Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 2003;42:297-303
Published online before print August 18, 2003, doi: 10.1161/01.HYP.0000088322.85804.96
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
42/3/297    most recent
01.HYP.0000088322.85804.96v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Harrap, S. B.
Right arrow Articles by Woodward, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harrap, S. B.
Right arrow Articles by Woodward, M.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*High Blood Pressure
Related Collections
Right arrow Cardiovascular Pharmacology
Right arrow Secondary prevention
Right arrow ACE/Angiotension receptors
Right arrow Cerebrovascular disease/stroke
Right arrow Clinical Studies
Right arrow Genetics of Stroke
Right arrow Other Stroke Treatment - Medical
Right arrow Genetics of cardiovascular disease

(Hypertension. 2003;42:297.)
© 2003 American Heart Association, Inc.


Scientific Contributions

The ACE Gene I/D Polymorphism Is Not Associated With the Blood Pressure and Cardiovascular Benefits of ACE Inhibition

Stephen B. Harrap; Christophe Tzourio; François Cambien; Odette Poirier; Segolene Raoux; John Chalmers; Neil Chapman; Samuel Colman; Solenn Leguennec; Stephen MacMahon; Bruce Neal; Takayoshi Ohkubo; Mark Woodward for the PROGRESS Collaborative Group*

From the Department of Physiology (S.B.H.), University of Melbourne, Melbourne, Australia; the National Institute of Health and Medical Research (C.T., S.L.), INSERM U360, Hopital de la Salpetriere, Paris, France; INSERM U525 (F.C., O.P., S.R.), Faculté de Médecine, Paris, France; and the Institute for International Health (J.C., N.C., S.C., S.M., B.N., T.O., M.W.), University of Sydney, Sydney, Australia.

Correspondence to Prof Stephen Harrap, Department of Physiology, Grattan Street, Parkville, VIC 3010, Australia. E-mail s.harrap{at}unimelb.edu.au


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowAppendix
down arrowReferences
 
The insertion/deletion (I/D) polymorphism of the angiotensin-converting enzyme (ACE) gene might have consequences for the risks of vascular diseases. We examined the ACE genotype and the effects of a perindopril-based blood pressure-lowering regimen on macrovascular events, dementia, and cognitive decline among hypertensive and nonhypertensive patients with a history of cerebrovascular disease. ACE I/D genotypes were measured in 5688 of 6105 individuals with previous stroke or transient ischemic attack who participated in the PROGRESS trial. The DD genotype was significantly (P<0.0001) less frequent in Asian subjects (Chinese and Japanese, 14.7%) than in non-Asian subjects (32.0%). Controlling for racial background, there were no associations between ACE genotypes and cerebrovascular disease history or cardiovascular risk factors, including baseline blood pressure. The ACE genotype was not associated with the long-term risks of stroke, cardiac events, mortality, dementia, or cognitive decline; neither did the ACE genotype predict the blood pressure reduction associated with the use of the ACE inhibitor perindopril. Similarly, there was no evidence that the ACE genotype modified the relative benefits of ACE inhibitor-based therapy over placebo. This study provides no evidence that in patients with cerebrovascular disease, knowledge of ACE genotype is useful for predicting either the risk of disease or the benefits of perindopril-based blood pressure-lowering treatment.


Key Words: genes • blood pressure • stroke • coronary disease • clinical trials


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowAppendix
down arrowReferences
 
Ischemic and hemorrhagic stroke and their associated risk factors show familial aggregation, such that the relative risk of stroke is approximately doubled in the presence of stroke in a first-degree relative.1 Genetic causes have been found for rare, specific cerebrovascular abnormalities.1 More generally, a recent genome scan identified a susceptibility locus for stroke on chromosome 5q12,2 and other studies have suggested candidate genes, including that encoding the angiotensin-converting enzyme (ACE).

Common variation in the ACE gene structure is defined by the insertion (I) or deletion (D) of 287 bp of nonsense DNA in intron 16, resulting in 3 genotypes (DD, ID, II). The ACE I/D polymorphism is presumed to be in linkage disequilibrium with functional variants that determine enzyme activity,3 such that the D allele is associated with increased ACE activity in white4 and Asian5,6 subjects. However, the I/D polymorphism does not appear to be associated with ACE activity in black subjects.7 Although the polymorphism is not associated with differences in plasma angiotensin II or aldosterone even in white subjects,8 changes in tissue ACE activity9 might be relevant to blood vessels and stroke.

