Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 2003;41:1202-1211
Published online before print May 12, 2003, doi: 10.1161/01.HYP.0000072334.34433.17
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
41/6/1202    most recent
01.HYP.0000072334.34433.17v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sethi, A. A.
Right arrow Articles by Tybjærg-Hansen, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sethi, A. A.
Right arrow Articles by Tybjærg-Hansen, A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Related Collections
Right arrow Cerebrovascular disease/stroke
Right arrow Risk Factors
Right arrow Other hypertension
Right arrow Acute myocardial infarction
Right arrow Acute Cerebral Infarction
Right arrow Genetics of Stroke
Right arrow Epidemiology
Right arrow Genetics of cardiovascular disease

(Hypertension. 2003;41:1202.)
© 2003 American Heart Association, Inc.


Scientific Contributions

Angiotensinogen Single Nucleotide Polymorphisms, Elevated Blood Pressure, and Risk of Cardiovascular Disease

Amar A. Sethi; Børge G. Nordestgaard; Marie-Louise M. Grønholdt; Rolf Steffensen; Gorm Jensen; Anne Tybjærg-Hansen

From the Department of Clinical Biochemistry, Herlev University Hospital (A.A.S., B.G.N.); the Copenhagen City Heart Study, Bispebjerg University Hospital (B.G.N., G.J., A.T.-H.); the Department of Vascular Surgery, Gentofte University Hospital (M.-L.M.G.); the Department of Medicine B, Hillerød Hospital (R.S.); and the Department of Clinical Biochemistry, Rigshospitalet, Copenhagen University Hospital (A.T.-H.); Copenhagen, Denmark.

Correspondence to Anne Tybjærg-Hansen, MD, DMSc, Department of Clinical Biochemistry, KB3011, Rigshospitalet, Copenhagen University Hospital, Blegdamsvej 9, DK-2100 Copenhagen Ø, Denmark. E-mail at-h{at}rh.dk


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
In this study of 10 690 individuals, associations with elevated blood pressure, ischemic heart disease, and ischemic cerebrovascular disease were determined for two noncoding [A(-20)C, G(-6)A] and two coding (T174M, M235T) single nucleotide polymorphisms, analyzed alone and in combination (haplotypes). Participants from the general population with (n=4950) and without (n=4234) elevated blood pressure were compared (study 1), as were participants from the general population without ischemic heart disease and ischemic cerebrovascular disease (n=7965) and cases with either ischemic heart disease (n=1850, study 2) or ischemic cerebrovascular disease (n=848, study 3). Finally, 22-year follow-up of 9184 individuals from the general population examined risk of ischemic heart disease (study 4) and ischemic cerebrovascular disease (study 5). Individuals with -6AA, 174TT, or 235TT had plasma angiotensinogen levels increased by 80 ng/mL (P=0.01 and 0.05 for women and men) compared with individuals with -6GG, 174TT, or 235 MM. In women, this difference was associated with an odds ratio of elevated blood pressure of 1.25 (1.03 to 1.51), which increased to 1.63 (1.05 to 2.51) in postmenopausal women receiving hormone replacement therapy. The promoter single nucleotide polymorphisms alone or as haplotypes did not predict the continuous variables of systolic, diastolic, or pulse pressure in cross section or the risk of ischemic heart disease or ischemic cerebrovascular disease in either gender in case-control or prospective studies. Individuals with -6AA, 174TT, or 235TT in the angiotensinogen gene have increased plasma angiotensinogen levels and moderately increased risk of elevated blood pressure (women only) but unaltered blood pressure examined as a continuous variable and unaltered risk of ischemic heart disease and ischemic cerebrovascular disease.


Key Words: blood pressure • hypertension, genetic • cardiovascular diseases • cerebrovascular disorders


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Single nucleotide polymorphisms (SNPs) in the angiotensinogen gene have been associated with elevated angiotensinogen levels,1 elevated blood pressure,1 ischemic heart disease (IHD),2 and ischemic cerebrovascular disease (ICVD).3 In the Copenhagen City Heart Study,4 we have previously shown that the M235T SNP (T-allele) was associated with elevated plasma angiotensinogen levels in both genders and a 30% increased risk of elevated blood pressure in women homozygous for 235T. However, the risk of IHD and ICVD was not associated with variation in genotype.5

SNPs in the transcription factor binding region (-25 to -1) of the angiotensinogen gene promoter have been reported to affect gene expression.6–8 The -6A SNP has been associated with increased gene transcription,8,9 elevated blood pressure, and increased risk of IHD in some10–12 but not in all studies,13–15 whereas the -20C SNP has been associated with increased gene transcription, elevated angiotensinogen levels, and elevated blood pressure in one7 but not in other studies.1,10,15 These conflicting results may be due to small sample size in previous studies, which have included between 301 and 1232 participants.

