Published online before print August 25, 2003, doi: 10.1161/01.HYP.0000087839.72582.DD
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Hypertension. 2003;42:335.)
© 2003 American Heart Association, Inc.
Scientific Contributions |
Glucose-Induced TGF-ß1 and TGF-ß Receptor-1 Expression in Vascular Smooth Muscle Cells Is Mediated by Protein Kinase C-
From the Department of Nephrology, Medical School Hannover (C.L., P.Q., J.M., F.G., A.F., H.H.), Hannover; the Max-Planck Institute for Experimental Endocrinology (M.L.), Hannover; and Helios-Klinikum, Franz Volhard Clinic, and the Max Delbrück Center for Molecular Medicine (F.C.L.), Medical Faculty of the Charité, Humboldt University of Berlin, Berlin, Germany.
Correspondence to Hermann Haller, MD, Department of Nephrology, OE 6840, Medizinische Hochschule Hannover, Carl-Neuberg-Strasse 1, D-30625 Hannover, Germany. E-mail haller.hermann{at}mh-hannover.de
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Sclerosis and increased matrix expression in diabetes are mediated by glucose-induced transforming growth factor (TGF)-ß1 expression. The intracellular effects of high glucose occur at least in part by way of protein kinase C (PKC). We previously described a role for PKC-
in glucose-induced permeability. We now investigated the hypothesis that glucose-induced expression of TGF-ß1 and its receptors (TGF-ß-R1 and -R2) are mediated by activation of this PKC isoform. TGF-ß1 and TGF-ß-R expressions were determined in vascular smooth muscle cells (VSMCs) by immunocytochemistry and Western blotting. PKC isoforms were assessed by confocal microscopy. PKC isoforms were inhibited with antisense oligodeoxynucleotides. PKC- was upregulated by overexpression or microinjection. High glucose (20 mmol/L) increased VSMC TGF-ß1 and TGF-ß-R1 expression but not TGF-ß-R2 expression. PKC inhibitors and specific PKC- downregulation by antisense treatment prevented this effect, whereas antisense treatment against PKC-ß, -
, and -
had no influence. PKC- overexpression increased TGF-ß1 and TGF-ß-R1 expression but not TGF-ß-R2 expression. PKC- microinjection into individual VSMCs also increased TGF-ß1 and TGF-ß-R immunofluorescence. Last, VSMCs from PKC--deficient mice did not respond to high glucose compared with VSMCs from wild-type mice. We propose that high glucose-induced TGF-ß1 and TGF-ß-R1 expression is mediated by PKC-. Our findings suggest an autocrine feedback mechanism and a possible role for PKC- in diabetic vascular disease.
Key Words: glucose • growth substances • protein kinases • diabetes • muscle, vascular, smooth • atherosclerosis
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Renal hypertrophy, basement membrane thickening, and extracellular matrix accumulation characterize diabetic nephropathy.1 Several cytokines with fibrogenic potential contribute to this, particularly transforming growth factor (TGF)-ß1.2 TGF-ß1 increases matrix synthesis, inhibits matrix degradation, upregulates adhesion molecules, and enhances chemoattraction.3,4 The possible importance of TGF-ß1 in diabetic nephropathy has been demonstrated in vitro by glucose-induced upregulation of this cytokine in different cell types.5–13 Increased TGF-ß1 expression has also been demonstrated in diabetic animal models and human patients.14,15 TGF-ß binds specific serine/threonine kinase type I and type II receptors. The receptors form heteromeric cell surface complexes with TGF-ß.16,17 The type II receptor determines ligand specificity, whereas the type I receptor interacts with the type II receptor and might not have a specific ligand. The type II receptor, likely in conjunction with the type I receptor, is probably required for the antiproliferative effect, whereas the type I receptor is the probable mediator of extracellular gene expression.16,17 High glucose upregulates TGF-ß1 receptors in vitro and in vivo.18,19 Hyperglycemia might mediate the effect of protein kinase C (PKC) activation.20–24 PKC consists of several isoforms with distinct cellular functions and different expression patterns.25 Inoguchi and coworkers26 observed increased PKC-ßII expression in diabetic animals and hypothesized that this isoform is responsible for the glucose-induced effects. Further evidence for this hypothesis stems from a report that a specific PKC-ß inhibitor ameliorates hyperglycemia-induced vascular changes.27,28 However, PKC-ß might not be expressed in all vascular cell types. We detected no PKC-ß expression in endothelial cells, even though these cells respond to changes in extracellular glucose concentration.29 In addition, we reported that high glucose increases endothelial cell permeability via PKC-
and that PKC- is important in vascular smooth muscle cell (VSMC) differentiation.30,31 We now tested whether or not PKC- mediates glucose-related effects on TGF-ß1 and its receptors. |
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
All other materials, if not stated otherwise, were purchased from Sigma. Antibodies against PKC isoforms were obtained from Transduction Laboratories; against TGF-ß1, from Promega; against TGF-ß receptors, from Santa Cruz Biotech; and secondary Cy-labeled antibodies, from Dianova. Cell culture media and supplies were purchased from Seromed.