Most studies of the ACE gene, blood pressure, and stroke have been neither large nor prospective, and the findings have been either inconclusive or conflicting. The Perindopril Protection Against Recurrent Stroke Study (PROGRESS) was a large-scale, randomized trial designed to determine the effects of an ACE inhibitor-based blood pressure-lowering regimen on the risks of major vascular events among individuals with a history of stroke or transient ischemic attack (TIA).10 There were substantial benefits of this regimen for the risk of stroke,10 and we report here the associations between the ACE gene I/D polymorphisms and blood pressure, the risk of vascular events, and the effects of study treatment on vascular events.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowAppendix
down arrowReferences
 
Study Design
The design of the PROGRESS study has been described in detail elsewhere.10 In brief, 6105 participants were recruited from 172 collaborating centers in 10 countries from Australasia, Europe, and Asia between 1995 and 1997. The institutional ethics committee of each collaborating center approved the trial and the genetic substudy, and all participants provided written, informed consent. Individuals were potentially eligible if they had a history of cerebrovascular disease (stroke or TIA, but not subarachnoid hemorrhage) within the previous 5 years and no clear indication for or contraindication to treatment with an ACE inhibitor. There were no blood pressure criteria for entry.

Potentially eligible individuals entered a 4-week, prerandomization run-in period, during which they received open-labeled perindopril (2 mg daily for 2 weeks, followed by 4 mg daily for another 2 weeks). Participants who tolerated and adhered to the run-in therapy with perindopril were randomly assigned, in a double-blind manner, to continued active treatment or matching placebo(s). Active treatment comprised a flexible treatment regimen based on perindopril (4 mg daily) in all participants, with the addition of indapamide (2.5 mg daily, or 2 mg daily in Japan) in those for whom the responsible study physician judged that there was no specific indication for nor contraindication to the use of a diuretic. Those participants assigned to placebo received 1 or 2 tablets identical in appearance to the active agent(s). All other aspects of medical care were left to the discretion of the responsible physician.

Data Collection and Follow-Up
Before randomization, information was collected about the history of vascular disease, vascular risk factors, and current medications. After randomization, participants were scheduled to be seen on 5 occasions in the first year and every 6 months thereafter until the end of the scheduled follow-up period or death. At each visit, blood pressure was measured in duplicate, to the nearest 2 mm Hg, by using a standard mercury sphygmomanometer.

Outcomes
In addition to blood pressure, outcomes for these analyses included major vascular events and cognitive decline, which were defined as follows: (1) fatal and nonfatal stroke, with separate classification of ischemic and hemorrhagic stroke subtypes; (2) major coronary heart disease, defined as nonfatal myocardial infarction or death due to coronary heart disease,11 with separate analyses of nonfatal myocardial infarction; (3) major vascular events, defined as a composite of nonfatal stroke, nonfatal myocardial infarction, or death due to any vascular cause (including sudden unexplained death); (4) mortality from any cause; (5) dementia, diagnosed according to DSM-IV criteria;12 and (6) cognitive decline, defined as a fall of at least 3 points in the Mini-Mental State Examination between baseline and final available assessment.12 An independent end-point adjudication committee, blinded to study treatment allocation, reviewed source documentation for all suspected strokes, myocardial infarctions, and all deaths during follow-up; a separate dementia adjudication committee reviewed all dementia assessments.12

DNA Analyses
Samples of venous blood were collected in EDTA for extraction of DNA from buffy coats by using a salting-out procedure. Genotyping of the ACE I/D polymorphism was performed after polymerase chain reaction amplification of the region encompassing the polymorphism with 3 primers, ACE3U (TCTCGATCTCCTGACCTCGTGATCC), ACE2L (CCCTTAGCTCACCTCTGCTTGTAAG), and ACE1U (CTGGAGACCACTCCCATCCTTTCTC), by hybridization with allele- specific oligonucleotides. The sequence of allele-specific oligonucleotide and assay conditions are available at the Internet address http://www.genecanvas.org/polymorphism.asp-pol=ACE_ID.htm.

Statistical Analysis
Baseline characteristics were compared between the 3 genotypes by {chi}2 tests and logistic regression (for categorical variables) or ANOVA and general linear models (for continuous variables). Hardy-Weinberg equilibrium was tested by {chi}2 tests. Differences between the 3 genotypes in the effects of active treatment on blood pressure were investigated by ANOVA (1) during the run-in phase of the trial, including all subsequently randomized patients with known genotype, comparing baseline with prerandomization blood pressure measurements; and (2) during the entire study period, including all randomized patients assigned to active treatment with known genotype, comparing baseline with final postrandomization blood pressure measurements. Average postrandomization differences in blood pressure between the randomized groups were also estimated by fitting linear mixed models, by using baseline and all available postrandomization blood pressure measurements with an interaction term to compare the effects in the 3 subgroups defined by genotype.