Using Copenhagen City Heart Study control subjects (n=7965) and cases with IHD (n=1805) and with ICVD (n=848), we explored whether these promoter SNPs independently or in combination with the T174M and M235T SNPs as haplotypes predict systolic, diastolic, or pulse pressure in cross section, elevated blood pressure, IHD, or ICVD in 3 case-control studies, or IHD or ICVD in 2 prospective studies. Prospective analyses were also performed for different subtypes of these large entities, for example, myocardial infarction, angina pectoris, ischemic stroke, and transient ischemic attack.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Three case-control and two prospective studies in the ethnically homogenous Danish population were conducted (Figure I in an online supplement available at http://www.hypertensionaha.org). Study 1 compared individuals from the Copenhagen City Heart Study with (n=4950) and without elevated blood pressure (n=4234). In studies 2 and 3, individuals in the Copenhagen City Heart Study without IHD and ICVD (controls; n=7965) were compared with cases with either IHD (n=1805; study 2) or ICVD (n=848; study 3). Each of these case groups were a combination of cases from the Copenhagen City Heart Study and patients recruited at Copenhagen University Hospital. Studies 4 and 5 were conducted prospectively within the Copenhagen City Heart Study (n=9184). Incident IHD and ICVD cases were recorded in the follow-up period from 1976 through 1997 by reviewing the Danish National Hospital Discharge Register, the Danish National Register of Causes of Death, and medical records from hospitals and general practitioners.5,16 Individuals with IHD or ICVD diagnosed before entry into the Copenhagen City Heart Study were excluded in the analysis of IHD risk (n=15) and ICVD risk (n=31), respectively.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 1. Plasma angiotensinogen levels adjusted for age as a function of G(-6)A genotype (top) and G(-6)A and M235T genotype (bottom) are shown. Individuals taking medication known to affect blood pressure or taking estrogen or other hormones and individuals with suspected liver disease were excluded from analyses. All individuals carried 174TT.

The Copenhagen City Heart Study is a prospective cardiovascular population study recruiting participants randomly from the Danish Central Population Register to obtain a representative sample of the adult Danish general population.4,5,16 The Danish Ethics Committee for Copenhagen and Frederiksberg approved this study (No. 100.2039/91), and all subjects gave informed consent.

During 1991 to 1993, 992 patients from the greater Copenhagen area were referred to Copenhagen University Hospital, Rigshospitalet, for coronary angiography.5 The study was approved by the Danish Ethics Committees for Copenhagen County (No. KA93125). Similarly, we identified patients with ICVD among patients referred from 1994 to 1999 for outpatient ultrasonography of the carotid artery at Copenhagen University Hospital, Rigshospitalet.5 The study was approved by the Ethics Committee of Copenhagen and Frederiksberg (No. KF01–375/94, KF01–372/94).

DNA Analyses
The A(-20)C and G(-6)A promoter SNPs were diagnosed by PCR7,8: sense primer, 5'CTCTCCAGCCTGTGCACAG3'; antisense primer, 5'GACAAGACCAGAAGGAGCTGA3'. The PCR product (158 bp) was digested with either Eco0109I (A[-20]C), resulting in SNP-specific bands of 130 bp (A-allele) or 67 bp and 63 bp (C-allele) (common bands of 27 and 1 bp), or with MvaI (G[-6]A), resulting in SNP-specific bands of 133 bp (G-allele) or 78 bp and 55 bp (A-allele) (common band, 25 bp). Individuals with rare haplotypes were sequenced to confirm the diagnoses.

Other Analyses
Plasma angiotensinogen levels were measured in 174TT individuals from the Copenhagen City Heart Study, excluding individuals taking medication or with conditions that potentially affect angiotensinogen levels. Individuals with the genotype 174TT were selected because individuals with the haplotype 235T, 174T had higher risk of elevated blood pressure when compared with the haplotype 235M, 174T.4 Therefore, among the 6786 individuals homozygous for 174TT in our study population, we randomly selected 300 men and women (40 to 67 years old) distributed equally between the 2 genders and among homozygotes, heterozygotes, and noncarriers of M235T.

Elevated blood pressure was systolic blood pressure >=140 mm Hg and/or diastolic blood pressure >=90 mm Hg17 or treatment with antihypertensive medication. Stratification of elevated blood pressure into mild, moderate, and severe was as previously defined. Blood pressure was measured by trained technicians, using a London School of Hygiene sphygmomanometer on the left arm, after 5 minutes of rest, and with the subject in the sitting position.4

Haplotype Estimation and Linkage Disequilibrium
Previous information of linkage disequilibrium and observed haplotypes between T174M and M235T4 was used together with already published data about linkage disequilibrium between the four examined loci10 to propose the construction of observed haplotypes (Table 1). However, to get an objective and thus reliable estimation of haplotype constructions, we also used a linkage utility program (http://linkage.rockefeller.edu), which lists all possible haplotype combinations by frequency, reflecting their estimated probability in our study population. These estimations are based on genotype frequencies of each of the four polymorphisms and their pairwise linkage disequilibrium.18 In all our statistical analyses, we used the six most frequent haplotypes estimated by the linkage utility program (Table 1).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Observed and Estimated Haplotype Frequencies for A(-20)C, G(-6)A, T174M, and M235T SNPs in 9184 Individuals From the General Population

Pairwise linkage disequilibrium between the four angiotensinogen SNPs were tested by the linkage utility program, which for each pair of SNPs estimated allele and haplotype frequencies with and without allelic association. The pairwise linkage disequilibrium coefficient D was calculated as D=P11-p1q1, where P11 is the observed frequency of the 1/1 haplotype, p1 is the frequency of the "1" allele at locus 1 in the general population, and q1 is the population frequency of the "1" allele at locus 2.19 The "1" allele at each locus is defined as the most common of the alleles at that locus. The extent of disequilibrium was expressed as the D'=D/Dmax.20

Statistical Analyses
All statistical analyses were performed stratified by gender and with the use of the SPSS program. A 2-sided probability value <0.05 was considered significant.