VSMC Techniques
Rat aortic VSMCs were prepared from rat aorta and cultured as previously published.31,32 The phenotype of the cultured VSMCs was determined by staining the cells for -actin and desmin. Antibodies for muscle-specific -actin and desmin were obtained from Boehringer-Mannheim. The techniques for immunoblotting have been described.31 The final incubation was carried out with a Cy5- or horseradish peroxidase-labeled goat anti-rabbit or anti-mouse antibody (Dianova) in buffer for >2 hours. After they were rinsed and washed as described earlier, the blots were analyzed on a fluorescence imager (STORM, Molecular Dynamics) or by chemiluminescence (Renaissance).
Immunocytochemistry and confocal microscopy were performed as described earlier.31 For microscopy, the preparation was mounted with mounting medium (Aqua Polymount, Polyscience) under a glass coverslip and analyzed with a Nikon-Diaphot microscope. A confocal imaging system (Bio-Rad MRC 1024, Bio-Rad Laboratories) with a UV source and an argon/krypton laser was used. At least 30 cells from each of at least 3 independent experiments were examined under each experimental condition. For each set of experiments, identical settings for power of the light source, confocal aperture, gain, and black level were used. Two separate investigators reproduced the results. Quantification of the signal intensity of single cells was done with histogram/area functions in the available software (Lasersharp or NIH Image). The cells were outlined manually, and the mean fluorescence intensity was obtained for the delineated regions. Data are presented as relative fluorescent intensity.
Quantitative PCR
For reverse transcription-polymerase chain reaction (RT-PCR), RNA was isolated by following an established protocol (TRIZOL, Gibco Life Technology). Primers were synthesized (BioTez) for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and TGF-ß. Real-time quantitative RT-PCR was performed with a commercially available system (TaqMan, PE Biosystems). Forty cycles of PCR were performed by following the protocol instructions included in the kit, with manganese concentrations of 3 µmol/L for GAPDH and 4 µmol/L for TGF-ß. The primer sequences were as follows:
- GAPDH-F: AAGCTGGTCATCAATGGGAAAC
- GAPDH-R ACCCCATTTGATGTTAGCGG
- GAPDH-P: CATCACCATCTTCCAGGAGCGCGCGAT
- TGFß1-F: TCCCAAACGTCGAGGTGAC
- TGFß1-R: CCATGAGGAGCAGGAAGGG
- TGFß1-P: TGGGCACCATCCATGACATGAACC
- GAPDH-R ACCCCATTTGATGTTAGCGG
Each sample was tested twice. For quantification, the target sequence was normalized in relation to the GAPDH gene.
Microinjection
Microinjection of VSMCs was carried out as described previously.32 PKC- (GIBCO) was dissolved in 20 mmol/L HEPES buffer at a concentration of 1:10. For control experiments, PKC- was first heated (60°C for 10 minutes) and then dissolved in HEPES buffer (1:10). Microinjection was carried out using a microinjector (Nikon). Forty to 70 fL active or denatured PKC- was injected per cell. Cells were then plated on coverslips (Cellocate, Eppendorf). To confirm the efficiency of microinjection, VSMCs were fixed 30 minutes after the procedure and stained for PKC- immunoreactivity. We observed a significantly increased immunoreactivity for both native and denatured PKC- after microinjection. The immunoreactivity was mostly located in the cytosolic region (data not shown).
