGK1 on rat chromosome 1 (D1Rat192-D1Rat10). Relationship of SGK1 to other markers and blood pressure QTL region 2 on virtual chromosome (VC) (http://rgd.mcw.edu/tools/vcmap/vcmap.cgi?Ver=5.0). SGK1 locus from LocusLink at NCBI (http://www.ncbi.nlm.nih.gov/LocusLink/) was integrated into the virtual comparative (VC) map (http://rgd.mcw.edu/tools/vcmap/vcmap.cgi?Ver=5.0) and related to known QTL and RH markers using Medical College of Ohio (http://home.mco.edu/depts/physiology/research/rat/marker.html), Massachusetts Institute of Technology (http://www. genome.wi.mit.edu/rat/public/), Oxford University (http://www.well.ox.ac.uk/rat_mapping_resources/), and the National Institutes of Health ARB (http://www.niams.nih.gov/rtbc/ratgbase/index.htm) linkage and RH maps.

A central question is the identity of proximate regulators of transcription SGK1 in salt adaptation. A decrease in plasma aldosterone may mediate the high salt-induced decrease in SGK1 transcript in the Sprague-Dawley rat but does not explain the increase in SGK1 transcript in the Dahl SS/Jr rat.23 One possibility in the Dahl SS/Jr rat is that corticosterone induces SGK1 activity.24 This would provide mechanistic insight into the association of 18-OH-deoxycortisone levels and 11 {alpha}-hydroxylase gene with hypertension in the Dahl SS rat.25 Another possibility is that insulin, which increases SGK1 kinase activity through phosphatidylinositol-3-kinase,1,13 mediates the increase in SGK1 transcript in the Dahl SS rat, since these and other forms of hypertension have been associated with hyperinsulinemia.26,27 TGF-{alpha}1, which has been shown to induce SGK1, is increased by a high salt diet in the Dahl SS/Jr rat.28 Oxidant stress cannot be excluded as an inducer of SGK1 in hypertension.29 Transcription of SGK1 is markedly upregulated by osmotic and isotonic cell shrinkage30,31 ; however, osmotic changes in salt-adaptation and salt-sensitive hypertension in the kidney remain to be fully clarified.

Although the rationale for these experiments was that SGK1 activates ENaC, other actions of SGK1 may also be important in the kidney, especially as related to cell hypertrophy and remodeling. Induction of SGK1 has been linked to glucocorticoid-mediated protection against apoptosis.32 Thus, reduced SGK1 expression may promote apoptosis of kidney cells during salt adaptation. On the other hand, increased SGK1 expression in the hypertensive Dahl SS/Jr rat may be a compensatory or protective response to hypertension-associated proapoptotic mechanisms. However, given the regulation by NaCl and its involvement in renin-angiotensin signaling, SGK1 is likely to play a major role in salt adaptation and blood pressure regulation.


*    Acknowledgments
 
Dr Danziger was supported by a Veterans Administration Advanced Career Development Award and a Grant-in-Aid from the American Heart Association.