ANOVA and a t test were used to examine continuous variables as a function of genotype or haplotype. Interaction between age, body mass index, alcohol consumption, and genotype or haplotype were examined by means of ANCOVA.

Risk of elevated blood pressure, IHD, and ICVD were examined by logistic regression analysis in age-adjusted, multifactorial-adjusted, and matched analyses.

Log-rank tests and Kaplan-Meier curves were used to examine prospective data. Cox regression analysis was used to calculate relative risks (95% CI) adjusted for age at entry into the Copenhagen City Heart Study.

An expanded Methods section can be found in an online supplement available at http://www.hypertensionaha.org.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Characteristics of participants in studies 1 to 5 are shown in Table 2. Table 3 shows relative genotype frequencies in the general population. Genotype frequencies did not differ significantly from those predicted by the Hardy-Weinberg equilibrium (A[-20]C, P>0.95; G[-6]A, P>0.30; T174M, P>0.95; M235T, P>0.70) and were similar to frequencies observed in other studies of whites.10,13,15 Relative allele frequencies of -20C and -6A in the general population were 0.16 and 0.40. Linkage disequilibrium was observed in all pairwise combinations of the four SNPs, A(-20)C, G(-6)A, T174M, and M235T ({chi}2 tests, P<0.000; Figure II in an online supplement available at http://www.hypertensionaha.org); the degree of linkage disequilibrium between the -6 and 235 loci was 98%.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Characteristics of Participants


View this table:
[in this window]
[in a new window]
 
TABLE 3. Genotype Frequencies in 9184 Individuals From the General Population



View larger version (23K):
[in this window]
[in a new window]
 
Figure 2. Systolic, diastolic, and pulse pressure as a function of angiotensinogen genotypes and haplotypes are shown. Mean±SEM values are shown for the A(-20)C (far left) and G(-6)A genotypes (left) Average haplotype effects are shown to the right. Broken lines show mean values for all women and men, respectively, in the general population. Individuals taking medications known to affect blood pressure (ie, antihypertensive medications or medication for angina pectoris, heart failure, or cardiac arrhythmias) were excluded from analyses. Probability values are for ANOVA; because all were nonsignificant, no post hoc 2-genotype comparisons were examined.

Table 1 shows observed and estimated haplotype frequencies for 16 possible haplotypes of the A(-20)C, G(-6)A, T174M, and M235T SNPs in 9184 individuals from the general population. Statistical analyses below are performed for the A(-20)C and G(-6)A SNPs alone and for the 6 most frequent haplotypes.

Plasma angiotensinogen levels were measured in 300 individuals from the general population in either gender.4 All of these 300 individuals were homozygous for 174T. Individuals on medications known to affect blood pressure or treated with estrogen or other hormones and individuals with suspected liver disease were excluded from the analyses. Plasma angiotensinogen levels were increased by {approx}80 ng/mL in women with -6AA versus -6GG and -6GA (P=0.03; P=0.04) (Figure 1). In men, the association was similar but nonsignificant. However, if individuals were double noncarrier, double heterozygous, or double homozygous for -6A and 235T, the overall association with angiotensinogen levels became significant in both genders (P=0.01 and P=0.05 in women and men, respectively) (Figure 1). Angiotensinogen levels did not vary as a function of A(-20)C genotype in either gender (data not shown).

Systolic, diastolic, or pulse pressure did not differ significantly as a function of genotype for the promoter SNPs or as a function of haplotypes in women or men (Figure 2). We did not find evidence for plausible interaction.

On logistic regression analysis adjusted for age, women with -6AA had an odds ratio for elevated blood pressure of 1.25 (95% CI, 1.03 to 1.51) compared with women with the -6GG genotype (Figure 3). In accordance with this, women carrying the AATT haplotypes of the -20, -6, 174, and 235 loci had an odds ratio for elevated blood pressure of 1.13 (1.02 to 1.26) compared with the AGTM haplotype (Figure 3). Similar odds ratios were found in multifactorial-adjusted analyses (data not shown) and in matched analyses in which each case was matched by gender, age, alcohol consumption, body mass index, and antihypertensive medication with one control (data not shown). In men, neither promoter genotype nor haplotypes could predict risk of elevated blood pressure in age-adjusted, multifactorial-adjusted, or matched analyses.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 3. Risk of elevated blood pressure as a function of A(-20)C and G(-6)A genotypes (top) and as a function of haplotypes (bottom), using logistic regression, are shown (study 1).

When analyzing data stratified by menopausal status and hormone replacement therapy, we found that the observed risk increment in women was confined to postmenopausal women receiving hormone replacement therapy carrying the -6AA genotype with an age-adjusted odds ratio for elevated blood pressure of 1.63 (1.05 to 2.51) when compared with women with the -6GG genotype (Figure 4). Correspondingly, postmenopausal women receiving hormone replacement therapy carrying the haplotype AATT had an odds ratio of elevated blood pressure of 1.35 (1.05 to 1.72) compared with the AGTM haplotype (Figure 4). We did not detect other plausible evidence for interaction.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 4. Risk of elevated blood pressure as a function of A(-20)C and G(-6)A genotypes (top) and as a function of haplotypes (bottom), using logistic regression, in women stratified for menopausal status and hormone replacement therapy, are shown.