Antisense Experiments
Phosphorothioate oligodeoxyribonucleotides (ODNs) were purchased from TIB Molbiol. We selected antisense ODNs against the 3'-untranslated region [as (1)] and against the AUG start codon [as (2)] derived from the rat PKC- sequence (accession number X07286).30 The antisense sequence used for PKC-(1) was TCT TTT GTT GAG TTT CA and for PKC-(2) was CAG CCA TTG TCC CCC CCA AC. The sense ODN sequence, a reverse ODN sequence, and a scrambled version were used as controls. The antisense sequence used for PKC- (accession number M18331) against the rat AUG start codon was GCC ATT GAA CAC TAC CAT. The antisense sequence used for PKC- (accession number J04532) was GAT GCT CAT GGC CTC ACA CG. Antisense oligonucleotides directed against PKC-ß1 and PKC-ßII were designed and manufactured by Biognostics. For transfection, the cells were incubated with lipofectin (10 µg/mL, GIBCO) and ODN (10 µmol/L) in the absence of fetal calf serum and antibiotics at 37°C for 4 hours and washed 2 times with medium, and then the medium was changed back to 10% fetal calf serum for 24 hours before the start of the experiments. We have previously shown the effective and specific downregulation of PKC isoforms with this protocol30,31
Construction and Expression of Plasmids Encoding PKC--GFP Fusion Protein
Details of plasmid construction can be found elsewhere.33 Transient transfection into VSMCs was carried out with SuperFect from Qiagen. Cells were seeded on glass coverslips for one day before transfection and washed 2 times with phosphate-buffered saline without Ca2+/Mg2+. They were then incubated with SuperFect and plasmid DNA in M199 culture medium for 3 hour at 37°C and 5% CO2 and washed 2 times with phosphate-buffered saline without Ca2+/Mg2+. After transfection, the cells were cultured at 31.5°C to obtain optimal folding of green fluorescent protein (GFP). The fluorescence of PKC-GFP was detected 24 hours after transfection. Immunofluorescence of TGF-ß and GFP expression was analyzed by confocal microscopy with a UV/laser at 365-nm/488-nm excitation and 460-nm/525-nm barrier-filter sets, respectively. Immunofluorescence was quantified as described earlier. At least 30 cells from 3 experiments were examined.
VSMCs From PKC- Gene-Disrupted Mice
PKC--deficient mice were developed as described elsewhere.34 The mouse VSMCs were isolated and subjected to the same techniques as the rat VSMCs described earlier.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
In resting VSMCs (5 mmol/L glucose), TGF-ß immunoreactivity was visible in the cytosol (Figure 1). Exposure to high (20 mmol/L) glucose led to increased immunoreactivity in the cytosol and the perinuclear region after 6 and 12 hours. After 24 hours, no significant difference in immunoreactivity compared with resting cells was observed. The right-hand panel of Figure 1A shows the semiquantitative analysis of these experiments (>30 cells of 4 independent experiments). Figure 1B shows the Western blot analysis of TGF-ß immunoreactivity in VSMCs after 12-hour exposure to high glucose concentrations or mannose (20 mmol/L). The middle panel shows the densitometric analysis of these experiments (n=4, P
0.05). High glucose induced a significant increase in TGF-ß1 that was independent of osmotic changes. In Figure 1C, the results for quantitative PCR (TaqMan) after 6 hours of high glucose are displayed. In Figure 2 are shown the effects of high glucose on TGF-ß-R1 expression. The upper panel shows the semiquantitative analysis of the confocal photomicrographs after 6, 12, and 24 hours of exposure. High glucose (Fig 2A) led to enhanced immunoreactivity that persisted for >24 hours (>30 cells of 4 independent experiments). TGF-ß-R1 immunoreactivity after 12-hour exposure to high glucose concentrations or mannose (Figure 2B) confirmed the results obtained with immunocytochemistry (n=4, P0.05). In contrast to the effects of high glucose on TGF-ß and TGF-ß-R1, no significant effect was observed on TGF-ß-R2 (Figure 3). Panel A shows the semiquantitative analysis of TGF-ß-R2 immunoreactivity in VSMCs after 6, 12, and 24 hours of high glucose exposure. TGF-ß-R2 immunoreactivity 12 hours after exposure to high glucose or mannose confirmed these results (Figure 3B).
|
|
|
We next addressed whether or not the effects of high glucose were mediated by activation of PKC. High glucose increased total cellular PKC kinase activity after 6 hours by 150% (n=3, P0.05), whereas mannose had only a minor effect (data not shown). We used PKC inhibitors as shown in Figure 4A. The upper panel shows the semiquantitative analysis of TGF-ß1 and TGF-ß-R1/2 immunofluorescence (>30 cells of 4 independent experiments) after 6-hour exposure to high glucose concentrations without and with calphostin C (10-8 mol/L) and staurosporine (5x10-8 mol/L). Staurosporine and calphostin C reduced the effects of 20 mmol/L glucose (6 hours) on TGF-ß and TGF-ß-R1 significantly (n=4, P0.05). These findings were confirmed by Western blot (Figure 4A, lower panel). In contrast, PKC inhibition had no significant effect on the expression of TGF-ß-R2.