Longitudinal associations between ACE genotypes and events were investigated with the Cox proportional-hazards models for those outcomes for which a specific event date was available (all stroke and coronary outcomes) and logistic regression models for those outcomes for which a specific event date was not available (dementia and cognitive decline). Hazard ratios and odds ratios were calculated by using the II genotype as the reference group. All analyses were carried out first without adjustment and then with adjustment for potential confounding variables (treatment allocation, assignment to combination or single-drug therapy, Asian or non-Asian ethnicity).

The effects of randomized treatment on events for each individual genotype were also estimated by using Cox and logistic regression models. Because the overall effect of treatment on stroke was greater among participants treated with combination therapy than among those treated with single-drug therapy,10 treatment effects were standardized for the proportions of the study population for whom combination (58%) or single-drug (42%) therapy was planned by taking weighted averages of the estimates obtained for the 2 therapies. Homogeneity of the effects of treatment among different genotypes was tested by adding interaction terms to the relevant statistical models.13


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowAppendix
down arrowReferences
 
Study Population and Baseline Characteristics
A total of 6105 individuals were randomized into PROGRESS. The current analyses include the 5688 randomized participants for whom ACE I/D genotyping was successful: of these, 2828 were in the active treatment group and 2860 were in the placebo group. These 5688 participants were representative of the total study participants in terms of their principal sociodemographic and clinical characteristics.10

The 2132 Asian subjects (individuals recruited from the People’s Republic of China or Japan) were younger (60.9 vs 65.7 years), had a lower body mass index (24.6 vs 26.4 kg/m2), consumed less alcohol (18% vs 47%, >=1 U per week) were more likely to have a history of stroke (92% vs 79%, and less likely to have a history of TIA or amaurosis fugax (12% vs 29%) than the 3556 non-Asian participants (all P<0.0001). The DD genotype was also significantly (P<0.0001) less frequent in Asian subjects (II 41.0%, ID 44.3%, DD 14.7%) than in non-Asian subjects (II 21.2%, ID 46.8%, DD 32.0%), but in both groups, genotypes were in Hardy-Weinberg equilibrium. Therefore, Table 1 provides baseline characteristics by genotype in Asian and non-Asian subjects separately. There were no significant differences in any of the baseline variables listed in Table 1 between the 3 genotypes. In particular, there were no differences in baseline systolic or diastolic blood pressure levels between the 3 genotype groups. This was true overall and separately for males and females and for participants who were and were not taking blood pressure-lowering medications at study entry (data not shown). The proportions assigned to each randomized treatment and the proportions managed with combination compared with single-drug therapy were well balanced between the 3 genotypes (Table 1).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Baseline Characteristics of 5688 Genotyped Participants

Effects of ACE Genotype on Blood Pressure Reduction Achieved
During the 4-week run-in period, treatment with perindopril reduced the overall mean blood pressure from baseline to follow-up by 8.8/4.7 mm Hg (Table 2) among the randomized participants genotyped. The mean reduction in blood pressure during run-in did not differ between the 3 participant groups defined by each genotype (P>=0.30 for systolic and diastolic blood pressure). This was true in both males and females separately, those participants already taking blood pressure-lowering medication and those who were not, and in both Asian and non-Asian participants separately (data not shown). Similar analyses of the effects of perindopril± indapamide on blood pressure during the mean 3.9-year postrandomization phase in the 2828 actively treated participants showed a mean 14.4/7.4 mm Hg reduction in blood pressure from baseline to final assessment (Table 2). Once again, there was no evidence that the effects of treatment varied between the participant groups defined on the basis of genotypes (P>0.57 for systolic and diastolic blood pressure). Finally, among all 5688 randomized participants with known genotype, the average difference in blood pressure between randomized groups during follow-up was 9.2/4.0 mm Hg. There was no evidence of significant variation (P=0.19) in the corresponding estimates of the effects of treatment between groups defined by ACE genotype (II 9.1/4.1, ID 9.2/3.6, DD 9.2/4.6).