Women homozygous for the -6AA had an odds ratio for mild elevated blood pressure of 1.33 (1.04 to 1.70) compared with women with the -6GG genotype (Figure 5). This was not found in men or for moderate or severe elevated blood pressure in either gender. In accordance with this finding, women carrying the haplotype AATT versus the AGTM haplotype had an odds ratio of 1.16 (1.00 to 1.33) for mild elevated blood pressure. Furthermore, when compared with the AGTM haplotype, women carrying the CAMT haplotype had an odds ratio for moderate elevated blood pressure of 1.36 (1.07 to 1.72) and an odds ratio for severe elevated blood pressure of 2.51 (1.11 to 5.67) if they carried the AGTT haplotype. This was not true for men.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 5. Risk of mild, moderate, and severe elevated blood pressure as a function of A(-20)C and G(-6)A genotypes (top) and as a function of haplotypes (bottom), using logistic regression, are shown (study 1). Individuals taking medications known to affect blood pressure (ie, antihypertensive medications or medication for angina pectoris, heart failure, or cardiac arrhythmias) were excluded from analyses.

Neither the A(-20)C and G(-6)A SNPs nor the haplotypes predicted risk of IHD or ICVD in age-adjusted case-control analyses in either gender (Figures 6 and 7Down). This was also true for multifactorial-adjusted and for matched analyses, in which each case was matched with two controls by gender, age, total cholesterol, elevated blood pressure, and smoking (data not shown). Although men heterozygous for G(-6)A had an apparently decreased risk of ICVD (odds ratio, 0.77; 95% CI, 0.62 to 0.95), this turned statistically insignificant in multifactorial-adjusted analysis (0.88; 0.69 to 1.12). Likewise, men heterozygous for A(-20)C also had a marginally decreased risk of ICVD (0.79; 0.63 to 0.99), which turned insignificant in multifactorial analysis (0.78; 0.60 to 1.02). No plausible significant interactions were found.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 6. Risk of IHD as a function of A(-20)C and G(-6)A genotypes (top) and as a function of haplotypes (bottom), using logistic regression, are shown (study 2).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 7. Risk of ICVD as a function of A(-20)C and G(-6)A genotypes (top) and as a function of haplotypes (bottom), using logistic regression, are shown (study 3).

The promoter SNPs alone or as haplotypes also could not predict risk of acute myocardial infarction (data not shown).

During 153 412 and 155 722 person-years, 847 and 407 IHD and ICVD events were observed in the Copenhagen City Heart Study, respectively. This results in an incidence rate of 55 IHD cases per 10 000 person-years and 26 ICVD cases per 10 000 person-years. The incidence of IHD and ICVD did not differ between A(-20)C and G(-6)A genotypes in either gender. This was also true for the subgroup analyses of myocardial infarction, angina pectoris, ischemic stroke, and transient ischemic attack (data not shown). Similarly, age-adjusted relative risks were nonsignificant for all comparisons between A(-20)C and G(-6)A genotypes for the large entities IHD and ICVD as well as for subgroup analyses of myocardial infarction, angina pectoris, ischemic stroke, and transient ischemic attack in both genders. Finally, incidence of IHD, ICVD, and for the different subgroups did not differ among the 6 common haplotypes, and we also did not observe any significant age-adjusted relative risk among haplotypes.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
In this study, we provide data suggesting that women and men with -6AA, 174TT, and 235TT (versus -6GG, 174TT, and 235 MM) in the angiotensinogen gene have increased plasma angiotensinogen levels. This difference was associated with a 63% increase in risk of elevated blood pressure (as a dichotomized variable) in postmenopausal women receiving hormone replacement therapy. In contrast, the -6A and -20C promoter SNPs alone or as haplotypes did not predict systolic or diastolic blood pressure (as a continuous variable), pulse pressure, or risk of IHD or ICVD in either gender.

Plasma Angiotensiongen Levels
Both women and men with -6AA, 174TT, and 235TT (versus -6GG, 174TT, and 235 MM) had higher angiotensinogen levels. A study in Japanese found no association between the promoter SNPs and plasma angiotensinogen levels.7 Possible explanations for this divergence could include that we only measured angiotensinogen levels in individuals homozygous for 174T and differences in allele frequencies and linkage disequilibrium caused by different ethnic backgrounds. However, our results are in accordance with previous findings that the -6A SNP affects basal transcription in vitro and is associated with increased transcription of the angiotensinogen gene.8

Although we did not observe an association between A(-20)C and plasma angiotensinogen levels, it is worth emphasizing that this SNP along with another promoter SNP, A(-217)G, have been suggested to affect basal promoter activity of the angiotensinogen gene.9,21 Therefore, we cannot exclude that the positive association observed with G(-6)A might also reflect the effect of other polymorphisms located in the regulatory region of the angiotensinogen gene.22

Blood Pressure as a Continuous Variable
None of the A(-20)C or G(-6)A genotypes and none of the haplotypes were associated with significant variation in systolic, diastolic, or pulse pressure in either gender. All individuals taking medications known to affect blood pressure were excluded in these analyses. Our finding is in accordance with previous studies showing no association of the G(-6)A SNP with interindividual variation in blood pressure levels.13 Similar results were previously found for 235T, which is in nearly complete linkage disequilibrium with -6A in our study.4 Although a Japanese study (n=274) showed a significant correlation between blood pressure increase and -6A,11 we were unable to replicate this in 7120 individuals. A possible explanation for this could be the large difference in allele frequencies of -6A between the Japanese (84%) and Danish populations (40%).