|
In the next set of experiments, we used antisense ODNs against the PKC isoforms -, -ß, -, and - to specifically test whether or not these isoforms were responsible for the effects of glucose on TGF-ß1 and TGF-ß-R1 expression. In addition, we used TGF-ß-R2 expression as a control for possible nonspecific and toxic effects of the ODNs on VSMCs. Protein expression was assessed by semiquantitative analysis of confocal photomicrographs (>30 cells of 
7 independent experiments). VSMCs were transfected with antisense, scrambled, and sense ODNs 24 hours before exposure to high glucose concentrations (Figure 4B). Both antisense ODNs against PKC- showed significant inhibition on the effects of glucose on TGF-ß1 and TGF-ß-R1 (n=7, P0.05), whereas scrambled and sense ODNs had no effect. We also found no inhibitory effect of ODNs for PKC isoforms -ß, -, and -. We found no adverse effects of ODN treatment in terms of TGF-ß-R2 expression. To support the data on PKC- downregulation, we isolated VSMCs from PKC--deficient and wild-type mice. High glucose induced TGF-ß1 expression in the cells of the control animals but not in the PKC--deficient mice (Figure 5).
|
To further substantiate the role of PKC-, we microinjected PKC- protein into VSMCs directly to demonstrate that this isoform is responsible for TGF-ß1 and TGF-ß-R1 expression. Protein expression in single cells was assessed by confocal microscopy. Heat-inactivated PKC- served as a control; activity of the protein was assessed by an in vitro phosphorylation assay. The results are shown in Figure 6. PKC- microinjection resulted in upregulation of TGF-ß1 (Figure 6A) and TGF-ß-R1 (Figure 6B), but no effects on TGF-ß-R2 expression were observed (Figure 6C). Heat-inactivated material had no effect.
|
We next overexpressed PKC- in cultured VSMCs by transfection with a plasmid containing a PKC--GFP fusion protein.33 The transfected cells showed significantly increased PKC activity compared with controls (P<0.05, n=4), indicating that the PKC--GFP fusion protein was enzymatically active.33 TGF-ß1 and TGF-ß-R1 expression was made visible by immunocytochemistry with marina blue-labeled secondary antibodies (Molecular Probes). Figure 7 shows the effect of PKC- overexpression on TGF-ß1 (A) and TGF-ßR1 (C). Cells overexpressing PKC- showed increased expression of TGF-ß1 after 24 hours compared with untransfected cells. TGF-ß-R1 expression was increased to a lesser extent (4 independent experiments). As a control, we overexpressed PKC-ßII-GFP fusion protein (Figure 7B). Expression analysis displayed no correlation between PKC-ß and TGF-ß1 expression. No significant alteration in the expression of both proteins was observed in the nontransfected cells (Figures 7A–7C, right-hand panels, open circles). The right-hand panels of Figure 7 show the correlation between expression of PKC- (green fluorescence) and expression of TGF-ß1 and TGF-ßR-1, respectively (n=4, P<0.01). No increased TGF-ß-R2 expression in PKC--overexpressing cells was observed (data not shown).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The important finding in our study was that PKC-
mediated the effects of high glucose on the TGF-ß and its receptors. We demonstrated that the effects of high glucose in vitro induce the expression of both TGF-ß1 and its receptor TGF-ß-R1, whereas no effect was seen on the TGF-ß-R2. Our experiments demonstrate that the glucose-induced TGF-ß and TGF-ß-R1 expression are most likely mediated by PKC-. Microinjection experiments and specific downregulation by antisense ODNs support our hypothesis. VSMCs from PKC- gene-disrupted mice showed no TGF-ß expression. Using specific antisense approaches, we found no evidence that other PKC isoforms play a major role in glucose-induced expression of TGF-ß.
An intracellular increase in PKC-, by direct microinjection or overexpression, increased both TGF-ß and TGF-ß-R1 in VSMCs. The finding of a role for PKC- in glucose-induced TGF-ß expression is supported by our observation that the glucose-induced increased permeability in cultured endothelial cells was also mediated by PKC-.30 Glucose-induced activation of PKC- has also been described by Ganesan et al.35 However, PKC-ßII has been implicated in the intracellular effects of glucose-induced activation of this enzyme family. In 2 rat models of diabetes, the PKC-ßII isoform was preferentially increased in aorta and heart, whereas PKC- did not change significantly.26 An increased expression of PKC-ßII was also recently reported in cultured VSMCs.36 Further support of a role for PKC-ßII in hyperglycemia came from a study by Ishii et al,28 who showed that an oral inhibitor of PKC-ß ameliorates vascular dysfunction in diabetic rats. However, most of the evidence of a role for PKC-ß in glucose-induced cell activation stems from experiments with a selective PKC-ß inhibitor.37 Possibly the compound used in those studies also inhibited PKC-. Another explanation might be differential expression of PKC isoforms in different vascular cell types or under different culture conditions.