View this table:
[in this window]
[in a new window]
 
TABLE 2. ACE I/D Genotype and Blood Pressure Reduction Associated With Perindopril During the Run-In Phase (4 Weeks) Among All Participants and During the Entire Study, Including Run-In, Among Participants Assigned Active Treatment

Associations of ACE Genotypes With the Risk of Vascular Events
Three-way analyses of the ACE genotypes identified no significant associations of ACE genotype with major outcomes in either unadjusted or adjusted analyses (Table 3). Pairwise comparisons of ID and DD against the II reference group identified only small to moderate differences in the relative risks of events, with estimates of effect ranging between 0.70 (30% reduced risk) and 1.23 (23% increased risk) for the 9 outcomes. The only pairwise comparisons to provide statistically significant results were for the outcomes major vascular events and major coronary heart disease. In each case, the DD group had lower risks than the II group, although both were only borderline significant at the 5% level. There was no evidence that the associations of ACE genotype with the risks of vascular events were different between Asian and non-Asian participants (results not shown). No association between ACE genotype with the risks of vascular events were observed when the placebo group was considered alone (data not shown).


View this table:
[in this window]
[in a new window]
 
TABLE 3. Associations Between ACE I/D Genotypes and Risks of Stroke, Vascular Events, Mortality, Dementia, Cognitive Decline, and Disability

Associations of ACE Genotypes With the Effects of Active Treatment on the Risk of Vascular Events
The main study analyses showed overall beneficial effects of randomized treatment on the risks of all of the 8 outcomes studied here10–12 except for dementia, for which there was only a nonsignificant trend toward benefit.12 There was no evidence that the beneficial effects of study treatment observed overall varied between the 3 participant groups defined by genotype. Although the confidence intervals about the estimates for individual genotypes were generally wide, all estimates for all outcomes were suggestive of benefit, except for a slight and nonsignificantly increased risk of death among participants with the ID genotype (Table 4). However, neither for this nor for any other outcome was there any statistical evidence that the effects of treatment varied between ACE genotype subgroups (All P homogeneity >=0.18).


View this table:
[in this window]
[in a new window]
 
TABLE 4. Effect of Active Treatment on Risk of Stroke, Vascular Events, Mortality, Dementia, Cognitive Decline, and Disability by ACE I/D Genotypes


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowAppendix
down arrowReferences
 
The PROGRESS study clearly demonstrated that among individuals with previous stroke or TIA, a perindopril-based blood pressure-lowering regimen reduced blood pressure and the risks of stroke, coronary heart disease, and cognitive decline.10–12 Although the activity of the ACE enzyme is to a significant extent determined by the ACE genotype in Asian5,6 and white4,8,9 subjects, we could find no evidence of any association between the ACE I/D genotypes and the effects of the ACE inhibitor on study outcomes.

There is little evidence that ACE genotype is a major determinant of hypertension14 or blood pressure variation,8 and this was confirmed by the PROGRESS study. Despite the large size of the study and the precise estimates of blood pressure levels afforded, there were no identifiable associations of ACE genotype with baseline blood pressure levels. Similarly, although there has been debate as to whether ACE genotype might influence the reduction in blood pressure achieved with ACE inhibitor therapy,15–18 the PROGRESS study provides no evidence to support this hypothesis. In PROGRESS, the estimates of treatment effect obtained for each genotype were very precise and provided extremely good statistical power to detect, with 90% power, a difference in blood pressure reduction (last recorded minus baseline reading) of 3.5, 2.5, and 3.2 mm Hg. Moreover, the ACE genotype was not useful in predicting the significant falls in systolic and diastolic pressures during the 4-week run-in phase, during which all patients were exposed to perindopril, or among the 2828 of these patients assigned to active perindopril-based treatment during the approximate 4-year follow-up period. This was so, whether or not patients were receiving other (non-ACE inhibitor) antihypertensive therapy at the time. Nor was there any association between ACE genotypes and the mean postrandomization differences in blood pressure between participants assigned to active treatment and those assigned to placebo.