Blood Pressure as a Dichotomous Variable
Although a previous study of whites found an association between the G(-6)A SNP and elevated blood pressure,10 our study is the first to show that this association may be gender-specific, depending on menopausal status and hormone replacement therapy. Failure of previous gender-stratified studies13–15 to show an association may be due to small sample size and/or lack of stratification by gender. A(-20)C has previously been shown to modify an estrogen-responsive element located in the regulatory region of the angiotensinogen gene.9 Whether G(-6)A has a role to play in modifying the estrogen-responsive element is unknown, but others have shown that 235T, which is in complete linkage disequilibrium with -6A, is associated with greater stimulation of angiotensinogen secretion in plasma after estrogen administration in humans, suggesting an important role of exogenous estrogen administration.23 Thus, although the interactive relation between G(-6)A and A(-20)C on transcriptional regulation of the angiotensinogen gene remains to be examined, our data suggest that G(-6)A has an important role to play in postmenopausal women treated with hormone replacement therapy. Furthermore, the 235T genotype has been associated with preeclampsia and pregnancy-induced elevated blood pressure24 in the homozygote state; keeping in mind that -6A is in near complete (98%) linkage disequilibrium with 235T, this would appear to support our gender-specific finding. The absolute size of the association of genotype with angiotensinogen levels is very similar in women and men: {approx}80 ng/mL higher in -6A, 235T homozygotes compared with -6G, 235M. However, the mean angiotensinogen level in women and men in our study was 861 ng/mL and 811 ng/mL, respectively (P=0.007), suggesting that genotype might have an effect on risk of elevated blood pressure in women, but not in men.

That the increased risk for elevated blood pressure overall in women homozygous for -6AA was seen only in those with mild elevated blood pressure and not in those with moderate and severe elevated blood pressure could be due to the smaller sample size for the analyses of moderate and severe versus mild elevated blood pressure.

The significant findings for moderate elevated blood pressure and severe elevated blood pressure in women carrying the CAMT and AGTT haplotypes, respectively, could also be chance findings because of smaller sample sizes for these stratified analyses. In support of this interpretation, no previous reports have examined risk of elevated blood pressure stratified into mild, moderate, and severe elevated blood pressure for the angiotensinogen gene SNPs, and thus these results are not confirmed elsewhere.

Risk of IHD
Both case-control and prospective studies from the Copenhagen City Heart Study suggest that neither promoter SNPs alone nor haplotypes are associated with increased risk of IHD. A recent study including 614 cases and control subjects of both genders found an increased risk of coronary heart disease in individuals homozygous for -6A SNP on univariate analyses; however, this increase in risk disappeared when adjusted for classic risk factors.12

Risk of ICVD
Previous reports suggested local expression of the angiotensinogen gene and its transcription regulators in the brain25 and development of hypertension when the protein is overexpressed in the brain.26 Both case-control and prospective studies from the Copenhagen City Heart Study suggest that neither promoter SNPs alone nor haplotypes are associated with increased risk of ICVD. In the case-control studies, men heterozygous for G(-6)A and A(-20)C had decreased risk of ICVD when adjusted for age alone; however, these findings disappeared in the multifactorial analyses, were not observed in women, and could not be confirmed in the prospective studies and therefore suggest chance findings.

No previous reports of the promoter SNPs have explored risk of ICVD, but recently we published a report showing no association between the T174M and M235T angiotensinogen SNPs and ICVD.5 The current study is in agreement with our previous results, when keeping in mind that -6A is in 98% linkage disequilibrium with 235T in our sample.

Mechanism
The end product of the renin-angiotensin system, angiotensin II, may increase blood pressure by stimulating renal sodium reabsorption and vasoconstriction. Our results imply that since one of the promoter SNPs, G(-6)A, in the homozygous form is associated with a 10% increase ({approx}80 ng/mL) in plasma angiotensinogen levels, this higher throughput in the renin-angiotensin system raises angiotensin II levels and hence blood pressure. Our data suggest that this may be most pronounced in postmenopausal women receiving hormone replacement therapy. It is therefore tempting to speculate that chronic stimulation of the renin-angiotensin system by estrogen could result in different physiological responses, depending on the G(-6)A genotype. Although our results suggest that -6A and 235T in the homozygote state is associated with a moderately increased risk of elevated blood pressure, this association seems too weak to be detected as an increased risk of IHD or ICVD.