Our previous finding that high glucose increases permeability by PKC- was obtained in endothelial cells.30 We could not detect expression of PKC-ß by Western blot and RT-PCR in endothelial cells.29 Possibly, glucose influences PKC- in cell types where PKC-ß is absent. However, we have previously shown that a high glucose concentration induces translocation of both PKC- and -ß in VSMCs.31 Hyperglycemia-related effects on PKC in different cell types might vary. In skeletal muscle from hyperglycemic animals, downregulation of PKC activity was observed, whereas in other tissues, PKC activity was increased.38 Furthermore, Donnelly et al39 found increased PKC-
in skeletal muscle from diabetic animals. We cannot rule out the possibility that other PKC isoforms mediate the effects of high glucose and hyperglycemia in other cell types and tissues. However, in our animal experiments, we observed an increase in PKC- expression. This observation is supported by increased PKC- expression in myocardial tissue from diabetic animals, suggesting a role for PKC- in the cellular response to hyperglycemia in the heart.40 The increased expression and colocalization of both PKC- and TGF-ß further support the hypothesis that high extracellular glucose mediates its effects on TGF-ß via PKC-.
Similar findings to those reported here have been observed in mesangial cells, adipocytes, and macrophages.5,9,41–43 Glucose-induced TGF-ß expression might directly contribute to increased expression of TGF-ß in the vascular wall under hyperglycemic conditions. In fact, the in vitro findings of TGF-ß induction by high glucose concentrations are accompanied by in vivo studies demonstrating increased TGF-ß expression during hyperglycemia in animal models of diabetes.1 Iwano et al44 observed increased intraglomerular TGF-ß1 mRNA expression in patients with diabetes mellitus. No results have been obtained in the vasculature under these conditions.
Less information is available on TGF-ß receptor protein expression.45 We observed increased expression of both a 105-kDa and a 65-kDa TGF-ß receptor after exposure to glucose. Ahuja et al46 observed concomitant expression of both TGF-ß1 and its receptor protein in lymphocytes. The expression of both components in the same VSMCs suggests that hyperglycemia induces an autocrine feedback mechanism. Hyperglycemia would thereby not only induce TGF-ß, which acts on other cell types to increase matrix expression, but also enhance this effect by concomitantly causing TGF-ß to express its own receptor.47 Such a model implies that both TGF-ß and its receptors are regulated by similar mechanisms, including PKC-responsive signaling pathways. However, our data also suggest that TGF-ß-R1 and TGF-ß-R2 are differentially regulated. This finding is in contrast to the report by Sharma et al,4 who observed an increase in TGF-ß-R2 mRNA in the kidneys of diabetic animals. Because we did not assess mRNA levels for the receptors, it is possible that the processing of the 2 receptors is different.16 The differential expression of TGF-ß receptor proteins in our study raises the possibility that TGF-ß exerts specific effects in hyperglycemia.
Perspective
Our findings underscore TGF-ß and its receptors as potential therapeutic targets. Because PKC- appears to mediate the extracellular stimuli that induce TGF-ß expression, specific inhibition of the PKC- isoform might diminish the adverse effects of hyperglycemia in diabetes mellitus.
|
Acknowledgments |
|---|
This work was supported by a grant in aid from the Deutsche Forschungsgemeinschaft to Hermann Haller (Ha 1388-7/1).
Received December 3, 2002; first decision December 31, 2002; accepted July 14, 2003.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Eddy AE. Molecular insights into renal interstitial fibrosis. J Am Soc Nephrol. 1996; 7: 2495–2508.[Abstract]
2. Sharma K, Ziyadeh FN. Hyperglycemia and diabetic kidney disease: the case for transforming growth factor-ß as a key mediator. Diabetes. 1995; 44: 1139–1146.[Abstract]
3. Sharma K, Ziyadeh FN. Renal hypertrophy is associated with upregulation of TGF-ß1 gene expression in diabetic BB rat and NOD mouse. Am J Physiol. 1994; 267: F1094–F1098.[Medline] [Order article via Infotrieve]
4. Sharma K, Jin Y, Guo J, Ziyadeh FN. Neutralization of TGF-ß by anti-TGF-ß antibody attenuates kidney hypertrophy and the enhanced extracellular matrix gene expression in STZ-induced diabetic mice. Diabetes. 1996; 45: 522–530.[Abstract]
5. Cosio FG. Effects of high glucose concentrations on human mesangial cell proliferation. J Am Soc Nephrol. 1995; 5: 1600–1609.[Abstract]
