| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Hypertension. 2003;41:1131.)
© 2003 American Heart Association, Inc.
Scientific Contributions |
From the Renal Division, Department of Medicine, Emory University School of Medicine, Atlanta, Ga.
Correspondence to W. Charles ONeill, MD, Emory University, Renal Division WMB 338, 1639 Pierce Dr, Atlanta, GA 30322. E-mail woneill{at}emory.edu
| Abstract |
|---|
|
|
|---|
Key Words: aldosterone muscle, smooth, vascular rats hypertension, mineralocorticoid vasoconstriction
| Introduction |
|---|
|
|
|---|
The mechanism responsible for increased contraction is unknown but may involve changes in Na+ transport akin to those in other mineralocorticoid-sensitive cells. Both the Na+ content and passive flux of Na+ are increased in vascular smooth muscle from mineralocorticoid-treated animals,5,7 and both the mRNA and activity of the Na+ pump are increased.710 This upregulation of the Na+ pump is probably secondary to increased Na+ influx because intracellular [Na+] is increased rather than decreased.5,11 Although increased intracellular [Na+] could stimulate Ca influx through the Na-Ca exchange, thereby increasing contractility, Ca stores do not appear to be increased in vascular smooth muscle from mineralocorticoid-treated rats.12 However, acute increases in intracellular [Ca] have been observed after treatment of cultured vascular smooth muscle cells with aldosterone.13
The source of the increased passive Na+ flux is unknown, but a likely candidate is the Na-K-2Cl cotransporter NKCC1. We have recently demonstrated that this transporter is acutely activated by vasoconstrictors and inhibited by nitrovasodilators in isolated rat aorta.14 In addition to the increase in Na+ flux, stimulation of NKCC1 could also account for the increased K+ and Cl- fluxes9,15 also observed in vascular smooth muscle from mineralocorticoid-treated animals. In fact, the increase in intracellular [Cl-] in femoral artery of mineralocorticoid-treated, hypertensive rats is abolished by bumetanide,16 a specific inhibitor of NKCC1. Although this indicates an increased Cl- influx via NKCC1, it is unclear whether this is due to the mineralocorticoid, the high salt diet, or the hypertension. Bumetanide also reduces isometric force generation in normal vascular smooth muscle,14,17 indicating a role for NKCC1 in smooth muscle contraction. To determine whether the Na-K-2Cl cotransporter in vascular smooth muscle is regulated by aldosterone, we measured bumetanide-sensitive fluxes in aortas from rats treated with aldosterone. Studies were also performed in normal aortas in culture to show that the regulation of NKCC1 was through a direct action of aldosterone on smooth muscle.
| Methods |
|---|
|
|
|---|
In Vitro Studies
Aortas proximal to the celiac axis were removed from normal rats and the adventitia was carefully dissected away, using sterile technique. Rings (0.5 cm in length) were placed in DMEM (low glucose) medium with penicillin and streptomycin, but no serum, and with aldosterone (50 nmol/L) or vehicle (DMSO; final concentration 0.001%). The vessels were maintained in a 5% CO2 atmosphere at 37°C with medium changes every 3 days.
NKCC1 Assay
Activity was measured as bumetanide-sensitive 86Rb+ efflux as previously described.14 Briefly, vessel segments were opened longitudinally and the endothelium removed with a cotton swab. They were then loaded with 86Rb+ for 2 hours in a HEPES-buffered physiological saline solution containing 5.4 mmol/L K, 1.8 mmol/L Ca, and 0.8 mmol/L Mg. Steady-state loading of Rb+ requires 3 to 4 hours, but concern that changes occurring in vivo might dissipate over this time dictated a shorter loading period. Previous studies have revealed a single pool of intracellular Rb+ and no differences between fluxes after different loading times. After extensive washing, efflux of 86Rb+ was measured over 10 minutes at 2 minutes intervals before and after addition of 50 µmol/L bumetanide (Figure 1). Results are expressed as the fraction of 86Rb+ leaving the vessel per minute and the flux caused by NKCC1 is determined by subtracting the mean of the 3 values after 4 minutes of bumetanide from the mean of the 3 values just before addition of bumetanide.