Limitations
Blood pressure was only measured once in our study sample. Since intraindividual variation in blood pressure may be considerable, we believe that this represents a limitation of our study. There are several possible explanations as to why there is no association with blood pressure as a continuous variable, whereas there is a moderate association with risk of dichotomized elevated blood pressure in women: (1) The finding for the dichotomous variable is a chance finding. However, the association between genotype and angiotensinogen levels was also most pronounced in women; furthermore, this finding has been confirmed in several other studies, including meta-analyses for the M235T SNP.27,28 (2) Misclassification of blood pressure as a dichotomous variable is probable among individuals with blood pressure {approx}140/90 mm Hg, the cutoff point; however, individuals with very high or very low blood pressure are less likely to be misclassified. In contrast to this, when exploring blood pressure as a continuous variable, misclassification will occur on all values. Although categorization of a continuous variable leads to loss of information, this is the only well-understood manner in which clinicians treat their patients. (3) The association between the SNP and the continuous variables of systolic and diastolic blood pressure could be so weak that only when combining these two variables into a dichotomous variable, one is able to demonstrate significant association with elevated blood pressure. Also important is the fact that people with clinically recognized hypertension, those who are treated for the condition, are excluded in the analysis of blood pressure as a continuous variable but included in the analysis of elevated blood pressure as a dichotomous variable.

Although genotype determination of T174M and M235T was made in the same PCR reaction enabling unequivocal haplotype determination for these two loci, our analyses of all 4 SNPs (A[-20]C, G[-6]A, T174M, and M235T] together naturally cannot be based on unequivocal but only on estimated haplotypes. All individuals can be classified uniquely in terms of his or her 4-loci genotype, but haplotype determination cannot be done uniquely in individuals heterozygous for more than one of the examined loci. These individuals present a difficulty, but omitting them from consideration in an analysis of linkage disequilibrium and haplotype estimation can lead to bias and loss of information for the considered test. Furthermore, it has been shown that exclusion of individuals in whom the phase cannot be uniquely determined a priori results in skewed information about linkage disequilibrium and hence haplotype frequencies.18 Therefore, a linkage utility program with maximum log likelihood methods that allow these individuals into the analyses was used by us to construct haplotypes used in statistical analyses.

When studying the average haplotype effects on blood pressure and cardiovascular disease, one must keep in mind that statistical analyses were based on each individual divided into two independent haplotypes, each with a set of covariates. This is controversial when adjusting for one or more risk factors in the statistical analyses; however, when confidence intervals were calculated by simple unadjusted {chi}2 estimation, confidence intervals were similar to those shown in Figures 3 through 7UpUpUpUp.

Perspectives
Although the individual risk associated with the two SNPs in homozygous women is {approx}30%, the attributable risk, that is, the fraction of elevated blood pressure in the population that can be attributed to these SNPs, is {approx}5% in our female population. This is due to the high prevalence of these alleles in the population and is comparable to the 6% fraction of ischemic heart disease attributable to diabetes mellitus. Future research should be directed toward other genes, because additional genetic factors besides the angiotensinogen gene must be taken into account in modulating risk of elevated blood pressure. This may allow us to define a subset of individuals in whom a special genotype combination is associated with increased risk or especially amenable to a specific kind of antihypertensive treatment.


*    Acknowledgments
 
This study was supported by the Danish Heart Foundation, the Danish Medical Research Council, University of Copenhagen, the European Organization for the Control of Circulatory Diseases, the Beckett Fund, Manufacturer Frands Køhler Nielsen and Wife’s Grant, and the King Christian the Xth Fund. We thank Marianne Lodahl for technical assistance.

Received September 20, 2002; first decision October 31, 2002; accepted April 7, 2003.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Jeunemaitre X, Soubrier F, Kotelevtsev YV, Lifton RP, Williams CS, Charru A, Hunt SC, Hopkins PN, Williams RR, Lalouel JM. Molecular basis of human hypertension: role of angiotensinogen. Cell. 1992; 71: 169–180.[CrossRef][Medline] [Order article via Infotrieve]

2. Katsuya T, Koike G, Yee TW, Sharpe N, Jackson R, Norton R, Horiuchi Pratt RE, Dzau VJ, MacMahon S. Association of angiotensinogen gene T235 variant with increased risk of coronary heart disease. Lancet. 1995; 345: 1600–1603.[CrossRef][Medline] [Order article via Infotrieve]

3. Nakata Y, Katsuya T, Rakugi H, Takami S, Sato N, Kamide K, Ohishi M, Miki T, Higaki J, Ogihara T. Polymorphism of angiotensin converting enzyme, angiotensinogen, and apolipoprotein E genes in a Japanese population with cerebrovascular disease. Am J Hypertens. 1997; 10: 1391–1395.[Medline] [Order article via Infotrieve]

4. Sethi AA, Nordestgaard BG, Agerholm-Larsen B, Frandsen E, Jensen G, Tybjaerg-Hansen A. Angiotensinogen polymorphisms and elevated blood pressure in the general population: the Copenhagen City Heart Study. Hypertension. 2001; 37: 875–881.[Abstract/Free Full Text]

5. Sethi AA, Tybjaerg-Hansen A, Gronholdt ML, Steffensen R, Schnohr P, Nordestgaard BG. Angiotensinogen mutations and risk for ischemic heart disease, myocardial infarction, and ischemic cerebrovascular disease: six case-control studies from the Copenhagen City Heart Study. Ann Intern Med. 2001; 134: 941–954.[Abstract/Free Full Text]

6. Yanai K, Saito T, Hirota K, Kobayashi H, Murakami K, Fukamizu A. Molecular variation of the human angiotensinogen core promoter element located between the TATA box and transcription initiation site affects its transcriptional activity. J Biol Chem. 1997; 272: 30558–30562.[Abstract/Free Full Text]