Although no association between ACE genotype and blood pressure could be identified, it remained possible that postulated blood pressure-independent effects of ACE inhibition might be associated with the ACE genotype. We were able to test for longitudinal associations between ACE genotypes and the incidence of predefined cerebrovascular outcomes. There was no evidence that the likelihood of a recurrent stroke (total, ischemic, or hemorrhagic) was any different for those with a particular ACE genotype. In PROGRESS, the estimates of treatment effect obtained for each genotype were precise; we had sufficient numbers to detect, with 90% power, relative risk reductions of 41%, 29%, and 35% (for DD, ID, and II, respectively) for stroke and of 35%, 23%, and 29% for major vascular disease. Although some studies suggested associations between the ACE D allele and increased carotid intima-medial thickness,19 carotid plaque,20 carotid stenosis,21 and ischemic stroke,22 the findings of PROGRESS confirm other negative association analyses.23–26

Patients with cerebrovascular disease, though at very high risk of stroke, also have substantially elevated risks of myocardial infarction and other cardiac events.27 In the PROGRESS study, 150 incident cases of nonfatal myocardial infarction and a total of 255 major coronary events were observed in the genotyped subjects. Earlier reports of the association of ACE genotype with myocardial infarction were somewhat variable,28 and in PROGRESS, there was no overall association between these events and ACE genotype. Pairwise comparisons did identify participants with the ACE DD genotype as being at slightly lesser risk of major coronary events and major vascular events compared with those with the ACE II genotype, although these differences were of borderline significance.

Prior studies had also suggested that the ACE gene might contribute to complications of cerebrovascular disease, such as vascular dementia,29 and the ACE gene has been associated with both cognitive decline30 and Alzheimer’s disease.31 In the PROGRESS study, careful assessment of cognitive function12 identified several hundred patients who developed dementia and more with cognitive decline. However, there was no evidence that the likelihood of these events occurring during follow-up was associated with the ACE genotype. It has also been suggested that the ACE DD genotype might be associated with increased overall death rate.32 However, in PROGRESS, rates of death during the 4-year follow-up were no more common in one ACE genotype group than any other. Finally, we could find no evidence that the demonstrated beneficial effects of perindopril-based therapy on cerebrovascular events, coronary events, and measures of cognitive function were influenced significantly by ACE genotype.

The PROGRESS study selected individuals based on preexisting cerebrovascular disease, and there is therefore some uncertainty about the applicability of the findings of this study to the association between ACE genotype and risk among individuals without established disease. However, the findings concur with the prospective analyses of the 348 primary strokes observed over 12 years in the Physicians’ Health Study,26 suggesting that the absence of association may be consistent across both first and recurrent events and not a specific feature of this patient group.

Perspectives
These analyses of PROGRESS are among the most comprehensive assessment of the effects of ACE genotype on outcome to date. The ACE gene I/D polymorphisms do not appear to translate into significant phenotypic effects of ACE inhibitor treatment. These genotype analyses of PROGRESS provide no rationale for using ACE genotype to guide treatment decisions or to provide prognostic information relevant to cerebrovascular, cardiovascular, or cognitive function end points.


*    Appendix
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*Appendix
down arrowReferences
 
PROGRESS Collaborative Group
A complete list is given in Reference 10. Management Committee: John Chalmers (coprincipal investigator), Stephen MacMahon (coprincipal investigator), Craig Anderson, Marie-Germaine Bousser, Jeffrey Cutler, Stephen Davis, Geoffrey Donnan, Lennart Hansson (deceased), Stephen Harrap, Kennedy Lees, Liu Lisheng, Giuseppi Mancia, Bruce Neal, Teruo Omae, John Reid, Anthony Rodgers, Roberto Sega, Andreas Terent, Christophe Tzourio, Charles Warlow, and Mark Woodward. End-point Adjudication Committee: Geoffrey Donnan (chair), Neil Anderson, Christopher Bladin, Brian Chambers, Gary Gordon, and Norman Sharpe. Dementia Adjudication Committee: Craig Anderson and Yogini Ratnasabapathy. Data Monitoring Committee: Rory Collins (chair), Peter Sandercock, John Simes, and Peter Sleight. Statistical Analysis: Samuel Colman, Lesley Francis, Arier Lee, and Mark Woodward.


*    Acknowledgments
 
PROGRESS was funded by grants from Servier, the Health Research Council of New Zealand, and the National Health and Medical Research Council of Australia. The study was designed, conducted, analyzed, and interpreted by the investigators, independent of all sponsors.