6. Kolm V, Sauer U, Olgemooller B, Schleicher ED. High glucose-induced TGF-ß1 regulates mesangial production of heparan sulfate proteoglycan. Am J Physiol. 1996; 270: F812–F821.[Medline] [Order article via Infotrieve]
7. Kreisberg JI, Garoni JA, Radnik R, Ayo SH. High glucose and TGF-ß1 stimulate fibronectin gene expression through a cAMP response element. Kidney Int. 1994; 46: 1019–1024.[Medline] [Order article via Infotrieve]
8. Phillips AO, Topley N, Steadman R, Morrisey K, Williams JD. Induction of TGF-ß1 synthesis in D-glucose primed human proximal tubular cells by IL-1ß and TNF-. Kidney Int. 1996; 50: 1546–1554.[Medline]
[Order article via Infotrieve]
9. Reinhold D, Ansorge S, Schleicher ED. Elevated glucose levels stimulate transforming growth factor-ß1 (TGF-ß1), suppress interleukin IL-2, IL-6 and IL-10 production and DNA synthesis in peripheral blood mononuclear cells. Horm Metab Res. 1996; 28: 267–270.[Medline] [Order article via Infotrieve]
10. Rocco MV, Chen Y, Goldfarb S, Ziyadeh FN. Elevated glucose stimulates TGF-ß gene expression and bioactivity in proximal tubule. Kidney Int. 1992; 41: 107–114.[Medline] [Order article via Infotrieve]
11. van Det NF, Verhagen NA, Tamsma JT, Berden JH, Bruijn JA, Daha MR, van der Woude FJ. Regulation of glomerular epithelial cell production of fibronectin and transforming growth factor-ß by high glucose, not by angiotensin II. Diabetes. 1997; 46: 834–840.[Abstract]
12. Wahab NA, Harper K, Mason RM. Expression of extracellular matrix molecules in human mesangial cells in response to prolonged hyperglycaemia. Biochem J. 1996; 316: 985–992.[Medline] [Order article via Infotrieve]
13. Ziyadeh FN, Sharma K, Ericksen M, Wolf G. Stimulation of collagen gene expression and protein synthesis in murine mesangial cells by high glucose is mediated by autocrine activation of transforming growth factor-ß. J Clin Invest. 1994; 93: 536–542.[Medline] [Order article via Infotrieve]
14. Shankland SJ, Scholey JW, Ly H, Thai K. Expression of transforming growth factor-ß1 during diabetic renal hypertrophy. Kidney Int. 1994; 46: 430–442.[Medline] [Order article via Infotrieve]
15. Pfeiffer A, Middelberg-Bisping K, Drewes C, Schatz H. Elevated plasma levels of transforming growth factor-ß1 in NIDDM. Diabetes Care. 1996; 19: 1113–1117.[Abstract]
16. Wells RG, Yankelev H, Lin HY, Lodish HF. Biosynthesis of the type I and type II TGF-ß receptors: implications for complex formation. J Biol Chem. 1997; 272: 11444–11451.
17. Koli KM, Arteaga CL. Processing of the transforming growth factor-ß type I and II receptors: biosynthesis and ligand-induced regulation. J Biol Chem. 1997; 272: 6423–6427.
18. Guh JY, Yang ML, Yang YL, Chang CC, Chuang LY. Captopril reverses high-glucose-induced growth effects on LLC-PK1 cells partly by decreasing transforming growth factor-ß receptor protein expressions. J Am Soc Nephrol. 1996; 7: 1207–1215.[Abstract]
19. Isono M, Mogyorosi A, Han DC, Hoffman BB, Ziyadeh FN. Stimulation of TGF-ß type II receptor by high glucose in mouse mesangial cells and in diabetic kidney. Am J Physiol Renal Physiol. 2000; 278: F830–F838.
20. Craven PA, Studer RK, Negrete H, DeRubertis FR. Protein kinase C in diabetic nephropathy. J Diabetes Complicat. 1995; 9: 241–245.[CrossRef][Medline] [Order article via Infotrieve]
21. Derubertis FR, Craven PA. Activation of protein kinase C in glomerular cells in diabetes: mechanisms and potential links to the pathogenesis of diabetic glomerulopathy. Diabetes. 1994; 43: 1–8.[Abstract]
22. Williams B, Tsai P, Schrier RW. Glucose-induced downregulation of angiotensin II and arginine vasopressin receptors in cultured rat aortic vascular smooth muscle cells: role of protein kinase C. J Clin Invest. 1992; 90: 1992–1999.[Medline] [Order article via Infotrieve]
23. Haller H, Drab M, Luft FC. The role of hyperglycemia and hyperinsulinemia in the pathogenesis of diabetic angiopathy. Clin Nephrol. 1996; 46: 246–255.[Medline] [Order article via Infotrieve]
24. Williams B, Schrier RW. Characterization of glucose-induced in situ protein kinase C activity in cultured vascular smooth muscle cells. Diabetes. 1992; 41: 1464–1472.[Abstract]
25. Haller H, Lindschau C, Luft FC. Role of protein kinase C in intracellular signaling. Ann N Y Acad Sci. 1994; 733: 313–324.[Medline] [Order article via Infotrieve]
26. Inoguchi T, Battan R, Handler E, Sportsman JR, Heath W, King GL. Preferential elevation of protein kinase C isoform ßII and diacylglycerol levels in the aorta and heart of diabetic rats: differential reversibility to glycemic control by islet cell transplantation. Proc Natl Acad Sci U S A. 1992; 89: 11059–11063.