7. Ishigami T, Umemura S, Tamura K, Hibi K, Nyui N, Kihara M, Yabana M, Watanabe Y, Sumida Y, Nagahara T, Ochiai H, Ishii M. Essential hypertension and 5' upstream core promoter region of human angiotensinogen gene. Hypertension. 1997; 30: 1325–1330.[Abstract/Free Full Text]

8. Inoue I, Nakajima T, Williams CS, Quackenbush J, Puryear R, Powers M, Cheng T, Ludwig EH, Sharma AM, Hata A, Jeunemaitre X, Lalouel JM. A nucleotide substitution in the promoter of human angiotensinogen is associated with essential hypertension and affects basal transcription in vitro. J Clin Invest. 1997; 99: 1786–1797.[Medline] [Order article via Infotrieve]

9. Zhao YY, Zhou J, Narayanan CS, Cui Y, Kumar A. Role of C/A polymorphism at -20 on the expression of human angiotensinogen gene. Hypertension. 1999; 33: 108–115.[Abstract/Free Full Text]

10. Jeunemaitre X, Inoue I, Williams C, Charru A, Tichet J, Powers M, Sharma AM, Gimenez-Roqueplo AP, Hata A, Corvol P, Lalouel JM. Haplotypes of angiotensinogen in essential hypertension. Am J Hum Genet. 1997; 60: 1448–1460.[CrossRef][Medline] [Order article via Infotrieve]

11. Ishigami T, Tamura K, Fujita T, Kobayashi I, Hibi K, Kihara M, Toya Y, Ochiai H, Umemura S. Angiotensinogen gene polymorphism near transcription start site and blood pressure: role of a T-to-C transition at intron I. Hypertension. 1999; 34: 430–434.[Abstract/Free Full Text]

12. Rodriguez-Perez JC, Rodriguez-Esparragon F, Hernandez-Perera O, Anabitarte A, Losada A, Medina A, Hernandez E, Fiuza D, Avalos O, Yunis C, Ferrario CM. Association of angiotensinogen M235T and A(-6)G gene polymorphisms with coronary heart disease with independence of essential hypertension: the PROCAGENE study: Prospective Cardiac Gene. J Am Coll Cardiol. 2001; 37: 1536–1542.[Abstract/Free Full Text]

13. Province MA, Boerwinkle E, Chakravarti A, Cooper R, Fornage M, Leppert M, Risch N, Ranade K. Lack of association of the angiotensinogen-6 polymorphism with blood pressure levels in the comprehensive NHLBI Family Blood Pressure Program: National Heart, Lung and Blood Institute. J Hypertens. 2000; 18: 867–876.[CrossRef][Medline] [Order article via Infotrieve]

14. Rodriguez-Perez JC, Rodriguez-Esparragon FJ, Hernandez-Perera O, Fiuza-Perez MD, Anabitarte-Prieto A, Losada-Cabrera A. Effects of the angiotensinogen gene M235T and A(-6)G variants on blood pressure and other vascular risk factors in a Spanish population. J Hum Hypertens. 2000; 14: 789–793.[CrossRef][Medline] [Order article via Infotrieve]

15. Wang WY, Glenn CL, Zhang W, Benjafield AV, Nyholt DR, Morris BJ. Exclusion of angiotensinogen gene in molecular basis of human hypertension: sibpair linkage and association analyses in Australian anglo-caucasians. Am J Med Genet. 1999; 87: 53–60.[CrossRef][Medline] [Order article via Infotrieve]

16. Tybjaerg-Hansen A, Steffensen R, Meinertz H, Schnohr P, Nordestgaard BG. Association of mutations in the apolipoprotein B gene with hypercholesterolemia and the risk of ischemic heart disease. N Engl J Med. 1998; 338: 1577–1584.[Abstract/Free Full Text]

17. Guidelines Subcommittee. World Health Organization–International Society of Hypertension Guidelines for the Management of Hypertension. J Hypertens. 1999;1999: 17: 151–183.[Medline] [Order article via Infotrieve]

18. Terwilliger JD, Ott J. Linkage disequilibrium between alleles at marker loci. In: Handbook of Human Genetic Linkage. Baltimore, Md: Johns Hopkins University Press; 1994.

19. Haines JE, Pericak-Vance MA. Approaches to Gene Mapping in Complex Human Diseases. New York, NY: Wiley; 1998.

20. Thompson EA, Deeb S, Walker D, Motulsky AG. The detection of linkage disequilibrium between closely linked markers: RFLPs at the AI-CIII apolipoprotein genes. Am J Hum Genet. 1988; 42: 113–124.[Medline] [Order article via Infotrieve]

21. Jain S, Tang X, Chittampalli SN, Agarwal Y, Stephen MP, Clinton DB, Ott J, Kumar A. Angiotensinogen gene polymorphism at -217 affects basal promoter activity and is associated with hypertension in African-Americans. J Biol Chem. 2002; 39: 36889–36896.