*    Footnotes
 
*Members of the PROGRESS Collaborative Group are listed in the Appendix. Back

Received June 3, 2003; first decision June 23, 2003; accepted July 16, 2003.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
up arrowAppendix
*References
 
1. Hademenos GJ, Alberts MJ, Awad I, Mayberg M, Shepard T, Jagoda A, Latchaw RE, Todd HW, Viste K, Starke R, Girgus MS, Marler J, Emr M, Hart N. Advances in the genetics of cerebrovascular disease and stroke. Neurology. 2001; 56: 997–1008.[Abstract/Free Full Text]

2. Gretarsdottir S, Sveinbjornsdottir S, Jonsson HH, Jakobsson F, Einarsdottir E, Agnarsson U, Shkolny D, Einarsson G, Gudjonsdottir HM, Valdimarsson EM, Einarsson OB, Thorgeirsson G, Hadzic R, Jonsdottir S, Reynisdottir ST, Bjarnadottir SM, Gudmundsdottir T, Gudlaugsdottir GJ, Gill R, Lindpaintner K, Sainz J, Hannesson HH, Sigurdsson GT, Frigge ML, Kong A, Gudnason V, Stefansson K, Gulcher JR. Localization of a susceptibility gene for common forms of stroke to 5q12. Am J Hum Genet. 2002; 70: 593–603.[CrossRef][Medline] [Order article via Infotrieve]

3. Zhu X, McKenzie CA, Forrester T, Nickerson DA, Broeckel U, Schunkert H, Doering A, Jacob HJ, Cooper RS, Rieder MJ. Localization of a small genomic region associated with elevated ACE. Am J Hum Genet. 2000; 67: 1144–1153.[Medline] [Order article via Infotrieve]

4. Rigat B, Hubert C, Alhenc-Gelas F, Cambien F, Corvol P, Soubrier F. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest. 1990; 86: 1343–1346.[Medline] [Order article via Infotrieve]

5. Nakai K, Itoh C, Miura Y, Hotta K, Musha T, Itoh T, Miyakawa T, Iwasaki R, Hiramori K. Deletion polymorphism of the angiotensin I-converting enzyme gene is associated with serum ACE concentration and increased risk for CAD in the Japanese. Circulation. 1994; 90: 2199–2202.[Abstract/Free Full Text]

6. Chiang FT, Lai ZP, Chern TH, Tseng CD, Hsu KL, Lo HM, Tseng YZ. Lack of association of the angiotensin converting enzyme polymorphism with essential hypertension in a Chinese population. Am J Hypertens. 1997; 10: 197–201.[CrossRef][Medline] [Order article via Infotrieve]

7. Bloem LJ, Manatunga AK, Pratt JH. Racial difference in the relationship of an angiotensin I-converting enzyme gene polymorphism to serum angiotensin I-converting enzyme activity. Hypertension. 1996; 27: 62–66.[Abstract/Free Full Text]

8. Harrap SB, Davidson R, Connor JM, Soubrier F, Corvol P, Fraser R, Foy CJW, Watt GCM. The angiotensin I-converting enzyme gene and predisposition to high blood pressure in man. Hypertension. 1993; 21: 455–460.[Abstract/Free Full Text]

9. Danser AH, Schalekamp MA, Bax WA, van den Brink AM, Saxena PR, Riegger GA, Schunkert H. Angiotensin-converting enzyme in the human heart: effect of the deletion/insertion polymorphism. Circulation. 1995; 92: 1387–1388.[Abstract/Free Full Text]

10. PROGRESS Collaborative Group. Randomised trial of a perindopril-based blood pressure lowering regimen among 6,105 individuals with previous stroke or transient ischaemic attack. Lancet. 2001; 358: 1033–1041.[CrossRef][Medline] [Order article via Infotrieve]

11. PROGRESS Collaborative Group. Effects of a perindopril-based blood pressure lowering regimen on cardiac outcomes among patients with cerebrovascular disease. Eur Heart J. 2003; 24: 475–484.[Abstract/Free Full Text]

12. PROGRESS Collaborative Group. Effects of blood pressure lowering with perindopril on dementia and cognitive decline in patients with cerebrovascular disease. Arch Intern Med. 2003; 163: 1069–1075.[Abstract/Free Full Text]

13. Woodward M. Epidemiology: Study Design and Data Analysis. Boca Raton, Fla: Chapman and Hall/CRC Press; 1999.

14. Jeunemaitre X, Lifton RP, Hunt SC, Williams RR, Lalouel JM. Absence of linkage between the angiotensin converting enzyme locus and human essential hypertension. Nat Genet. 1992; 1: 72–75.[CrossRef][Medline] [Order article via Infotrieve]

15. Ha SK, Yong Lee S, Su Park H, Ho Shin J, Jung Kim S, Hun Kim D, Rae Kim K, Yung Lee H, Suk Han D. ACE DD genotype is more susceptible than ACE II and ID genotypes to the antiproteinuric effect of ACE inhibitors in patients with proteinuric non-insulin-dependent diabetes mellitus. Nephrol Dialysis Transplant. 2000; 15: 1617–1623.[Abstract/Free Full Text]