Received October 23, 2002; first decision November 15, 2002; accepted February 13, 2003.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 

  1. Pearce D. The role of SGK1 in hormone-regulated sodium transport. Trends Endocrinol Metab. 2001; 12: 341–347.[CrossRef][Medline] [Order article via Infotrieve]
  2. Yun CC, Chen Y, Lang F. Glucocorticoid activation of Na(+)/H(+) exchanger isoform-3 roles of SGK1 and NHERF2. J Biol Chem. 2002; 277: 7676–7683.[Abstract/Free Full Text]
  3. Naray-Fejes-Toth Fejes-Toth G. The sgk, an aldosterone-induced gene in mineralocorticoid target cells, regulates the epithelial sodium channel. Kidney Int. 2000; 57: 1290–1294.[CrossRef][Medline] [Order article via Infotrieve]
  4. Verrey F. Transcriptional control of sodium transport in tight epithelial by adrenal steroids. J Membr Biol. 1995; 144: 93–110.[Medline] [Order article via Infotrieve]
  5. Naray-Fejes-Toth A, Canessa C, Cleaveland ES, Aldrich G, Fejes-Toth G. Sgk is an aldosterone-induced kinase in the renal collecting duct: effects on epithelial Na+ channels. J Biol Chem. 1999; 274: 16973–16978.[Abstract/Free Full Text]
  6. Chen SY, Bhargava A, Mastroberardino L, Meijer OC, Wang J, Buse P, Firestone GL, Verrey F, Pearce D. Epithelial sodium channel regulated by aldosterone-induced protein sgk. Proc Natl Acad Sci U S A. 1999; 96: 2514–2519.[Abstract/Free Full Text]
  7. Webster MK, Goya L, Firestone GL. Immediate-early transcriptional regulation and rapid mRNA turnover of a putative serine/threonine protein kinase. J Biol Chem. 1993; 268: 11482–11485.[Abstract/Free Full Text]
  8. Webster MK, Goya L, Ge Y, Maiyar AC, Firestone GL. Characterization of sgk, a novel member of the serine/threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum. Mol Cell Biol. 1993; 13: 2031–2040.[Abstract/Free Full Text]
  9. Richards JS, Fitzpatrick SL, Clemens JW, Morris JK, Alliston T, Sirois J. Ovarian cell differentiation: a cascade of multiple hormones, cellular signals, and regulated genes. Recent Prog Horm Res. 1995; 50: 223–254.[Medline] [Order article via Infotrieve]
  10. Waldegger S, Barth P, Forrest JN Jr, Raber G, Lang F. Cloning and characterization of a putative human serine/threonine protein kinase transcriptionally modified during anisotonic and isotonic alterations of cell volume. Proc Natl Acad Sci U S A. 1997; 94: 4440–4445.[Abstract/Free Full Text]
  11. Hollister RD, Page KJ, Hyman BT. Distribution of the messenger RNA for the extracellularly regulated kinases 1, 2 and 3 in rat brain: effects of excitotoxic hippocampal lesions. Neuroscience. 1997; 79: 1111–1119.[CrossRef][Medline] [Order article via Infotrieve]
  12. Maiyar AC, Huang AJ, Phu PT, Cha HH, Firestone GL. p53 stimulates promoter activity of the sgk. serum/glucocorticoid-inducible serine/threonine protein kinase gene in rodent mammary epithelial cells. J Biol Chem. 1996; 271: 12414–12422.[Abstract/Free Full Text]
  13. Park J, Leong ML, Buse P, Maiyar AC, Firestone GL, Hemmings BA. Serum and glucocorticoid-inducible kinase (SGK) is a target of the PI 3-kinase-stimulated signaling pathway. EMBO J. 1999; 18: 3024–3033.[CrossRef][Medline] [Order article via Infotrieve]
  14. Lang F, Cohen P. Regulation and physiological roles of serum- and glucocorticoid-induced protein kinase isoforms. Sci STKE. 2001; 108: RE17.
  15. Rapp JP, Tan SY, Margolius HS. Plasma mineralocorticoids, plasma renin, and urinary kallikrein in salt-sensitive and salt-resistant rats. Endocr Res Commun. 1978; 5: 35–41.[Medline] [Order article via Infotrieve]
  16. Gomez-Sanchez EP, Zhou M, Gomez-Sanchez CE. Mineralocorticoids, salt and high blood pressure. Steroids. 1996; 61: 184–188.[CrossRef][Medline] [Order article via Infotrieve]
  17. Tamura K, Chiba E, Yokoyama N, Sumida Y, Yabana M, Tamura N, Takasaki I, Takagi N, Ishii M, Horiuchi M, Umemura S. Renin-angiotensin system and fibronectin gene expression in Dahl Iwai salt-sensitive and salt-resistant rats. J Hypertens. 1999; 17: 81–89.[Medline] [Order article via Infotrieve]