|
Real-Time Polymerase Chain Reaction (PCR)
Total RNA was prepared using a modified phenol-chloroform extraction from rat aorta previously frozen in liquid N2 and stored at -80°C. RNA (2 µg) was converted into cDNA using ThermoScript RT reverse transcriptase (Invitrogen) and 200 ng was then amplified in an PE Biosystems real-time PCR unit using SYBR green dye. Forward and reverse primers for NKCC1 were CCACACCAACACCTACTAC and TGCGACCACAGCATCTCT, respectively, corresponding to nucleotides 743 to 761 and 956 to 973 of the rat NKCC1 cDNA (GenBank Accession No. U13174). Results were normalized to real-time PCR of rat ß-actin (GenBank Accession No. NM_031144) using the forward and reverse primers TGTTGTCCCTGTATGCCTCTGGTC and ATGTCACGCACGATTTCCCTCTCA, corresponding to (nucleotides 416 to 439 and 635 to 658).
Data Analysis
Results are expressed as the mean of the number of samples indicated. Errors are standard errors. Significance was determined by Student t test (2-tailed).
| Results |
|---|
|
|
|---|
|
|
Most effects of aldosterone are mediated through classic mineralocorticoid receptors that affect DNA transcription. Immediate nongenomic effects on Na+ transport have also been proposed in vascular smooth muscle cells,19 but aldosterone had no immediate effect on 86Rb+ efflux in rat aorta (Figure 3). The response to different concentrations of aldosterone in culture is shown in Figure 4. A 3-parameter exponential regression yielded a half-maximal concentration of aldosterone for stimulation of NKCC1 of 0.052±0.017 nmol/L, which is in the physiological range and consistent with the affinity of the mineralocorticoid receptor for aldosterone.5 Stimulation of NKCC1 was blocked by spironolactone (a mineralocorticoid receptor antagonist), but not by RU38486, a glucocorticoid receptor antagonist (Figure 5), indicating that it is mediated by classic mineralocorticoid receptors. The increase in NKCC1 activity with spironolactone is consistent with a partial agonist effect that may occur with spironolactones.20,21
|
|
|
To determine whether aldosterone increases the quantity of cotransporters, we stimulated aldosterone-treated aortas with phenylephrine. This
-adrenergic agent acutely stimulates NKCC1,14 and we reasoned that an increase in cotransporter quantity would augment the stimulation by phenylephrine. As seen in Figure 6, NKCC1 activity after phenylephrine was not greater in aortas cultured with aldosterone for 3 days. Because basal NKCC1 activity was greater in aldosterone-treated aortas, the stimulation by phenylephrine was actually reduced. Similar results were obtained in an additional experiment and in one experiment in aortas from adrenalectomized rats treated with aldosterone in vivo. To address this issue further, we measured NKCC1 mRNA by real-time PCR. This assay has been used to show increased NKCC1 mRNA expression in hypertensive rats (G. Jiang, F. Akar, S. Cobbs, K. Lomeshrili, R. Lakkis, F. Gordon, R. Sutliff, W. ONeill, submitted for publication, 2003). In 3 separate experiments, each performed in triplicate, there was no increase in NKCC1 mRNA in aortas treated with aldosterone in culture for 3 days (2.82±0.29 vs 2.86±0.25 pg NKCC1 mRNA/ng ß-actin mRNA, aldosterone vs control).