27. Ishii H, Koya D, King GL. Protein kinase C activation and its role in the development of vascular complications in diabetes mellitus. J Mol Med. 1998; 76: 21–31.[CrossRef][Medline] [Order article via Infotrieve]
28. Ishii H, Jirousek MR, Koya D, Takagi C, Xia P, Clermont A, Bursell SE, Kern TS, Ballas LM, Heath WF, Stramm LE, Feener EP, King GL. Amelioration of vascular dysfunction in diabetic rats by an oral PKC-ß inhibitor. Science. 1996; 272: 699–700.[Medline] [Order article via Infotrieve]
29. Haller H, Ziegler W, Lindschau C, Luft FC. Endothelial cell tyrosine kinase receptor and G-protein coupled receptor activation involves distinct protein kinase C isoforms. Arterioscler Thromb Vasc Biol. 1996; 16: 678–686.
30. Hempel A, Maasch C, Heintze U, Lindschau C, Dietz R, Luft FC, Haller H. High glucose concentrations increase endothelial cell permeability via activation of protein kinase C-. Circ Res. 1997; 81: 363–371.
31. Haller H, Baur E, Quass P, Behrend M, Lindschau C, Distler A, Luft FC. High glucose concentrations and protein kinase C isoforms in vascular smooth muscle cells. Kidney Int. 1995; 47: 1057–1067.[Medline] [Order article via Infotrieve]
32. Haller H, Lindschau C, Maasch C, Olthoff H, Kurscheid D, Luft FC. Integrin-induced protein kinase C and C translocation to focal adhesions mediates vascular smooth muscle cell spreading. Circ Res. 1998; 82: 157–165.
33. Maasch C, Wagner S, Lindschau C, Alexander G, Buchner K, Gollasch M, Luft FC, Haller H. Receptor-dependent protein kinase C targeting with GFP technology in vascular smooth muscle cells. FASEB J. 2000; 14: 1653–1663.
34. Leitges M, Plohmann M, Standaert ML, Bandyopadhyay G, Sajan MP, Kanoh Y, Farese RV. Knockout of PKC- enhances insulin signaling through PI3K. Mol Endocrinol. 2002; 16: 847–858.
35. Ganesan S, Calle R, Zawalich K, Smallwood JI, Zawalich WS, Rasmussen H. Glucose-induced translocation of protein kinase C in rat pancreatic islets. Proc Natl Acad Sci U S A. 1990; 87: 9893–9897.
36. Kunisaki M, Fumio U, Nawata H, King GL. Vitamin E normalizes diacylglycerol-protein kinase C activation induced by hyperglycemia in rat vascular tissues. Diabetes. 1996; 45 (suppl 3): S117–S119.[Medline] [Order article via Infotrieve]
37. Koya D, Jirousek MR, Lin YW, Ishii H, Kuboki K, King GL. Characterization of protein kinase C-ß isoform activation on the gene expression of transforming growth factor-ß, extracellular matrix components, and prostanoids in the glomeruli of diabetic rats. J Clin Invest. 1997; 100: 115–126.[Medline] [Order article via Infotrieve]
38. Avignon A, Yamada K, Zhou X, Spencer B, Cardona O, Saba-Siddique S, Galloway L, Standaert ML, Farese RV. Chronic activation of protein kinase C in soleus muscles and other tissues of insulin-resistant type II diabetic Goto-Kakizaki (GK), obese/aged, and obese/Zucker rats: a mechanism for inhibiting glycogen synthesis. Diabetes. 1996; 45: 1396–1404.[Abstract]
39. Donnelly R, Reed MJ, Azhar S, Reaven GM. Expression of the major isoenzyme of protein kinase-C in skeletal muscle, nPKC-
, varies with muscle type and in response to fructose-induced insulin resistance. Endocrinology. 1994; 135: 2369–2374.[Abstract]
40. Giles TD, Ouyang J, Kerut EK, Given MB, Allen GE, McIlwain EF, Greenberg SS. Changes in protein kinase C in early cardiomyopathy and in gracilis muscle in the BB/Wor diabetic rat. Am J Physiol. 1998; 274: H295–H307.[Medline] [Order article via Infotrieve]
41. Fumo P, Kuncio GS, Ziyadeh FN. PKC and high glucose stimulate collagen 1 (IV) transcriptional activity in a reporter mesangial cell line. Am J Physiol. 1994; 267: F632–F638.[Medline]
[Order article via Infotrieve]