  18. Campbell WG Jr, Gahnem F, Catanzaro DF, James GD, Camargo MJ, Laragh JH, Sealey JE. Plasma and renal prorenin/renin, renin mRNA, and blood pressure in Dahl salt-sensitive and salt-resistant rats. Hypertension. 1996; 27: 1121–1133.[Abstract/Free Full Text]
  19. Saad Y, Garrett MR, Rapp JP. Multiple blood pressure QTL on rat chromosome 1 defined by Dahl rat congenic strains. Physiol Genomics. 2001; 4: 201–214.[Abstract/Free Full Text]
  20. Saad Y, Garrett MR, Lee SJ, Dene H, Rapp JP. Localization of a blood pressure QTL on rat chromosome 1 using Dahl rat congenic strains. Physiol Genomics. 1999; 1: 119–125.[Abstract/Free Full Text]
  21. Waldegger S, Erdel M, Nagl UO, Barth P, Raber G, Steuer S, Utermann G, Paulmichl M, Lang F. Genomic organization and chromosomal localization of the human SGK protein kinase gene. Genomics. 1998; 51: 299–302.[CrossRef][Medline] [Order article via Infotrieve]
  22. Vidan-Jeras B, Gregoric A, Jurca B, Jeras M, Bohinjec M. Possible influence of genes located on chromosome 6 within or near to the major histocompatibility complex on development of essential hypertension. Pflugers Arch. 2000; 439: R60–R62.[CrossRef][Medline] [Order article via Infotrieve]
  23. Rapp JP, Dahl LK. Suppression of aldosterone in salt susceptible and salt resistant rats. Endocrinology. 1973; 92: 1286–1289.[Medline] [Order article via Infotrieve]
  24. Griffing GT, Melby JC, Holbrook M, Wilson T, Azar S, Delaney M, Weiss S. Elevated 18-hydroxy-corticosterone in inbred salt-sensitive rats. Clin Exp Hypertens A. 1991; 13: 371–382.[Medline] [Order article via Infotrieve]
  25. Rapp JP, Dahl LK. Mendelian inheritance of 18- and ll beta-steroid hydroxylase activities in the adrenals of rats genetically susceptible or resistant to hypertension. Endocrinology. 1972; 90: 1435–1446.[Medline] [Order article via Infotrieve]
  26. Sechi LA, Griffin CA, Giacchetti G, Zingaro L, Catena C, Bartoli E, Schambelan M. Abnormalities of insulin receptors in spontaneously hypertensive rats. Hypertension. 1996; 27: 955–961.[Abstract/Free Full Text]
  27. Tomiyama H, Kushiro T, Abeta H, Kurumatani H, Taguchi H, Kuga N, Saito F, Kobayashi F, Otsuka Y, Kanmatsuse K. Blood pressure response to hyperinsulinemia in salt-sensitive and salt-resistant rats. Hypertension. 1992; 20: 596–600.[Abstract/Free Full Text]
  28. Tamaki K, Okuda S, Nakayama M, Yanagida T, Fujishima M. Transforming growth factor-beta 1 in hypertensive renal injury in Dahl salt-sensitive rats. J Am Soc Nephrol. 1996; 7: 2578–2589.[Abstract]
  29. Wilcox CS. Reactive oxygen species: roles in blood pressure and kidney function. Curr Hypertens Rep. 2002; 4: 160–166.[Medline] [Order article via Infotrieve]
  30. Fillon S, Warntges S, Matskevitch J, Moschen I, Setiawan I, Gamper N, Feng YX, Stegen C, Friedrich B, Waldegger S, Broer S, Wagner CA, Huber SM, Klingel K, Vereninov A, Lang F. Serum- and glucocorticoid-dependent kinase, cell volume, and the regulation of epithelial transport. Comp Biochem Physiol A Mol Integr Physiol. 2001; 130: 367–376.[CrossRef][Medline] [Order article via Infotrieve]
  31. Warntges S, Friedrich B, Henke G, Duranton C, Lang PA, Waldegger S, Meyermann R, Kuhl D, Speckmann EJ, Obermuller N, Witzgall R, Mack AF, Wagner HJ, Wagner A, Broer S, Lang F. Cerebral localization and regulation of the cell volume-sensitive serum- and glucocorticoid-dependent kinase SGK1. Pflugers Arch. 2002; 443: 617–624.[CrossRef][Medline] [Order article via Infotrieve]
  32. Mikosz CA, Brickley DR, Sharkey MS, Moran TW, Conzen SD. Glucocorticoid receptor-mediated protection from apoptosis is associated with induction of the serine/threonine survival kinase gene, sgk-1. J Biol Chem. 2001; 276: 16649–16654.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
PhysiologyHome page
H. A. Drummond, S. C. Grifoni, and N. L. Jernigan
A New Trick for an Old Dogma: ENaC Proteins as Mechanotransducers in Vascular Smooth Muscle