16. Todd GP, Chadwick IG, Higgins KS, Yeo WW, Jackson PR, Ramsay LE. Relation between changes in blood pressure and serum ACE activity after a single dose of enalapril and ACE genotype in healthy subjects. Br J Clin Pharmacol. 1995; 39: 131–134.[Medline] [Order article via Infotrieve]

17. Stavroulakis GA, Makris TK, Krespi PG, Hatzizacharias AN, Gialeraki AE, Anastasiadis G, Triposkiadis P, Kyriakidis M. Predicting response to chronic antihypertensive treatment with fosinopril: the role of angiotensin-converting enzyme gene polymorphism. Cardiovasc Drugs Ther. 2000; 14: 427–432.[CrossRef][Medline] [Order article via Infotrieve]

18. Dudley C, Keavney B, Casadei B, Conway J, Bird R, Ratcliffe P. Prediction of patient responses to antihypertensive drugs using genetic polymorphisms: investigation of renin-angiotensin system genes. J Hypertens. 1996; 14: 259–262.[CrossRef][Medline] [Order article via Infotrieve]

19. Kauma H, Paivansalo M, Savolainen MJ, Rantala AO, Kiema TR, Lilja M, Reunanen A, Kesaniemi YA. Association between angiotensin converting enzyme gene polymorphism and carotid atherosclerosis. J Hypertens. 1996; 14: 1183–1187.[Medline] [Order article via Infotrieve]

20. Watanabe Y, Ishigami T, Kawano Y, Umahara T, Nakamori A, Mizushima S, Hibi K, Kobayashi I, Tamura K, Ochiai H, Umemura S, Ishii M. Angiotensin-converting enzyme gene I/D polymorphism and carotid plaques in Japanese. Hypertension. 1997; 30: 569–573.[Abstract/Free Full Text]

21. Pfohl M, Fetter M, Koch M, Barth CM, Rudiger W, Haring HU. Association between angiotensin I-converting enzyme genotypes, extracranial artery stenosis, and stroke. Atherosclerosis. 1998; 140: 161–166.[CrossRef][Medline] [Order article via Infotrieve]

22. Margaglione M, Celentano E, Grandone E, Vecchione G, Cappucci G, Giuliani N, Colaizzo D, Panico S, Mancini FP, Di Minno G. Deletion polymorphism in the angiotensin-converting enzyme gene in patients with a history of ischemic stroke. Arterioscler Thromb Vasc Biol. 1996; 16: 304–309.[Abstract/Free Full Text]

23. Hung J, McQuillan BM, Nidorf M, Thompson PL, Beilby JP. Angiotensin-converting enzyme gene polymorphism and carotid wall thickening in a community population. Arterioscler Thromb Vasc Biol. 1999; 19: 1969–1974.[Abstract/Free Full Text]

24. Arnett DK, Borecki IB, Ludwig EH, Pankow JS, Myers R, Evans G, Folsom AR, Heiss G, Higgins M. Angiotensinogen and angiotensin converting enzyme genotypes and carotid atherosclerosis: the atherosclerosis risk in communities and the NHLBI family heart studies. Atherosclerosis. 1998; 138: 111–116.[CrossRef][Medline] [Order article via Infotrieve]

25. Ueda S, Weir CJ, Inglis GC, Murray GD, Muir KW, Lees KR. Lack of association between angiotensin converting enzyme gene insertion/deletion polymorphism and stroke. J Hypertens. 1995; 13: 1597–1601.[Medline] [Order article via Infotrieve]

26. Zee RY, Ridker PM, Stampfer MJ, Hennekens CH, Lindpaintner K. Prospective evaluation of the angiotensin-converting enzyme insertion/deletion polymorphism and the risk of stroke. Circulation. 1999; 99: 340–343.[Abstract/Free Full Text]

27. Hartmann A, Rundek T, Mast H, Mohr JP. Mortality and causes of death after first ischaemic stroke: the Northern Manhattan Stroke Study. Neurology. 2001; 57: 2000–2005.[Abstract/Free Full Text]

28. Butler R. The DD-ACE genotype and cardiovascular disease. Pharmacogenomics. 2000; 1: 153–167.[CrossRef][Medline] [Order article via Infotrieve]

29. Zuliani G, Zanca R, Ble A, Munari MP, Zurlo A, Vavalle C. Factors associated with dementia in subjects with cerebrovascular disease. Archiv Gerontol Geriatr. 2001; 33 (suppl 1): 443–451.[CrossRef]