42. Haneda M, Kikkawa R, Sugimoto T, Koya D, Araki S, Togawa M, Shigeta Y. Abnormalities in protein kinase C and MAP kinase cascade in mesangial cells cultured under high glucose conditions. J Diabetes Complicat. 1995; 9: 246–248.[CrossRef][Medline] [Order article via Infotrieve]
43. Studer RK, Craven PA, DeRubertis FR. Role for protein kinase C in the mediation of increased fibronectin accumulation by mesangial cells grown in high-glucose medium. Diabetes. 1993; 42: 118–126.[Abstract]
44. Iwano M, Kubo A, Nishino T, Sato H, Nishioka H, Akai Y, Kurioka H, Fujii Y, Kanauchi M, Shiiki H, Dohi K. Quantification of glomerular TGF-ß1 mRNA in patients with diabetes mellitus. Kidney Int. 1996; 49: 1120–1126.[Medline] [Order article via Infotrieve]
45. MacKay K, Striker LJ, Stauffer JW, Doi T, Agodoa LY, Striker GE. Transforming growth factor-ß: murine glomerular receptors and responses of isolated glomerular cells. J Clin Invest. 1989; 83: 1160–1167.[Medline] [Order article via Infotrieve]
46. Ahuja SS, Shrivastav S, Danielpour D, Balow JE, Boumpas DT. Regulation of transforming growth factor-ß1 and its receptor by cyclosporine in human T lymphocytes. Transplantation. 1995; 60: 718–723.[Medline] [Order article via Infotrieve]
47. Yamamoto T, Nakamura T, Noble NA, Ruoslahti E, Border WA. Expression of transforming growth factor-ß is elevated in human and experimental diabetic nephropathy. Proc Natl Acad Sci U S A. 1993; 90: 1814–1818.
This article has been cited by other articles:
 |
|
 |
|
  C. E. Hills, N. Al-Rasheed, N. Al-Rasheed, G. B. Willars, and N. J. Brunskill C-peptide reverses TGF-{beta}1-induced changes in renal proximal tubular cells: implications for treatment of diabetic nephropathy Am J Physiol Renal Physiol, March 1, 2009; 296(3): F614 - F621. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Spinetti, N. Kraenkel, C. Emanueli, and P. Madeddu Diabetes and vessel wall remodelling: from mechanistic insights to regenerative therapies Cardiovasc Res, May 1, 2008; 78(2): 265 - 273. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Meier, J. Menne, J.-K. Park, and H. Haller Nailing down PKC isoform specificity in diabetic nephropathy two's company, three's a crowd Nephrol. Dial. Transplant., September 1, 2007; 22(9): 2421 - 2425. [Full Text] [PDF]
|
|
|
|
 |
|
 M. Meier, J. Menne, J.-K. Park, M. Holtz, F. Gueler, T. Kirsch, M. Schiffer, M. Mengel, C. Lindschau, M. Leitges, et al. Deletion of Protein Kinase C-{varepsilon} Signaling Pathway Induces Glomerulosclerosis and Tubulointerstitial Fibrosis In Vivo J. Am. Soc. Nephrol., April 1, 2007; 18(4): 1190 - 1198. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Mikaelsson, A. H. Danesh-Manesh, A. Luppert, M. Jeddi-Tehrani, M.-R. Rezvany, R. A. Sharifian, R. Safaie, A. Roohi, A. Osterborg, F. Shokri, et al. Fibromodulin, an extracellular matrix protein: characterization of its unique gene and protein expression in B-cell chronic lymphocytic leukemia and mantle cell lymphoma Blood, June 15, 2005; 105(12): 4828 - 4835. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Rask-Madsen and G. L. King Proatherosclerotic Mechanisms Involving Protein Kinase C in Diabetes and Insulin Resistance Arterioscler. Thromb. Vasc. Biol., March 1, 2005; 25(3): 487 - 496. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Menne, J.-K. Park, M. Boehne, M. Elger, C. Lindschau, T. Kirsch, M. Meier, F. Gueler, A. Fiebeler, F. H. Bahlmann, et al. Diminished Loss of Proteoglycans and Lack of Albuminuria in Protein Kinase C-{alpha}--Deficient Diabetic Mice Diabetes, August 1, 2004; 53(8): 2101 - 2109. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||