Physiology, February 1, 2008; 23(1): 23 - 31.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. Nagase, H. Matsui, S. Shibata, T. Gotoda, and T. Fujita
Salt-Induced Nephropathy in Obese Spontaneously Hypertensive Rats Via Paradoxical Activation of the Mineralocorticoid Receptor: Role of Oxidative Stress
Hypertension, November 1, 2007; 50(5): 877 - 883.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
S. Shibata, M. Nagase, S. Yoshida, H. Kawachi, and T. Fujita
Podocyte as the Target for Aldosterone: Roles of Oxidative Stress and Sgk1
Hypertension, February 1, 2007; 49(2): 355 - 364.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
M. Nagase, S. Yoshida, S. Shibata, T. Nagase, T. Gotoda, K. Ando, and T. Fujita
Enhanced Aldosterone Signaling in the Early Nephropathy of Rats with Metabolic Syndrome: Possible Contribution of Fat-Derived Factors
J. Am. Soc. Nephrol., December 1, 2006; 17(12): 3438 - 3446.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
D. Y. Huang, K. M. Boini, H. Osswald, B. Friedrich, F. Artunc, S. Ullrich, J. Rajamanickam, M. Palmada, P. Wulff, D. Kuhl, et al.
Resistance of mice lacking the serum- and glucocorticoid-inducible kinase SGK1 against salt-sensitive hypertension induced by a high-fat diet
Am J Physiol Renal Physiol, December 1, 2006; 291(6): F1264 - F1273.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
F. Lang, C. Bohmer, M. Palmada, G. Seebohm, N. Strutz-Seebohm, and V. Vallon
(Patho)physiological Significance of the Serum- and Glucocorticoid-Inducible Kinase Isoforms.
Physiol Rev, October 1, 2006; 86(4): 1151 - 1178.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
K. M. Boini, A. M. Hennige, D. Y. Huang, B. Friedrich, M. Palmada, C. Boehmer, F. Grahammer, F. Artunc, S. Ullrich, D. Avram, et al.
Serum- and glucocorticoid-inducible kinase 1 mediates salt sensitivity of glucose tolerance.
Diabetes, July 1, 2006; 55(7): 2059 - 2066.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
F. Grahammer, F. Artunc, D. Sandulache, R. Rexhepaj, B. Friedrich, T. Risler, J. A. McCormick, K. Dawson, J. Wang, D. Pearce, et al.
Renal function of gene-targeted mice lacking both SGK1 and SGK3
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2006; 290(4): R945 - R950.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
D. Y. Huang, K. M. Boini, B. Friedrich, M. Metzger, L. Just, H. Osswald, P. Wulff, D. Kuhl, V. Vallon, and F. Lang
Blunted hypertensive effect of combined fructose and high-salt diet in gene-targeted mice lacking functional serum- and glucocorticoid-inducible kinase SGK1
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2006; 290(4): R935 - R944.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
D. Alvarez de la Rosa, I. Gimenez, B. Forbush, and C. M. Canessa
SGK1 activates Na+-K+-ATPase in amphibian renal epithelial cells
Am J Physiol Cell Physiol, February 1, 2006; 290(2): C492 - C498.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
V. Vallon, P. Wulff, D. Y. Huang, J. Loffing, H. Volkl, D. Kuhl, and F. Lang
Role of Sgk1 in salt and potassium homeostasis
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2005; 288(1): R4 - R10.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Physiol.Home page
D. A. de la Rosa, T. G. Paunescu, W. J. Els, S. I. Helman, and C. M. Canessa
Mechanisms of Regulation of Epithelial Sodium Channel by SGK1 in A6 Cells
J. Gen. Physiol., September 27, 2004; 124(4): 395 - 407.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. Farjah, T. L. Washington, B. P. Roxas, D. L. Geenen, and R. S. Danziger
Dietary NaCl Regulates Renal Aminopeptidase N: Relevance to Hypertension in the Dahl Rat
Hypertension, February 1, 2004; 43(2): 282 - 285.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
41/4/874    most recent
01.HYP.0000063885.48344.EAv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Farjah, M.
Right arrow Articles by Danziger, R. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Farjah, M.
Right arrow Articles by Danziger, R. S.