30. Richard F, Berr C, Amant C, Helbecque N, Amouyel P, Alperovitch A. Effect of the angiotensin I-converting enzyme I/D polymorphism on cognitive decline: the EVA Study Group. Neurobiol Aging. 2000; 21: 75–80.[Medline] [Order article via Infotrieve]

31. Narain Y, Yip A, Murphy T, Brayne C, Easton D, Evans JG, Xuereb J, Cairns N, Esiri MM, Furlong RA. Rubinsztein DC. The ACE gene and Alzheimer’s disease susceptibility. J Med Genet. 2000; 37: 695–697.[Abstract/Free Full Text]

32. Morris BJ, Zee RY, Schrader AP. Different frequencies of angiotensin-converting enzyme genotypes in older hypertensive individuals. J Clin Invest. 1994; 94: 1085–1089.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Nephrol Dial TransplantHome page
E. J. Hoorn, N. van der Lubbe, and R. Zietse
The renal WNK kinase pathway: a new link to hypertension
Nephrol. Dial. Transplant., April 1, 2009; 24(4): 1074 - 1077.
[Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
D. Rosskopf and M. C. Michel
Pharmacogenomics of G Protein-Coupled Receptor Ligands in Cardiovascular Medicine
Pharmacol. Rev., December 1, 2008; 60(4): 513 - 535.
[Abstract] [Full Text] [PDF]


Home page
Journal of Pharmacy PracticeHome page
K. M. Momary
Cardiovascular Pharmacogenomics
Journal of Pharmacy Practice, June 1, 2007; 20(3): 265 - 276.
[Abstract] [PDF]


Home page
HypertensionHome page
D. Gu, S. Su, D. Ge, S. Chen, J. Huang, B. Li, R. Chen, and B. Qiang
Association Study With 33 Single-Nucleotide Polymorphisms in 11 Candidate Genes for Hypertension in Chinese
Hypertension, June 1, 2006; 47(6): 1147 - 1154.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
S. Padmanabhan, C. Wallace, P. B. Munroe, R. Dobson, M. Brown, N. Samani, D. Clayton, M. Farrall, J. Webster, M. Lathrop, et al.
Chromosome 2p Shows Significant Linkage to Antihypertensive Response in the British Genetics of Hypertension Study
Hypertension, March 1, 2006; 47(3): 603 - 608.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
D. K. Arnett, B. R. Davis, C. E. Ford, E. Boerwinkle, C. Leiendecker-Foster, M. B. Miller, H. Black, and J. H. Eckfeldt
Pharmacogenetic Association of the Angiotensin-Converting Enzyme Insertion/Deletion Polymorphism on Blood Pressure and Cardiovascular Risk in Relation to Antihypertensive Treatment: The Genetics of Hypertension-Associated Treatment (GenHAT) Study
Circulation, June 28, 2005; 111(25): 3374 - 3383.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
Y. Wang, M. C.Y. Ng, W. Y. So, P. C.Y. Tong, R. C.W. Ma, C. C. Chow, C. S. Cockram, and J. C.N. Chan
Prognostic Effect of Insertion/Deletion Polymorphism of the ACE Gene on Renal and Cardiovascular Clinical Outcomes in Chinese Patients With Type 2 Diabetes
Diabetes Care, February 1, 2005; 28(2): 348 - 354.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
F. C. Luft
Geneticism of Essential Hypertension
Hypertension, June 1, 2004; 43(6): 1155 - 1159.
[Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
T. Ohkubo, N. Chapman, B. Neal, M. Woodward, T. Omae, and J. Chalmers
Effects of an Angiotensin-converting Enzyme Inhibitor-based Regimen on Pneumonia Risk
Am. J. Respir. Crit. Care Med., May 1, 2004; 169(9): 1041 - 1045.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
42/3/297    most recent
01.HYP.0000088322.85804.96v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Harrap, S. B.
Right arrow Articles by Woodward, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harrap, S. B.
Right arrow Articles by Woodward, M.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*High Blood Pressure
Related Collections
Right arrow Cardiovascular Pharmacology
Right arrow Secondary prevention
Right arrow ACE/Angiotension receptors
Right arrow Cerebrovascular disease/stroke
Right arrow Clinical Studies
Right arrow Genetics of Stroke
Right arrow Other Stroke Treatment - Medical
Right arrow Genetics of cardiovascular disease