|
| Discussion |
|---|
|
|
|---|
Stimulation of NKCC1 could explain the increased Na+, K+, and Cl- fluxes previously noted in vascular smooth muscle from mineralocorticoid-treated rats.5,7,9,11 Although we measured cotransporter activity as unidirectional efflux of Rb+ (as a tracer for K+), the transporter is bidirectional and the net flux under physiological conditions is inward because of the inward gradients for both Na+ and Cl-. This is demonstrated by the reduction in [Cl-]i after treatment of vascular smooth muscle with bumetanide.22 Thus stimulation of NKCC1 by mineralocorticoid would be expected to increase [Cl-]i and at least partly explains the increased [Cl-]i in vascular smooth muscle from deoxycorticosterone acetate (DOCA)-hypertensive rats.16 Intracellular [Cl-] in vascular smooth muscle is substantially lower than extracellular [Cl-], but above electrochemical equilibrium, enabling agonist-sensitive Cl- channels to initiate a depolarization that leads to subsequent Ca influx via voltage-sensitive channels.22,23 A reduction in [Cl-]i probably explains the reduced sensitivity of isometric force generation to phenylephrine in mice lacking NKCC124 and in normal aortas treated with bumetanide.14,17 Likewise, an increase in [Cl-]i resulting from stimulation of NKCC1 could account for the increased sensitivity to vasoconstrictors produced by mineralocorticoids.24
Stimulation of NKCC1 activity could explain the increase in intracellular [Na+] noted in mineralocorticoid-treated vascular smooth muscle.5,11 This has been demonstrated in cardiac myocytes, in which bumetanide blocked the increase in Na+ influx produced by aldosterone.25 An increase in intracellular Na+ could contribute to the contractile effect of NKCC1 by secondarily increasing Ca influx through Na-Ca exchange. However, Cl- is the more likely mediator because Ca stores do not appear to be increased by mineralocorticoids12 and because bumetanide does not inhibit the contractile response to KCl.14 The contraction produced by KCl is Ca-dependent but KCl directly depolarizes the membrane and therefore bypasses any effect of intracellular Cl-. An acute increase in [Ca2+]i produced by aldosterone in cultured smooth muscle cells could also contribute to increased smooth muscle tone13 but cannot be ascribed to NKCC1 because there was no acute stimulation of this transporter by aldosterone.
The coupled influx of Na+, K+, and Cl- ions produced by NKCC1, together with an obligate influx of water, results in an increase in cell volume. Consequently, NKCC1 is an important volume-regulatory transporter,26 and stimulation of NKCC1 by growth factors27 produces cell enlargement that may be required for cell growth.28,29 Thus, stimulation of NKCC1 may contribute to smooth muscle hypertrophy and remodeling in addition to increased tone.
The mechanism by which aldosterone stimulates NKCC1 in vascular smooth muscle is unclear. The absence of an increase in NKCC1 mRNA or augmentation of the phenylephrine response suggests that there is not an increase in the number of transporters. In contrast, hypertension produced by aortic coarctation, which results in a similar stimulation of NKCC1, produces a 5-fold increase in NKCC1 mRNA (Jiang et al, submitted). Although a small increase in NKCC1 mRNA by aldosterone cannot be ruled out, the stimulation of NKCC1 by aldosterone clearly has a different mechanism. It is likely then that aldosterone is producing an indirect genomic stimulation of NKCC1 similar to its regulation of Na+ channels.30 NKCC1 is acutely regulated through direct phosphorylation by a kinase that is activated by cell shrinkage and inhibited by intracellular Cl-.31,32 Because neither smooth muscle shrinkage nor a decrease in [Cl-] seems likely, aldosterone could be inducing phosphorylation of NKCC1 through a different mechanism that is under genomic control. Vasoconstrictors also phosphorylate NKCC1 in rat aorta,14 and the fact that the stimulation of NKCC1 by aldosterone and phenylephrine were not additive suggests a common pathway.
Perspectives
The vasculature is an important target of mineralocorticoids, but the mechanism by which mineralocorticoids promote vascular tone is unknown. Previous studies have shown increased ion fluxes consistent with aldosterone action in the kidney, but the identity of the transporter(s) and how these fluxes contribute to increased tone were unclear. The finding that aldosterone increases the activity of the Na-K-2Cl cotransporter in rat aorta provides some important answers. Stimulation of this single transporter can explain the increased passive fluxes of Na+, K+, and Cl- fluxes previously demonstrated in mineralocorticoid-treated rats, as well as upregulation of the Na-K pump secondary to increased [Na+]i. The fact that this transporter contributes to force generation provides a plausible link between the increased ion fluxes and the increased vascular tone produced by mineralocorticoids. This inotropic effect of the cotransporter appears to be mediated by an increased [Cl-]i, indicating that aldosterone should be considered to be a Cl-retentive hormone as well as a Na-retentive hormone. The contribution of NKCC1 to smooth muscle tone may explain the weak vasodilatory response to loop diuretics, and our new results suggest that they might be particularly useful in treating mineralocorticoid-dependent hypertension. However, these drugs are highly protein-bound, and direct vasodilatory effects may occur only at very high clinical doses.14 The degree to which bumetanide blocks the vasoconstrictive and hypertensive effects of mineralocorticoids is an important issue that is currently being investigated.