22. Nakajima T, Jorde LB, Ishigami T, Umemura S, Emi M, Lalouel JM, Inoue I. Nucleotide diversity and haplotype structure of the human angiotensinogen gene in two populations. Am J Hum Genet. 2002; 70: 108–123.[CrossRef][Medline] [Order article via Infotrieve]

23. Azizi M, Hallouin MC, Jeunemaitre X, Guyene TT, Menard J. Influence of the M235T polymorphism of human angiotensinogen (AGT) on plasma AGT and renin concentrations after ethinylestradiol administration. J Clin Endocrinol Metab. 2000; 85: 4331–4337.[Abstract/Free Full Text]

24. Ward K, Hata A, Jeunemaitre X, Helin C, Nelson L, Namikawa C, Farrington PF, Ogasawara M, Suzumori K, Tomoda S. A molecular variant of angiotensinogen associated with preeclampsia. Nat Genet. 1993; 4: 59–61.[CrossRef][Medline] [Order article via Infotrieve]

25. Nishii T, Moriguchi A, Morishita R, Yamada K, Nakamura S, Tomita N, Kaneda Y, Fukamizu A, Mikami H, Higaki J, Ogihara T. Angiotensinogen gene-activating elements regulate blood pressure in the brain. Circ Res. 1999; 85: 257–263.[Abstract/Free Full Text]

26. Kimura S, Mullins JJ, Bunnemann B, Metzger R, Hilgenfeldt U, Zimmermann F, Jacob H, Fuxe K, Ganten D, Kaling M. High blood pressure in transgenic mice carrying the rat angiotensinogen gene. EMBO J. 1992; 11: 821–827.[Medline] [Order article via Infotrieve]

27. Kunz R, Kreutz R, Beige J, Distler A, Sharma AM. Association between the angiotensinogen 235T-variant and essential hypertension in whites: a systematic review and methodological appraisal. Hypertension. 1997; 30: 1331–1337.[Abstract/Free Full Text]

28. Staessen JA, Kuznetsova T, Wang JG, Emelianov D, Vlietinck R, Fagard R. M235T angiotensinogen gene polymorphism and cardiovascular renal risk. J Hypertens. 1999; 17: 9–17.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Nephrol Dial TransplantHome page
E. J. Hoorn, N. van der Lubbe, and R. Zietse
The renal WNK kinase pathway: a new link to hypertension
Nephrol. Dial. Transplant., April 1, 2009; 24(4): 1074 - 1077.
[Full Text] [PDF]


Home page
CirculationHome page
M.-Q. Xu, Z. Ye, F. B. Hu, and L. He
Quantitative Assessment of the Effect of Angiotensinogen Gene Polymorphisms on the Risk of Coronary Heart Disease
Circulation, September 18, 2007; 116(12): 1356 - 1366.
[Abstract] [Full Text] [PDF]


Home page
Am J EpidemiolHome page
K. D. Marciante, J. C. Bis, M. J. Rieder, A. P. Reiner, T. Lumley, S. A. Monks, C. Kooperberg, C. Carlson, S. R. Heckbert, and B. M. Psaty
Renin-Angiotensin System Haplotypes and the Risk of Myocardial Infarction and Stroke in Pharmacologically Treated Hypertensive Patients
Am. J. Epidemiol., July 1, 2007; 166(1): 19 - 27.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
A. Kretowski, K. McFann, J. E. Hokanson, D. Maahs, G. Kinney, J. K. Snell-Bergeon, R. P. Wadwa, R. H. Eckel, L. Ogden, S. Garg, et al.
Polymorphisms of the Renin-Angiotensin System Genes Predict Progression of Subclinical Coronary Atherosclerosis
Diabetes, March 1, 2007; 56(3): 863 - 871.
[Abstract] [Full Text] [PDF]


Home page
Journal of Renin-Angiotensin-Aldosterone SystemHome page
A. Reyes-Engel, L. Morcillo, F. J. Aranda, M. Ruiz, M. J. Gaitan, A. Mayor-Olea, P. Aranda, and C. M. Ferrario
Influence of Gender and Genetic Variability on Plasma Angiotensin Peptides
Journal of Renin-Angiotensin-Aldosterone System, June 1, 2006; 7(2): 92 - 97.
[Abstract] [PDF]


Home page
HypertensionHome page
F. C. Luft
Geneticism of Essential Hypertension
Hypertension, June 1, 2004; 43(6): 1155 - 1159.
[Full Text] [PDF]


Home page
Physiol. GenomicsHome page
S.-J. Wu, F.-T. Chiang, W. J. Chen, P.-H. Liu, K.-L. Hsu, J.-J. Hwang, L.-P. Lai, J.-L. Lin, C.-D. Tseng, and Y.-Z. Tseng
Three single-nucleotide polymorphisms of the angiotensinogen gene and susceptibility to hypertension: single locus genotype vs. haplotype analysis
Physiol Genomics, April 13, 2004; 17(2): 79 - 86.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
41/6/1202    most recent
01.HYP.0000072334.34433.17v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sethi, A. A.
Right arrow Articles by Tybjærg-Hansen, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sethi, A. A.
Right arrow Articles by Tybjærg-Hansen, A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Related Collections
Right arrow Cerebrovascular disease/stroke
Right arrow Risk Factors
Right arrow Other hypertension
Right arrow Acute myocardial infarction
Right arrow Acute Cerebral Infarction
Right arrow Genetics of Stroke
Right arrow Epidemiology
Right arrow Genetics of cardiovascular disease