Received July 1, 2002; first decision July 30, 2002; accepted February 28, 2003.
| References |
|---|
|
|
|---|
-Adrenergic receptors and 45Ca2+ efflux in arteries from deoxycorticosterone acetate hypertensive rats. Hypertension. 1992; 19: 734738.This article has been cited by other articles:
![]() |
P. Garg, C. F. Martin, S. C. Elms, F. J. Gordon, S. M. Wall, C. J. Garland, R. L. Sutliff, and W. C. O'Neill Effect of the Na-K-2Cl cotransporter NKCC1 on systemic blood pressure and smooth muscle tone Am J Physiol Heart Circ Physiol, May 1, 2007; 292(5): H2100 - H2105. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Orlov NKCC1 as a regulator of vascular tone and a novel target for antihypertensive therapeutics Am J Physiol Heart Circ Physiol, May 1, 2007; 292(5): H2035 - H2036. [Full Text] [PDF] |
||||
![]() |
R. Gros, Q. Ding, S. Armstrong, C. O'Neil, J. G. Pickering, and R. D. Feldman Rapid effects of aldosterone on clonal human vascular smooth muscle cells Am J Physiol Cell Physiol, February 1, 2007; 292(2): C788 - C794. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wouters, A. D. Laet, L. V. Donck, E. Delpire, P.-P. van Bogaert, J.-P. Timmermans, A. de Kerchove d'Exaerde, K. Smans, and J.-M. Vanderwinden Subtractive hybridization unravels a role for the ion cotransporter NKCC1 in the murine intestinal pacemaker Am J Physiol Gastrointest Liver Physiol, June 1, 2006; 290(6): G1219 - G1227. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Wall, M. A. Knepper, K. A. Hassell, M. P. Fischer, A. Shodeinde, W. Shin, T. D. Pham, J. W. Meyer, J. N. Lorenz, W. H. Beierwaltes, et al. Hypotension in NKCC1 null mice: role of the kidneys Am J Physiol Renal Physiol, February 1, 2006; 290(2): F409 - F416. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Wall, Y. H. Kim, L. Stanley, D. M. Glapion, L. A. Everett, E. D. Green, and J. W. Verlander NaCl Restriction Upregulates Renal Slc26a4 Through Subcellular Redistribution: Role in Cl- Conservation Hypertension, December 1, 2004; 44(6): 982 - 987. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Lomashvili, S. Cobbs, R. A. Hennigar, K. I. Hardcastle, and W. C. O'Neill Phosphate-Induced Vascular Calcification: Role of Pyrophosphate and Osteopontin J. Am. Soc. Nephrol., June 1, 2004; 15(6): 1392 - 1401. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Palacios, E. T. Marusic, N. C. Lopez, M. Gonzalez, and L. Michea Estradiol-induced expression of Na+-K+-ATPase catalytic isoforms in rat arteries: gender differences in activity mediated by nitric oxide donors Am J Physiol Heart Circ Physiol, May 1, 2004; 286(5): H1793 - H1800. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Jiang, F. Akar, S. L. Cobbs, K. Lomashvilli, R. Lakkis, F. J. Gordon, R. L. Sutliff, and W. C. O'Neill Blood pressure regulates the activity and function of the Na-K-2Cl cotransporter in vascular smooth muscle Am J Physiol Heart Circ Physiol, April 1, 2004; 286(4): H1552 - H1557. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Hypertension Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2003 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |